First Report of Bacterial Canker on Blueberry (Vaccinium corymbosum) Caused by Pseudomonas syringae pv. syringae in Serbia

During May 2021, necrosis of young twigs and flower buds were observed on two-year-old highbush blueberry plants (Vaccinium corymbosum) cv. Draper, in a 1 hectare orchard in the municipality of Šabac, Serbia. Disease symptoms included reddish-brown to black irregularly shaped cankers developing on the shoot tips that extended downwards along the branches. In some plants, cankers surrounded the stem, causing shoot-tip dieback and necrosis of the buds. Beneath the bark, a distinct margin between diseased and healthy tissue was visible. A few weeks before symptoms development, seven freezing events with temperature from -3°C to -1°C, and five near-freezing temperatures were recorded in this area, leading to the hypothesis that symptoms were associated to the presence of ice nucleating bacteria belonging to Pseudomonas syringae. The observed disease incidence was 80%, while 10% of the plants died. Bacteria were isolated from symptomatic tissue on King’s medium B (KB). After 2 to 3 days of incubation at 27°C, predominantly grey-whitish, shiny, round, convex bacterial colonies were observed on agar plates. Ten isolates producing a fluorescent pigment on KB were selected for further characterization by biochemical and molecular tests. The isolates were Gram, oxidase and arginine-dihydrolase negative, levan positive, induced hypersensitive response on tobacco leaves and showed no pectinolytic activity on potato slices. Based on the results of API 20E and API 20NE tests (BioMerieux, France), and the fact that isolates did not utilize tartrate nor had tyrosinase activity, they were preliminarly identified as Pseudomonas syrinage pv. syringae (Braun-Kiewnick and Sands 2001). Additionally, all tested isolates had ice-nucleation activity at -5°C. The syrB gene responsible for syringomycin synthesis, was amplified in all isoaltes with the specific primer pair B1/B2 (Sorensen et al. 1998). The 16S rRNA gene sequences of five selected isolates (GenBank MZ410287 to 91) showed 100% identity to P. s. pv. syringae isolated from Prunus avium in United Kingdom (GenBank CP026568) and France (GenBank LT962480). Sequences of gyrB gene (Sarkar and Guttman 2004) of two selected isolates (GenBank MZ420633 and MZ420634) showed 98,44% identity to the P. s. pv. syrinage strain isolated in France (GenBank LT962480). Pathogenicity of the isolates was confirmed on 2-year-old blueberry plants cv. Draper, by inoculating two plants per isolate. One-cm long wounds were made on branches using a scalpel and 20 µl of bacterial suspension (106 CFU/ml) was infiltrated into the tissue. The cuts were then covered with moist sterile cotton pads and wraped in parafilm for 3 days. Inoculation was also performed on two leaves per plant by needleless syringe infiltration (106 CFU/ml). Sterile distilled water was used as a negative control. Plants were maintained in greenhouse at 27°C day and 15°C night temperature. Three weeks after inoculation, the inoculated branches and leaves developed necrosis, leaves spots and cankers respectively, resembling the natural infection. Symptoms were not observed on the control plants. Bacteria were reisolated from symptomatic tissue and their identity was confirmed by amplifying the syrB gene sequence and additional biochemical tests. This is the first report of bacterial canker of highbush blueberry caused by P. s. pv. syringae in Serbia. In Europe, there was only one report on Pseudomonas spp. causing disease on blueberry leaves in Poland (Kaluzna et al. 2013). Due to market demands and export potential, blueberry production in Serbia has been rapidly increasing. In 2015, highbush blueberry was cultivated on 220 ha, while in 2020 the area increased to 1899 ha. However, under favourable environmental conditions, blueberry production might be severely affected by bacterial canker. References: Braun-Kiewnick, A. and Sands, D.C. Page 84 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. Kaluzna, M., et al. 2013. J Plant Protec Res 53:32. Sarkar, S. F., and Guttman, D. S. 2004. Appl. Environ. Microbiol. 70:1999. https://doi.org/10.1128 Sorensen, K. N., et al. 1998. Appl. Environ. Microbiol. 64:226.

