scholarly journals Transcriptome-based discovery of genes and networks related to RSC3Q-mediated resistance to Soybean mosaic virus in soybean

2020 ◽  
Vol 71 (12) ◽  
pp. 987
Author(s):  
Yuan Yuan ◽  
Yongqing Yang ◽  
Jinlong Yin ◽  
Yingchao Shen ◽  
Bowen Li ◽  
...  
Keyword(s):  
Salicylic Acid ◽  
Abscisic Acid ◽  
Jasmonic Acid ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Early Stage ◽  
Soybean Mosaic Virus ◽  
Pathway Enrichment Analysis ◽  
Post Inoculation ◽  
Resistance Response

Abstract Soybean mosaic virus (SMV) is a worldwide disease of soybean (Glycine max (L.) Merr.) that can cause serious reduction in yield and seed quality. Soybean cv. Qihuang-1 is an important source of resistance to SMV in China, carrying a resistance gene (RSC3Q) against SMV strain SC3. In order to discover genes and networks regulated by RSC3Q-mediated resistance in Qihuang-1, we analysed transcriptome data of a pair of near-isogenic lines, R (RSC3Q) and S (rSC3Q), from the cross Qihuang-1 × Nannong 1138-2 (rSC3Q), after SC3 inoculation. Many differentially expressed genes (DEGs) were identified in the R and S lines at 6, 20 and 48 h post-inoculation. Based on pathway-enrichment analysis of DEGs, three genes encoding calmodulin-like protein (Glyma03g28650, Glyma19g31395 and Glyma11g33790) with downregulated expression in the S line were identified in the plant–pathogen interaction pathway at 6 h post-inoculation. Analyses by quantitative real-time PCR were performed to verify that these three genes were not beneficial for SMV infection. Our results also revealed a complex plant-hormone signal network in RSC3Q-mediated resistance during the early stage of SMV infection. Expression of jasmonic acid repressor genes (TIFY/JAZ) and abscisic acid-induced genes (PP2C3a) was upregulated in the R line but not the S line. More DEGs related to indole-3-acetic acid were found in the R line than the S line, and no salicylic acid-related DEGs were identified. These results suggest that suppression of jasmonic acid or promotion of abscisic acid is important for RSC3Q-mediated resistance against SC3, and that salicylic acid may not act as a main regulator of RSC3Q-mediated resistance during early stages of SC3 infection. Growth and development were greatly affected through RSC3Q-mediated resistance responses after SC3 infection. Our understanding would be enhanced by identification of factors associated with RSC3Q that help to trigger the resistance response.

scholarly journals Salicylic Acid and Jasmonic Acid Are Essential for Systemic Resistance Against Tobacco mosaic virus in Nicotiana benthamiana

2014 ◽  
Vol 27 (6) ◽  
pp. 567-577 ◽  
Author(s):  
Feng Zhu ◽  
De-Hui Xi ◽  
Shu Yuan ◽  
Fei Xu ◽  
Da-Wei Zhang ◽  
...  
Keyword(s):  
Salicylic Acid ◽  
Jasmonic Acid ◽  
Tobacco Mosaic Virus ◽  
Mosaic Virus ◽  
Nicotiana Benthamiana ◽  
Foliar Application ◽  
Mass Spectrometry Analysis ◽  
Systemic Resistance ◽  
Long Distance ◽  
Resistance Response

