First Report of Pestalotiopsis clavispora Causing Twig Blight on Highbush Blueberry (Vaccinium corymbosum) in Anhui Province of China

Leaf rust symptoms have been noticed sporadically on northern highbush blueberry plants (Vaccinium corymbosum L.) in Michigan for the past 8 years. In 2009, leaf rust was seen in several cultivated blueberry fields and on greenhouse-grown blueberry plants in southwest Michigan. In 2010, leaf rust was widespread throughout western Michigan and particularly evident in the fall, sometimes resulting in premature defoliation. Cultivars Rubel, Jersey, Elliott, Liberty, and Brigitta were most commonly affected. Both the 2009 and 2010 growing seasons were characterized by above-average precipitation in early to mid-summer. Early symptoms on the adaxial leaf surface consisted of roughly circular yellow spots that later developed brown, necrotic centers. Older lesions were more angular and sometimes surrounded by a purplish border. In the fall, a “green island” effect was sometimes apparent around the lesions. On the abaxial side, numerous yellow-to-orange rust pustules (uredinia) were visible. Uredinia were dome shaped, erumpent, 100 to 400 μm in diameter, clustered, and sometimes coalescing. Urediniospores were broadly obovate with dark yellowish content and measured 19 to 25 × 16 to 20 μm (average 22 × 18 μm, n = 30). Spore walls were hyaline, echinulate, and 1.0 to 1.5 μm thick with obscure germ pores. Uredinia were examined with light and scanning electron microscopy for the presence of conspicuous ostiolar cells characteristic of Naohidemyces vaccinii (Wint.) Sato, Katsuya et Y. Hiratsuka, but none were observed. No telia or teliospores were observed. On the basis of morphology, the pathogen was identified as Thekopsora minima P. Syd. & Syd. (3,4) and a sample was deposited in the U.S. National Fungus Collection (BPI 881107). Genomic DNA was extracted from urediniospores of rust isolates from six different locations, and a 267-bp fragment of the ITS2 region was amplified and sequenced using the primers ITS3 and ITS4 (GenBank Accession No. HQ661383). All sequences were identical to each other and shared 99% identity (232 of 234 bp) with a T. minima isolate from South Africa (GenBank Accession No. GU355675). The alternate host, hemlock (mostly Tsuga canadensis L.) is a common and valuable conifer in the Michigan landscape. Hemlock trees were not examined for the presence of aecia but are assumed to play a role in the epidemiology of the disease in Michigan because leaf rust tends to be more severe near hemlock trees. Pucciniastrum vaccinii (G. Wint.) Jorst. was considered the causal agent of blueberry leaf rust until Sato et al. (1,4) identified three unique species. While T. minima has been reported on black huckleberry (Gaylussacia baccata [Wangenh.] K. Koch) in Michigan (4), to our knowledge, this is the first report of T. minima on highbush blueberry in the state. T. minima has been reported on highbush blueberry in Delaware and New York (4), Japan (2), and South Africa (3). The severity of the outbreak in 2010 warrants further research into economic losses, epidemiology, and management of the disease. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Botany and Mycology Laboratory, ARS, UDSA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 2010. (2) T. Kobayashi. Page 1227 in: Index of Fungi Inhabiting Woody Plants in Japan. Host, Distribution and Literature. Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Tokyo, 2007. (3) L. Mostert et al. Plant Dis. 94:478, 2010. (4) S. Sato et al. Trans. Mycol. Soc. Jpn. 34:47, 1993.

Download Full-text

First Report of Root Rot Caused by Fusarium proliferatum on Blueberry in Argentina

Plant Disease ◽

10.1094/pdis-04-11-0307 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1478-1478 ◽

Cited By ~ 3

Author(s):

B. A. Pérez ◽

M. F. Berretta ◽

E. Carrión ◽

E. R. Wright

Keyword(s):