Download Full-text

First Report of Acidovorax avenae subsp. avenae Causing Bacterial Leaf Stripe of Strelitzia nicolai

Plant Disease ◽

10.1094/pdis-03-11-0160 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1474-1474 ◽

Cited By ~ 2

Author(s):

T. E. Seijo ◽

N. A. Peres

Keyword(s):

Pathogenic Bacteria ◽

Fatty Acid Analysis ◽

South Florida ◽

Metabolic Phenotype ◽

Bacterial Suspension ◽

Rrna Gene ◽

First Report ◽

Plastic Bags ◽

Young Leaves ◽

Symptomatic Tissue

White bird of paradise (Strelitzia nicolai Regel & K. Koch) is a commonly grown ornamental in central and south Florida. Each summer of 2004 to 2007, a reoccurring disease was observed at a commercial nursery in central Florida. Diseased plants had brown, necrotic stripes between the lateral leaf veins, which usually appeared along the midvein and spread toward the leaf edge. Lesions developed on the youngest leaves as they emerged from the central whorl. During 2004 and 2005, 20 symptomatic leaves were sampled. A white, nonfluorescent bacterium was consistently isolated from symptomatic tissue. It induced a hypersensitive response (HR) on tomato, grew at 41°C, and was identified as a Acidovorax sp. based on fatty acid analysis and as Acidovorax avenae subsp. avenae by Biolog metabolic phenotype analysis (similarity 0.76 to 0.86). A partial 16S rRNA gene sequence (1,455 bp) (Accession No. EF418616) was identical to four sequences in the NCBI (National Center for Biotechnology Information) database: one from A. avenae subsp. avenae and three from A. avenae of undetermined subspecies. To confirm pathogenicity, a bacterial suspension (O.D590 = 0.1) was applied to fill the central whorl (~0.5 to 1 ml) of potted S. nicolai. Plants were incubated for 7 to 10 days inside plastic bags at ambient temperature. Plants were inoculated individually with five strains of A. avenae subsp. avenae, four from S. nicolai, and one from corn (ATCC19860). Two to nine plants per strain were inoculated in each experiment. All strains were tested at least twice and noninoculated control plants were included. Symptoms were reproduced on the emerging leaf of 50 to 100% of inoculated plants with all five A. avenae subsp. avenae strains. No symptoms were observed on the controls. The bacteria recovered from symptomatic tissue were confirmed to be A. avenae subsp. avenae. Corn seedlings were inoculated as described above, except that entire seedlings were sprayed. Water-soaked lesions along the length of older leaf blades developed in 4 to 7 days. Only the corn strain was pathogenic (>80% of seedlings symptomatic), indicating host specificity. To our knowledge, this is the first report of A. avenae subsp. avenae infecting S. nicolai. In 1971, Wehlburg (2) described the same symptoms on orange bird of paradise (S. reginae) as being caused by a nonfluorescent Pseudomonas sp. This report likely describes the same disease since the published description is consistent with symptoms caused by A. avenae subsp. avenae. The pathogen reported by Wehlburg (2) had one polar flagellum, reduced nitrate, produced oxidase and a HR, and utilized arabinose, but not sucrose or arginine, characteristics consistent with those of A. avenae subsp. avenae (1). The only difference was A. avenae subsp. avenae has a delayed positive starch hydrolysis (1), whereas Welhburg's strain was negative. This disease occurs mainly on young leaves when plants receive daily overhead irrigation. Incidence can be as high as 40%, occasionally causing mortality, but even mild symptoms affect appearance and reduce marketability as an ornamental. References: (1) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) C. Wehlburg. Plant Dis. Rep. 55:447, 1971.

Download Full-text

First Report of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae in Spain

Plant Disease ◽

10.1094/pdis-06-11-0537 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1583-1583 ◽

Cited By ~ 35

Author(s):