Systemic resistance is induced by pathogens and confers protection against a broad range of pathogens. Recent studies have indicated that salicylic acid (SA) derivative methyl salicylate (MeSA) serves as a long-distance phloem-mobile systemic resistance signal in tobacco, Arabidopsis, and potato. However, other experiments indicate that jasmonic acid (JA) is a critical mobile signal. Here, we present evidence suggesting both MeSA and methyl jasmonate (MeJA) are essential for systemic resistance against Tobacco mosaic virus (TMV), possibly acting as the initiating signals for systemic resistance. Foliar application of JA followed by SA triggered the strongest systemic resistance against TMV. Furthermore, we use a virus-induced gene-silencing–based genetics approach to investigate the function of JA and SA biosynthesis or signaling genes in systemic response against TMV infection. Silencing of SA or JA biosynthetic and signaling genes in Nicotiana benthamiana plants increased susceptibility to TMV. Genetic experiments also proved the irreplaceable roles of MeSA and MeJA in systemic resistance response. Systemic resistance was compromised when SA methyl transferase or JA carboxyl methyltransferase, which are required for MeSA and MeJA formation, respectively, were silenced. Moreover, high-performance liquid chromatography–mass spectrometry analysis indicated that JA and MeJA accumulated in phloem exudates of leaves at early stages and SA and MeSA accumulated at later stages, after TMV infection. Our data also indicated that JA and MeJA could regulate MeSA and SA production. Taken together, our results demonstrate that (Me)JA and (Me)SA are required for systemic resistance response against TMV.

scholarly journals Role of Soybean mosaic virus–Encoded Proteins in Seed and Aphid Transmission in Soybean

2013 ◽  
Vol 103 (9) ◽  
pp. 941-948 ◽  
Author(s):  
Sushma Jossey ◽  
Houston A. Hobbs ◽  
Leslie L. Domier
Keyword(s):  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Seed Transmission ◽  
Aphid Transmission ◽  
Plant Introduction ◽  
Sequence Motif ◽  
Coding Region ◽  
Encoded Proteins ◽  
Seed Transmissibility

Soybean mosaic virus (SMV) is seed and aphid transmitted and can cause significant reductions in yield and seed quality in soybean (Glycine max). The roles in seed and aphid transmission of selected SMV-encoded proteins were investigated by constructing mutants in and chimeric recombinants between SMV 413 (efficiently aphid and seed transmitted) and an isolate of SMV G2 (not aphid or seed transmitted). As previously reported, the DAG amino acid sequence motif near the amino terminus of the coat protein (CP) was the major determinant in differences in aphid transmissibility of the two SMV isolates, and helper component proteinase (HC-Pro) played a secondary role. Seed transmission of SMV was influenced by P1, HC-Pro, and CP. Replacement of the P1 coding region of SMV 413 with that of SMV G2 significantly enhanced seed transmissibility of SMV 413. Substitution in SMV 413 of the two amino acids that varied in the CPs of the two isolates with those from SMV G2, G to D in the DAG motif and Q to P near the carboxyl terminus, significantly reduced seed transmission. The Q-to-P substitution in SMV 413 also abolished virus-induced seed-coat mottling in plant introduction 68671. This is the first report associating P1, CP, and the DAG motif with seed transmission of a potyvirus and suggests that HC-Pro interactions with CP are important for multiple functions in the virus infection cycle.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals An Avirulent Strain of Soybean Mosaic Virus Reverses the Defensive Effect of Abscisic Acid in a Susceptible Soybean Cultivar

Viruses ◽  
2019 ◽  
Vol 11 (9) ◽  
pp. 879 ◽  
Author(s):  
Mazen Alazem ◽  
Kristin Widyasari ◽  
Kook-Hyung Kim
Keyword(s):  
Abscisic Acid ◽  
Mosaic Virus ◽  
Rna Silencing ◽  
Defense Mechanisms ◽  
Virulent Strain ◽  
Soybean Mosaic Virus ◽  
Resistance Mechanisms ◽  
Soybean Cultivar ◽  
Avirulent Strain ◽  
Rapid Induction