Root Rot ◽

Its Region ◽

Vaccinium Corymbosum ◽

Fusarium Proliferatum ◽

Highbush Blueberry ◽

Buenos Aires Province ◽

Distilled Water ◽

First Report ◽

Potted Plants ◽

Water Plants

In 2009, a highbush blueberry (Vaccinium corymbosum L. ‘O'Neal’) field located in Rojas, Buenos Aires Province showed 30% of plants with dry or dead branches. Disinfected root pieces were placed on water agar and incubated at 24°C. A fungal colony was obtained and purified by successive transfers of an individual hyphal tip from a sparsely growing colony. Colony color and growth rate were evaluated in potato dextrose agar where the fungus produced white-to-pale pink colonies and grew 3.5 cm after 5 days. The fungus was studied on Spezieller Nährstoffarmer agar (2), carnation leaf-piece agar, and KCl agar where it produced abundant single-celled hyaline microconidia in moderate-length chains and in false heads originated from monophialides and polyphialides. Microconidia measured 6 to 12 × 2 to 3 μm (average 8 × 2.3 μm). On KCl, chains of microconidia and tan-to-light cream sporodochia with 3- to 5-septate, slender, relatively straight macroconidia were easily observed after 4 and 10 days, respectively. Macroconidia measured 38 to 48 × 3.5 to 4 μm (average 43.9 × 3.9 μm). Chlamydospores and sclerotia were not present. Data coincided with the description for Fusarium proliferatum (Matsush.) Niremberg ex Gerlach & Niremberg. The isolate was deposited in the IMYZA Microbial Collection as INTA-IMC 144. The fungus was cultured in 100 ml of Czapek-Dox supplemented with sucrose, peptone, yeast extract, sodium nitrate, and vitamins for 4 days. Genomic DNA was obtained with a DNA extraction kit, PCR amplified with primers ITS1 and ITS4 for the internal transcribed spacer (ITS) region of ribosomal genes, and sequenced. The nucleotide sequence (Accession No JF913468) was compared with GenBank records. The sequence shared 99% identity with Accession No HQ113948 for F. proliferatum. Pathogenicity was confirmed in 1-year-old ‘O'Neal’ plants. A 10-ml suspension (2.4 × 106 conidia/ml in sterile distilled water) was applied to six potted plants grown in sterilized potting mix. Roots were superficially wounded with a needle. Control plants were treated with sterile distilled water. Plants were incubated at 24°C and a 12-h photoperiod. After 90 days, plants showed root rot, leaf chlorosis, and branch necrosis followed by plant death. Control plants remained healthy. F. proliferatum was reisolated from diseased roots of inoculated plants. This fungus was previously cited in Argentina on asparagus (1), corn (1,3), and oat (4). To our knowledge, this is the first report of F. proliferatum as a root pathogen of highbush blueberry in Argentina. References: (1) G. Lori et al. Plant Dis. 82:1405, 1998. (2) H. I. Nirenberg. Releases Fed. Biol. Res. Ctr. Agric. For. (Berlin-Dahlem) 169:1, 1976. (3) D. A. Sampietro et al. Fung. Biol. 114:74, 2010. (4) S. A. Stenglein et al. Plant Dis. 94:783, 2010.

Download Full-text

First Report of Brown Blight Disease Caused by Colletotrichum gloeosporioides on Camellia sinensis in Anhui Province, China

Plant Disease ◽

10.1094/pdis-08-13-0896-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 284-284 ◽

Cited By ~ 16

Author(s):

M. Guo ◽

Y. M. Pan ◽

Y. L. Dai ◽

Z. M. Gao

Keyword(s):

Camellia Sinensis ◽

Colletotrichum Gloeosporioides ◽

Tea Plant ◽

Anhui Province ◽

Molecular Characteristics ◽

Fluorescent Light ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Twig Blight