A. Abelleira ◽

M. M. López ◽

J. Peñalver ◽

O. Aguín ◽

J. P. Mansilla ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Online Publication ◽

Untreated Control ◽

Early Spring ◽

Bacterial Suspension ◽

Bacterial Canker ◽

Biochemical Tests ◽

Woody Vines ◽

First Report ◽

Sterile Needle

Bacterial canker of kiwifruit caused by Pseudomonas syringae pv. actinidiae was first described in Japan and Korea and is currently an emerging disease that causes major losses in China, Italy, New Zealand, France, Portugal, and Chile. Gold kiwifruit (Actinidia chinensis), especially cvs. Jin Tao and Hort 16A, seem to be more susceptible than green kiwifruit (Actinidia deliciosa) cvs. Hayward and Summer. The bacterium affects male and female woody vines equally, with young vines being more susceptible. The most characteristic symptoms that appear in early spring are reddish orange or white exudates associated with cankers and wounds in branches and/or trunk, as well as brown leaf spots. Buds and fruits were also affected (1). In Spain, 1,132 ha of kiwifruit orchards yielded 25,285 t of fruit in 2009 (2). Most Spanish kiwifruit is cultivated in Galicia (northwest Spain), where the main cultivar is Hayward. In 2010, the first plantation of cv. Jin Tao and one plantation of cv. Summer were established in this area close to Hayward woody vine. In early spring 2011, 80% of the vines in one orchard had twigs with reddish exudates and branches and trunks as well as leaves with angular spots surrounded by yellow haloes. Isolations from both Actinidia spp. were conducted on nutrient agar with sucrose. One hundred and twelve isolates were obtained and seventy-seven were aerobic, gram negative and nonfluorescent on King's B medium. Biochemical tests performed were levan, oxidase, potato rot, arginine didhydrolase, hypersensitivity in tobacco, and utilization of 49 carbohydrates by the API 50 CH system (BioMérieux, Marcy l'Etoile, France). Three PCR protocols were used: two with pathovar-specific primers (PSAF1/PSAR2 and PSAF3/PSAR4) and one with nonspecific primers (PsITSF1/PsITSR2) (3). The results of all biochemical and molecular tests were in agreement with those expected for P. syringae pv. actinidiae. The 16S-23S region of strain EFA 37 isolated from A. deliciosa cv. Summer was sequenced (GenBank Accession No. JF815537) and had 100% sequence identity with P. syringae pv. actinidiae (GenBank Accession Nos. AY342165 and D86357). Pathogenicity tests were performed on 15 plants of A. deliciosa cv. Hayward (five plants per isolate) with the Spanish representative strain EFA 37 and compared with two reference strains isolated from both Actinidia species in Italy and five plants of an untreated control. Three buds per healthy vine were wounded with a sterile needle, inoculated with 30 to 50 μl of each bacterial suspension (108 CFU/ml), sealed, and then covered with plastic. Five leaves per healthy vine were also pierced with a sterile needle and then atomized with the same suspension. Symptoms began to appear after 5 days on inoculated vines, but not on untreated control vines. The bacterium, P. syringae pv. actinidiae, was reisolated from symptomatic plants. The kiwifruit orchard with affected plants was eradicated (25 ha). To our knowledge, this is the first report of P. syringae pv. actinidiae in Spain. References: (1) EPPO Alert List. Online publication. Retrieved from http://www.eppo.org/QUARATINE/Alert_List , June, 2011. (2) Ministerio de Medio Ambiente y Medio Rural y Marino (MARM). Anuario de Estadística, Online Publication. Retrieved from http://www.marm.es/estadistica/pags/anuario/2010 , June 2011. (3) J. Rees-George et al. Plant Pathol. 59:453, 2010.

Download Full-text

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽

10.1094/pdis-03-12-0257-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 418-418 ◽

Cited By ~ 5

Author(s):

M. Gupta ◽

N. Bharat ◽

A. Chauhan ◽

A. Vikram

Keyword(s):

Host Range ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Molecular Techniques ◽

Bacterial Suspension ◽

Leaf Spot Disease ◽

Rrna Gene ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Download Full-text

BIOASSAY TO DETERMINE CHERRY ROOTSTOCK TOLERANCE TO `BACTERIAL CANKER' CAUSED BY PSEUDOMONAS SYRINGAE PV SYRINGAE

HortScience ◽

10.21273/hortsci.25.11.1354 ◽

1990 ◽

Vol 25 (11) ◽

pp. 1354F-1355

Author(s):

Elzbieta Krzesinska ◽

Anita Nina Miller

Keyword(s):

Relative Humidity ◽

Pseudomonas Syringae ◽

Bacterial Suspension ◽

Avirulent Strain ◽

Bacterial Canker ◽

Symptom Development ◽

Virulent Strains ◽

Callus Production ◽

Root Stock ◽

One Year

An excised twig assay was developed to evaluate cherry geno-types for their tolerance to Pseudomonas syringae pv. syringae. One-year-old wood was collected at monthly intervals from October until January of `Royal Ann', `Corum', and a number of cherry rootstock. The rootstock included; F/12–1 and Giessen (GI) and M × M selections. A 2-cm incision (“^”-shaped flap) was made on each twig. A 20-μl droplet of inoculum or water was placed onto each incision. The inoculum was prepared with one avirulent (K4) and three virulent strains (W4N54, AP2, B15) concentrations (105, 106, or 107 cfu). Inoculated twigs were placed in test tubes and incubated at 15C in high relative humidity for 3 weeks. After incubation, twigs were evaluated for gummosis production (0–3, 0 = no gummosis), incision browning (1–4, 1 = yellow pith), and callus production (0–1, 0 = no callus). The concentration of bacterial suspension had no effect on symptom development. No gummosis or browning was observed on twigs inoculated with water or the avirulent strain. Based on the gummosis and browning ratings, rootstock M × M 2, M × M 39, M × M 60, GI 148-1, GI 154-2, and GI 154-4 were found to be resistant to these three strains of P. syringae in this assay. Root-stock F 12-1, GI 169–15, GI 172–9, and GI 173-9 were found to be tolerant.