In soybean cultivar L29, the Rsv3 gene is responsible for extreme resistance (ER) against the soybean mosaic virus avirulent strain G5H, but is ineffective against the virulent strain G7H. Part of this ER is attributed to the rapid increase in abscisic acid (ABA) and callose, and to the rapid induction of several genes in the RNA-silencing pathway. Whether these two defense mechanisms are correlated or separated in the ER is unknown. Here, we found that ABA treatment of L29 plants increased the expression of several antiviral RNA-silencing genes as well as the PP2C3a gene, which was previously shown to increase callose accumulation; as a consequence, ABA increased the resistance of L29 plants to G7H. The effect of ABA treatment on these genes was weaker in the rsv3-null cultivar (Somyungkong) than in L29. Besides, G5H-infection of Somyungkong plants subverted the effect of ABA leading to reduced callose accumulation and decreased expression of several RNA-silencing genes, which resulted in increased susceptibility to G5H infection. ABA treatment, however, still induced some resistance to G7H in Somyungkong, but only AGO7b was significantly induced. Our data suggest that Rsv3 modulates the effect of ABA on these two resistance mechanisms, i.e., callose accumulation and the antiviral RNA-silencing pathway, and that in the absence of Rsv3, some strains can reverse the effect of ABA and thereby facilitate their replication and spread.

Interactions between soybean, Bradyrhizobium japonicum and Soybean mosaic virus: the effects depend on the interaction sequence

2019 ◽  
Vol 46 (11) ◽  
pp. 1036 ◽  
Author(s):  
Sofía Andreola ◽  
Marianela Rodriguez ◽  
Rodrigo Parola ◽  
Sergio Alemano ◽  
Ramiro Lascano
Keyword(s):  
Salicylic Acid ◽  
Virus Infection ◽  
Mosaic Virus ◽  
Bradyrhizobium Japonicum ◽  
Crop Yields ◽  
Soybean Mosaic Virus ◽  
Single Infection ◽  
Sugar Accumulation ◽  
Primary Metabolism ◽  
Tripartite Interaction

The symbiotic interaction between soybean and nitrogen-fixing rhizobia can lead to plant growth promotion and induced systemic responses. Symbiotic interactions may increase tolerance/resistance to abiotic/biotic stress conditions, but are also sensitive to environmental conditions. Soybean mosaic virus (SMV), which is transmitted by seed and aphids, severely affects crop yields in many areas of the world, consequently virus infection may precede rhizobium infection or vice versa in the field. With the hypothesis that sequence of interaction is a key determinant of the resulting responses; growth, primary metabolism and defence responses were evaluated in different interaction sequences. Results showed that vegetative growth was promoted by Bradyrhizobium japonicum (Bj) inoculation and drastically impaired by SMV infection. The negative effect of SMV single infection on soybean growth parameters was correlated with photosynthesis decrease, sugar accumulation, oxidative damage, and increases in salicylic acid levels. Bj inoculation partially reversed virus-induced symptoms, mainly at Bj-SMV sequence. However, this symptom attenuation did not correlate with less virus accumulation. Nodulation was negatively affected by SMV, particularly when virus infection was previous to Bj inoculation (SMV-Bj). Defence related hormones (salicylic acid (SA)/jasmonic acid (JA)) and the expression of defence-related genes were dependent on the sequence of tripartite interaction. The present study showed that the sequence of the tripartite interaction among soybean, Bj and SMV determinates the tolerance/susceptibility to SMV infection, through changes in the defence mechanism and metabolic alteration.

Mapping tightly linked genes controlling potyvirus infection at the Rsv1 and Rpv1 region in soybean

Genome ◽  
2002 ◽  
Vol 45 (3) ◽  
pp. 592-599 ◽  
Author(s):  
M A Gore ◽  
A J Hayes ◽  
S C Jeong ◽  
Y G Yue ◽  
G R Buss ◽  
...  
Keyword(s):  
Disease Resistance ◽  
Microsatellite Markers ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Resistance Response ◽  
Marker Data ◽  
Glycine Max L ◽  
Resistance Gene Candidate ◽  
Rflp Rapd ◽  
Insight Into