Yellow Mountain fuzz tip, a cultivar of Camellia sinensis (L.) Kuntze, is commonly grown in the Yellow Mountain region in Anhui Province of China. During 2011 to 2012, leaf and twig blight on tea plants occurred from July to September in growing regions. Symptoms of blight on leaves of infected plants were detected in 30 to 60% of the fields visited and up to 500 ha were affected each year. Symptoms began as small, water-soaked lesions on young leaves and twigs and later became larger, dark brown, necrotic lesions, 1 to 3 mm in diameter on leaves and 2 to 5 mm long on twigs. To determine the causal agent, symptomatic leaf tissue was collected from plants in Gantang and Tangkou townships in September 2012. Small pieces of diseased tea leaves and twigs were surface-disinfested in 2% NaClO for 3 min, rinsed twice in distilled water, plated on potato dextrose agar, and incubated at 28°C for 5 days. Eleven isolates were recovered and all cultures produced white-to-gray fluffy aerial hyphae and were dark on the reverse of the plate. The hyphae were hyaline, branching, and septate. Setae were 2- to 3-septate, dark brown, acicular, and 78.0 to 115.0 μm. Conidiogenous cells were hyaline, short, branchless, cylindrical, and 11.3 to 21.5 × 4.2 to 5.3 μm. Conidia were hyaline, aseptate, guttulate, cylindrical, and 12.5 to 17.3 × 3.9 to 5.8 μm. Appresoria were ovate to obovate, dark brown, and 8.4 to 15.2 × 7.8 to 12.9 μm. DNA was amplified using the rDNA-ITS primer pair ITS4/ITS5 (3), glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) primer pair GDF/GDR (2) and beta-tubulin 2 gene (Tub2) primer pair Btub2Fd/Btub4Rd (4). Sequences (GenBank Accession Nos. KC913203, KC913204, and KC913205) of the 11 isolates were identical and revealed 100% similarity to the ITS sequence of strain P042 of Colletotrichum gloeosporioides (EF423527), 100% identity to the GAPDH of isolate C07009 of C. gloeosporioides (GU935860), and 99% similarity to Tub2 of isolate 85 of C. gloeosporioides (AJ409292), respectively. Based on the above data, the 11 isolates were identified as C. gloeosporioides (Penz.) Penz. & Sacc. To confirm pathogenicity, Koch's postulate was performed and 4 ml of conidial suspension (1 × 105 conidia/ml) of each of the 11 isolates was sprayed on five leaves and five twigs per plant on four 12-month-old Yellow Mountain fuzz tip plants. Control plants were sprayed with distilled water. The inoculated plants were maintained at 28°C in a greenhouse with constant relative humidity of 90% and a 12-h photoperiod of fluorescent light. Brown necrotic lesions appeared on leaves and twigs after 7 days, while the control plants remained healthy. The experiments were conducted three times and the fungus was recovered and identified as C. gloeosporioides by both morphology and molecular characteristics. Tea plant blight caused by C. gloeosporioides was identified in Brazil (1), but to our knowledge, this is the first report of C. gloeosporioides causing tea leaf and twig blight on Yellow Mountain fuzz tip plants in Anhui Province of China. References: (1) M. A. S. Mendes et al. Page 555 in: Embrapa-SPI/Embrapa-Cenargen, Brasilia, 1998. (2) M. D. Templeton et al. Gene 122:225, 1992. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (4) J. H. C. Woudenberg et al. Persoonia 22:56, 2009.

Download Full-text

Alternaria Leaf Spot, Twig Blight, and Fruit Rot of Highbush Blueberry in Argentina

Plant Disease ◽

10.1094/pdis.2004.88.12.1383b ◽

2004 ◽

Vol 88 (12) ◽

pp. 1383-1383 ◽

Cited By ~ 8

Author(s):

E. R. Wright ◽

M. C. Rivera ◽

J. Esperón ◽

A. Cheheid ◽

A. Rodríguez Codazzi

Keyword(s):

Vaccinium Corymbosum ◽

Fruit Rot ◽

Fluorescent Light ◽

Highbush Blueberry ◽

Disease Symptoms ◽

Potted Plants ◽

Leaf Spots ◽

Twig Blight ◽

Polyethylene Bags ◽

Plastic Trays

Disease symptoms have been observed since October 1997 on highbush blueberry (Vaccinium corymbosum L.) cvs. Georgia Gem, O'Neal, and Sharpblue cultivated in Buenos Aires. Lesions were observed on recently planted, as well as mature plants, in commercial fields. Circular-to-irregular, light brown-to-gray leaf spots with brownish red borders, initially 3 to 7 mm in diameter, enlarged and coalesced. Blight developed on twigs. Reddish circular spots appeared on stems, developing small cankers. Dark sunken lesions were observed on attached ripening berries. During December 2002, postharvest fruit rot was noted. Small pieces of diseased leaves, twigs, stems, and fruits were surface sterilized with 0.2% NaOCl, plated on 2% potato dextrose agar (pH 7), and incubated at 20 ± 3°C. Symptomatic fruits were placed in plastic trays in humid chambers. In all cases, olive mycelium developed after 3 days with septate hyphae and abundant ovoid and obclavate muriformly septate conidia. The isolate obtained from diseased leaves of cv. O'Neal was used to test pathogenicity on micropropagated potted plants of 20-cm height and ripe fruits contained in plastic trays. Both plants and fruits belonged to cv. O'Neal. A suspension of 2 × 105 conidia per ml was sprayed on needle-punctured young stems, fully expanded leaves, and mature fruits. Plants and trays were covered with polyethylene bags and kept at 24 ± 3°C under fluorescent light (12-hr photoperiod). The bags were removed after 72 hr. Symptoms appeared after 3 days on fruits and 8 days on leaves and stems. Controls remained symptomless. The inoculated pathogen was recovered from diseased organs and identified as Alternaria tenuissima (Kunze:Fr.) Wiltshire (1). To our knowledge, this is the first report on the presence of A. tenuissima affecting blueberry crops in Argentina. Reference: (1) E. G. Simmons. Mycotaxon 70:325, 1999.