Download Full-text

The First Report of Stolbur Phytoplasma Associated with Phyllody of Calendula officinalis in Serbia

Plant Disease ◽

10.1094/pdis-01-14-0085-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1152-1152 ◽

Cited By ~ 3

Author(s):

S. Pavlovic ◽

M. Starovic ◽

S. Stojanovic ◽

G. Aleksic ◽

S. Kojic ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Natural Infection ◽

Cytotoxic Activities ◽

Rrna Gene ◽

Calendula Officinalis ◽

Aster Yellows ◽

First Report ◽

Pot Marigold ◽

Stolbur Phytoplasma

Pot marigold (Calendula officinalis L.) is native to southern Europe. Compounds of marigold flowers exhibit anti-inflammatory, anti-tumor-promoting, and cytotoxic activities (4). In Serbia, pot marigold is cultivated as an important medicinal and ornamental plant. Typical phyllody, virescence, proliferation of axillary buds, and witches' broom symptoms were sporadically observed in 2011 in Pancevo plantation, Serbia (44°51′49″ N, 20°39′33″ E, 80 m above sea level). Until 2013, the number of uniformly distributed affected pot marigold plants reached 20% in the field. Due to the lack of seed production, profitability of the cultivation was seriously affected. Leaf samples from 10 symptomatic and 4 symptomless marigold plants were collected and total nucleic acid was extracted from midrib tissue (3). Direct PCR and nested PCR were carried out with primer pairs P1/16S-SR and R16F2n/R16R2n, respectively (3). Amplicons 1.5 and 1.2 kb in length, specific for the 16S rRNA gene, were amplified in all symptomatic plants. No PCR products were obtained when DNA isolated from symptomless plants was used. Restriction fragment length polymorphism (RFLP) patterns of the 1.2-kb fragments of 16S rDNA were determined by digestion with four endonucleases separately (TruI1, AluI, HpaII, and HhaI) and compared with those of Stolbur (Stol), Aster Yellows (AY), Flavescence dorée-C (FD-C), Poinsettia Branch-Inducing (PoiBI), and Clover Yellow Edge (CYE) phytoplasmas (2). RFLP patterns from all symptomatic pot marigold plants were identical to the Stol pattern, indicating Stolbur phytoplasma presence in affected plants. The 1.2-kb amplicon of representative Nv8 strain was sequenced and the data were submitted to GenBank (accession no. KJ174507). BLASTn analysis of the sequence was compared with sequences available in GenBank, showing 100% identity with 16S rRNA gene of strains from Paeonia tenuifolia (KF614623) and corn (JQ730750) from Serbia, and peach (KF263684) from Iran. All of these are members of the 16SrXII ‘Candidatus Phytoplasma solani’ group, subgroup A (Stolbur). Phytoplasmas belonging to aster yellows (16SrI) (Italy and Canada) and peanut witches' broom related phytoplasma (16SrII) group (Iran) have been identified in diseased pot marigold plants (1). To our knowledge, this is the first report of natural infection of pot marigold by Stolbur phytoplasma in Serbia. References: (1) S. A. Esmailzadeh-Hosseini et al. Bull. Insectol. 64:S109, 2011. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) J. P. Prince. Phytopathology 83:1130, 1993. (4) M. Ukiya et al. J. Nat. Prod. 69:1692, 2006.

Download Full-text

First report of Armillaria gallica on highbush blueberry (Vaccinium corymbosum) in Italy

Plant Pathology ◽

10.1111/j.1365-3059.2006.01420.x ◽

2006 ◽

Vol 55 (4) ◽

pp. 583-583 ◽

Cited By ~ 2

Author(s):

D. Prodorutti ◽

L. Palmieri ◽

D. Gobbin ◽

I. Pertot

Keyword(s):

Vaccinium Corymbosum ◽

Highbush Blueberry ◽

First Report ◽

Armillaria Gallica

Download Full-text

First Report of Bacterial Canker Caused by Pseudomonas syringae pv. morsprunorum Race 1 on Peach from Khyber Pakhtunkhwa Province of Pakistan

Plant Disease ◽

10.1094/pdis-10-17-1618-pdn ◽

2018 ◽

Vol 102 (10) ◽

pp. 2027-2027 ◽

Cited By ~ 2

Author(s):