Soybean mosaic virus (SMV) and peanut mottle virus (PMV) are two potyviruses that cause yield losses and reduce seed quality in infested soybean (Glycine max (L.) Merr.) fields throughout the world. Rsv1 and Rpv1 are genes that provide soybean with resistance to SMV and PMV, respectively. Isolating and characterizing Rsv1 and Rpv1 are instrumental in providing insight into the molecular mechanism of potyvirus recognition in soybean. A population of 1056 F2 individuals from a cross between SMV- and PMV-resistant line PI 96983 (Rsv1 and Rpv1) and the susceptible cultivar 'Lee 68' (rsv1 and rpv1) was used in this study. Disease reaction and molecular-marker data were collected to determine the linkage relationship between Rsv1, Rpv1, and markers that target candidate disease-resistance genes. F2 lines showing a recombination between two of three Rsv1-flanking microsatellite markers were selected for fine mapping. Over 20 RFLP, RAPD, and microsatellite markers were used to map 38 loci at high-resolution to a 6.8-cM region around Rsv1 and Rpv1. This study demonstrates that Rsv1 and Rpv1 are tightly linked at a distance of 1.1 cM. In addition, resistance-gene candidate sequences were mapped to positions flanking and cosegregating with these resistance loci. Based on comparisons of genetic markers and disease reactions, it appears likely that several tightly linked genes are conditioning a resistance response to SMV. We discuss the specifics of these findings and investigate the utility of two disease resistance related probes for the screening of SMV or PMV resistance in soybean.Key words: NBS, multigene family, and disease resistance.

scholarly journals First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
S. Lim ◽  
Y.-H. Lee ◽  
D. Igori ◽  
F. Zhao ◽  
R. H. Yoo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
South Korea ◽  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Nucleotide Sequences ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

Spatio-temporal characterisation of changes in the resistance of widely grown soybean cultivars to Soybean mosaic virus across a century of breeding in China

2018 ◽  
Vol 69 (4) ◽  
pp. 395 ◽  
Author(s):  
Le Gao ◽  
Shi Sun ◽  
Kai Li ◽  
Liwei Wang ◽  
Wensheng Hou ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Disease Index ◽  
Soybean Cultivars ◽  
Individual Strain ◽  
Glycine Max L ◽  
Spatio Temporal ◽  
River Valleys ◽  
Over Time

Soybean mosaic virus (SMV) causes significant yield losses and seed-quality deterioration in the soybean (Glycine max (L.) Merr.) growing areas of China, and breeding disease-resistant cultivars is the most common approach for controlling the spread of the disease and the destruction of soybean crop. In this study, 97 widely grown soybean cultivars representing nine decades (1923–2006) of breeding from the four main soybean-producing subregions in China (Northern Heilongjiang (NH), Mid-Southern Heilongjiang (MSH), Jilin-Liaoning (JL) and Yellow–Huai-Hai River Valleys (YHH)) were inoculated with six prevalent SMV strains: SC3, SC7, SC8, SC11, SC15 and SC18. The average disease index (ADI) of the six SMV strains ranged from 26.95 to 48.97, and the numbers of resistant and susceptible cultivars to the six SMV strains ranged from 27 (27.8%) to 64 (66.0%) and 33 (34.0%) to 70 (72.2%), respectively. The ADIs of cultivars from NH, MSH, JL and YHH were 50.82, 47.27, 43.10 and 33.05, respectively. Soybean cultivars released in the 1940s and 1960s had the highest and lowest ADI values, 53.95 and 32.03, respectively. From NH and JL, all individual strain disease index (DI) values exhibited decreasing trend over time, but no decreasing trend in DI values was observed from MSH. From YHH, DI values for SC3 and SC18 displayed apparent increasing trend over time, and DI values for SC15 showed an obvious decreasing trend. In all, 24 soybean cultivars were identified as having broad-spectrum resistance, with ADI values ranging from 0.80 to 35.52 for the six SMV strains, and 13 soybean cultivars were identified as highly resistant to at least one SMV strain. The findings of this study will contribute to monitoring the pattern of spatio-temporal variation in SMV resistance in different soybean-producing areas of China and facilitate conventional and molecular breeding programs for SMV resistance in soybean.

Sign in / Sign up

Export Citation Format

Share Document