Download Full-text

First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

Plant Disease ◽

10.1094/pdis-94-8-1071b ◽

2010 ◽

Vol 94 (8) ◽

pp. 1071-1071 ◽

Cited By ~ 6

Author(s):

J. Přibylová ◽

J. Špak ◽

D. Kubelková ◽

K. Petrzik

Keyword(s):

Czech Republic ◽

Reverse Transcriptase ◽

Vaccinium Corymbosum ◽

Ringspot Virus ◽

Tween 20 ◽

Highbush Blueberry ◽

Reverse Transcriptase Gene ◽

The Czech Republic ◽

First Report

A collection of highbush blueberry (Vaccinium corymbosum L.) cultivars planted in the field for propagation in South Bohemia was surveyed in May and July of 2009 for the occurrence of detrimental viruses. A total of 67 plants of 10 cultivars (Berkeley, Burlington, Blue Crop, Bluetta, Darrow, Duke, Gila, Jersey, Late Blue, and Northland), were observed for typical Blueberry red ringspot virus (BRRV) symptoms that appear as reddish ring spots and blotches on stems and fruits, exclusively on the upper surface of the older leaves but not the underside. Samples of leaves were collected and maintained at –20°C until used for DNA extraction, then assayed for BRRV infection using PCR. Controls originated from the same blueberry cultivars in vitro. DNA was extracted from leaf tissue with a NucleoSpin Plant II kit for isolating genomic DNA according to the manufacturer's instructions (Macherey-Nagel, Düren, Germany). Primer pair BRRV15/16, which amplified fragments of the reverse transcriptase gene (1), was used in PCR for BRRV detection. The program used for PCR amplification was 94°C for 2 min, followed by 35 cycles at 94°C for 30 s, 49°C for 30 s, and 70°C for 45 s, followed by a final extension at 70°C for 5 min. The total PCR volume of 25 μl contained 20 ng of DNA, 200 μmol liter–1 dNTPs, 0.5 μl of each primer BRRV15 and BRRV16 (20 pmol μl–1), 75 mM Tris-HCl pH 8.8, 20 mM (NH4)2SO4, 0.01% Tween 20, 2.5 mM MgCl2, 2.5 U of Taq Purple DNA polymerase, and stabilizers (Top-Bio Ltd., Prague, Czech Republic). Amplifications were conducted in an MJ Research (Waltham, MA) thermocycler. Aliquots (4 μl) of each PCR product were analyzed by electrophoresis in tris-acetate-EDTA buffer. No BRRV symptoms were observed on the plants in early spring, yet BRRV was detected in one symptom-free bush of cv. Darrow by PCR. In July, typical symptoms developed on that and another cv. Darrow bush that was also positive by PCR. DNA fragments of the expected sizes were amplified from total nucleic acid samples of both infected blueberry bushes using primers BRRV15/16, while no amplification products were detected in plants without symptoms. The amplicons obtained with primers BRRV15/BRRV16 were sequenced and revealed 97.5%-nt identity to the BRRV putative reverse transcriptase gene (GenBank Accession No. AF404509). The 845 nt of the amplicon has been deposited at GenBank under Accession No. HM107773. The disease was likely introduced in infected planting material, since no highbush blueberry plantations exist in the vicinity and V. corymbosum is not native to the Czech Republic. In conclusion, to our knowledge, this is the first report of Blueberry red ringspot virus (genus Soymovirus, family Caulimoviridae) in V. corymbosum L. in the Czech Republic. Symptom observation and PCR testing for BRRV should therefore, be incorporated into the certification scheme for highbush blueberry in the Czech Republic. Reference: (1) J. J. Polashock et al. Plant Dis. 93:727, 2009.