R. Ahmed ◽

M. Inam-ul-Haq ◽

U. Shahzad ◽

S. Hyder ◽

S. Shahzaman ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Bacterial Canker ◽

First Report ◽

Khyber Pakhtunkhwa ◽

Race 1 ◽

Khyber Pakhtunkhwa Province

Download Full-text

First Report of Fire Blight on Pear Trees Caused by Erwinia amylovora in Kurdistan Province, Iran

Plant Disease ◽

10.1094/pdis-09-12-0876-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1111-1111 ◽

Cited By ~ 1

Author(s):

S. N. Mollaei ◽

B. Harighi

Keyword(s):

Fire Blight ◽

Erwinia Amylovora ◽

Reca Gene ◽

Phylogenetic Position ◽

Bacterial Suspension ◽

Sodium Hypochlorite Solution ◽

Pathogenicity Test ◽

First Report ◽

Appl Environ ◽

Pear Trees

Pear (Pyrus L.) is one of the most widely grown crops in western Iran. Since 2010, an outbreak of a disease with symptoms similar to fire blight has been observed on pear trees in various locations of Kurdistan Province. Initial flower symptoms include water-soaking and rapidly shriveling, infected flowers that remained hanging on the trees. Immature fruits become water-soaked, turned brown, and shriveled. Infected flowers and immature fruits were collected from different locations in the province. Small pieces (about 1 mm2) were excised from infected tissues, surface sterilized with 0.5% sodium hypochlorite solution, followed by rinsing in sterile-distilled water (SDW). Each piece was macerated in 2 to 3 ml of SDW, streaked onto nutrient agar sucrose or eosin methylene blue agar media, and incubated at 27 to 29°C. After 48 to 72 h, single colonies were subcultured onto the same media and stored at 4°C. In total, 74 bacteria were isolated from infected tissues. All isolates were gram-negative and rod-shaped. Based on other phenotypic properties, strains were grouped into three clusters at a similarity level of 65% (data not shown). Forty-one and 23 strains showed properties as expected for Erwinia amylovora and Enterobacter sp., respectively. Other strains showed properties resembling Pantoea agglomerans. All strains identified as E. amylovora produced an expected DNA fragment of about 900 bp by PCR using primers PE29A and PE29B corresponding to plasmid pEA29 (1). The result was confirmed by using primers AMSbL and AMSbR derived from the ams region required for amylovoran synthesis of E. amylovora. E. amylovora strains produced an expected 1,600-bp fragment (2). For the pathogenicity test, a bacterial suspension was adjusted to approximately 1 × 107 CFU/ml from cell cultures grown in nutrient broth at 27°C for 48 h. Immature pear fruits sterilized with 70% ethanol and rinsed with SDW were injected with the bacterial suspension using a 25-gauge sterile needle. Fruits injected with sterile water were used as controls. Pear fruits were kept in a mist chamber at 27 to 29°C. Symptoms were assessed up to 2 weeks after inoculation. All E. amylovora strains produced typical symptoms on inoculated immature pear fruits. Necrosis and oozing of bacterial exudates were observed after 3 to 7 days. The phylogenetic position of two selected strains was analyzed by sequence comparison of recA gene among other species in the genus Erwinia and related bacteria. The recA sequence of bacterial strains identified as E. amylovora revealed high similarity (99%) to the E. amylovora type strain (CFBP 1430). Genetic diversity of selected strains was assessed and compared with E. amylovora reference strain CFBP 1430 using ERIC and REP primers in rep-PCR analysis. (3). UPGMA cluster analysis of the combined data obtained in the rep-PCR experiments using Dice's coefficient revealed that the majority of E. amylovora strains showed the same fingerprint patterns at a similarity level of 93%, indicating genetic homogeneity among strains but clearly separated from Enterobacter sp. and P. agglomerans strains. To our knowledge, this is the first report that characterizes the phenotypic and genetic properties of E. amylovora in western part of Iran. References: (1) S. Bereswill et al. Appl. Environ. Microbiol. 58:3522, 1992. (2) S. Bereswill et al. Appl. Environ. Microbiol. 61:2636, 1995. (3) J. Versalovic et al. Mol. Cell Biol. 5:25, 1994.

Download Full-text

First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽

10.1094/pdis-05-13-0521-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1653-1653 ◽

Cited By ~ 3

Author(s):

M. Starović ◽

S. Kojic ◽

S. T. Kuzmanovic ◽

S. D. Stojanovic ◽

S. Pavlovic ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Nested Pcr ◽

Vaccinium Corymbosum ◽

23S Rrna ◽

Rrna Gene ◽

Restriction Enzyme Digestion ◽

First Report ◽

Stolbur Phytoplasma ◽

The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

Download Full-text