Download Full-text

First Report of Blueberry scorch virus in Black Huckleberry in British Columbia

Plant Disease ◽

10.1094/pdis-91-3-0328c ◽

2007 ◽

Vol 91 (3) ◽

pp. 328-328 ◽

Cited By ~ 4

Author(s):

L. A. Wegener ◽

Z. K. Punja ◽

R. R. Martin

Keyword(s):

British Columbia ◽

Reverse Transcription ◽

Direct Sequencing ◽

Sandwich Elisa ◽

Leaf Tissue ◽

Vaccinium Corymbosum ◽

Negative Control ◽

Highbush Blueberry ◽

First Report ◽

Sequence Identity

Blueberry scorch virus (BlScV), an aphid-borne carlavirus, causes a serious disease of highbush blueberry (Vaccinium corymbosum L.) in North America and Europe. Symptoms of BlScV infection on highbush blueberry include necrosis of flower blossoms and young leaves, shoot blight, and chlorosis. Currently, cranberry (Vaccinium macrocarpon L.) is the only other natural host of BlScV. In July 2004, wild black huckleberry (Vaccinium membranaceumL.) was sampled in the Kootenay Region of southeastern British Columbia. Foliar tissues were sampled during 2004 from 11 bushes from a clearing on the side of a mountain near Crawford Bay, BC, Canada and tested by double-antibody sandwich-ELISA using polyclonal antiserum (Agdia Inc., Elkhart, IN). BlScV was detected in 6 of the 11 bushes sampled and in the positive control (BlScV-infected blueberry leaf tissue) and was not detected in the negative control (healthy blueberry leaf tissue). To confirm the presence of the virus, total nucleic acid was extracted from ELISA-positive huckleberry samples according to an established protocol (A. Rowhani et al. Proc. Int. Counc. Stud. Viruses Virus-Like Dis. Grapevine, Extended Abstr. 13:148, 2000). Reverse transcription-PCR was performed using pd(T)12-18 random primer (Amersham Biosciences, Piscataway, NJ) for reverse transcription and BlScV-specific primers developed against the published NJ-2 sequence of BlScV (GenBank Accession No. NC_003499). Using the forward primer, BS708F, (5′-TCAATCCGTGGTGCTACGAG-3′), and the reverse primer, BS1188R, (5′-ACAGTGCGCAATGTTCCAGT-3′), a 480-bp amplicon was obtained from each of the ELISA-positive samples, while no ampli-cons were observed for the negative control (ELISA-negative huckleberry tissue). Direct sequencing of one selected amplicon revealed 90, 84, and 77% nucleotide sequence identity and 97, 96, and 88% amino acid sequence identity with strains NJ-2, BC-1 (GenBank Accession No. AY941198) and BC-2 (GenBank Accession Nos. AY941199), respectively. BlScV-infected huckleberries were asymptomatic. The presence of BlScV in alternate hosts has implications for disease epidemiology. Testing for BlScV in Vaccinium species in and around commercial highbush blueberry plantings, as well as lowbush blueberry (V. angustifolium Aiton), rabbiteye blueberry (V. ashei Reade), other native Pacific Northwest species (V. ovatum Pursh and V. parvifolium Smith), and ornamental Vaccinium species is warranted. To our knowledge, this is the first report of BlScV infecting black huckleberry.

Download Full-text

First report of Tobacco ringspot virus in highbush blueberry in Washington State

Plant Disease ◽

10.1094/pdis-01-21-0183-pdn ◽

2021 ◽

Author(s):

Arunabha Mitra ◽

Sridhar Jarugula ◽

Gwen Hoheisel ◽

Naidu Rayapati

Keyword(s):

South Korea ◽

Vaccinium Corymbosum ◽

Washington State ◽

Ringspot Virus ◽

Highbush Blueberry ◽

Korean Isolate ◽

Total Rna ◽

First Report ◽

Tobacco Ringspot Virus ◽

Cherry Leaf Roll Virus

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Download Full-text

Glomerella acutata on Highbush Blueberry (Vaccinium corymbosum L.) in Norway

Plant Health Progress ◽

10.1094/php-2007-0509-01-rs ◽

2007 ◽

Vol 8 (1) ◽

pp. 19 ◽

Cited By ~ 7

Author(s):

V. Talgø ◽

H. U. Aamot ◽

G. M. Strømeng ◽

S. S. Klemsdal ◽

A. Stensvand

Keyword(s):

Solid Medium ◽

Vaccinium Corymbosum ◽

Potato Dextrose Agar ◽

Infected Host ◽

Colletotrichum Acutatum ◽

Highbush Blueberry ◽

First Report ◽

First Time

In August 2004, Glomerella acutata Guerber & Correll was detected on fruits from highbush blueberry (Vaccinium corymbosum L.) for the first time in Norway. Both the conidial (Colletotrichum acutatum J. H. Simmonds) and the ascigerous (G. acutata) stage developed on naturally infected blueberry fruits. Perithecia also readily formed on blueberries and strawberries inoculated with a culture from highbush blueberry, and on artificial, solid medium (both on strawberry leaf agar and potato dextrose agar). To our knowledge this is the first report worldwide of the teleomorph of Glomerella acutata on a naturally infected host. Accepted for publication 15 January 2007. Published 9 May 2007.

Download Full-text

First Report of Blueberry scorch virus in Elderberry in Poland

Plant Disease ◽

10.1094/pdis-03-13-0277-pdn ◽

2013 ◽

Vol 97 (11) ◽

pp. 1515-1515 ◽

Cited By ~ 6

Author(s):

E. Kalinowska ◽

E. Paduch-Cichal ◽

M. Chodorska

Keyword(s):

Pcr Primers ◽

The United States ◽

Vaccinium Corymbosum ◽

Negative Control ◽

Highbush Blueberry ◽

First Report ◽

Sequence Identity ◽

Reverse Transcription Pcr ◽

Shoot Blight ◽

Das Elisa

Blueberry scorch virus (BlScV) is a member of the genus Carlavirus and one of the most widespread pathogens of highbush blueberry (Vaccinium corymbosum L.). The virus was first reported in the United States and has been reported in several countries in Europe, including Italy, Germany, the Netherlands, and Poland. Symptoms of scorch disease in highbush blueberry include necrosis of flower blossoms and leaves, shoot blight, and chlorosis. Sometimes BlScV infection is symptomless or limited to single blossoms and shoots, but all highbush blueberry cultivars are susceptible to virus infection. Cranberry (V. macrocarpon L.) and wild black huckleberry (V. membranaceum L.) are known as natural and symptomless hosts of BlScV (1). In June 2012, during the research concerning the occurrence of BlScV in plants outside Vaccinium sp., 15 leaf samples from five elderberry bushes (Sambucus nigra L., family Adoxaceae) were randomly collected from the Lodzkie region in Central Poland and three were positive in double antibody sandwich (DAS)-ELISA using specific antiserum (Agdia Inc., Elkhart, IN). To confirm the presence of the virus, total nucleic acid was extracted from ELISA-positive elderberry samples according to established protocol (T. Malinowski. Proc. 4th Int. EFPP Symposium, 445, 1996) and used in one step reverse transcription PCR. Primers were developed against the published NJ-2, BC-1, and BC-2 sequences of BlScV (GenBank Accession Nos. NC_003499, AY941198, and AY941199, respectively). The forward primer, RDP_1 (5′-ATGGCACTCACATACAGAAGTCC-3′), and the reverse primer, RDP_2 (5′-TGCCTCTTCAATGCACGATGTTC-3′), were used to amplify a 420-bp fragment of the RNA-dependent RNA polymerase gene of the virus. Amplicons of expected size were obtained from three DAS-ELISA-positive samples, while no products were observed for the negative control (DAS-ELISA-negative elderberry tissues). Sequence of one selected PCR product revealed 100, 88, and 87% nucleotide sequence identity and 100, 96, and 96% amino acid sequence identity with BC-2, NJ-2, and BC-1, respectively. BlScV-infected elderberry bushes were asymptomatic. As BlScV is transmitted by aphids in a non-persistent manner, infected elderberry bushes near highbush blueberry plantings may play an important role in virus spread. The potential for BlScV infection of plants outside family Ericaceae should be investigated. To the best of our knowledge, this is the first report of BlScV infecting elderberry. Reference: (1) R. R. Martin et al. Viruses 4:2831, 2012.

Download Full-text