Glomerella acutata on Highbush Blueberry (Vaccinium corymbosum L.) in Norway

V. Talgø; H. U. Aamot; G. M. Strømeng; S. S. Klemsdal; A. Stensvand

doi:10.1094/php-2007-0509-01-rs

Isolation of furanocoumarins from Pastinaca sativa L. callus culture

Acta Societatis Botanicorum Poloniae ◽

10.5586/asbp.2000.025 ◽

2014 ◽

Vol 69 (3) ◽

pp. 193-195 ◽

Cited By ~ 3

Author(s):

Halina Ekiert ◽

Wanda Kisiel

Keyword(s):

Secondary Metabolites ◽

Callus Culture ◽

Spectral Methods ◽

Solid Medium ◽

Intact Plant ◽

Pastinaca Sativa ◽

First Report ◽

Callus Tissues ◽

First Time

Four furanocoumarins: bergapten, xanthotoxin, isopimpinellin (linear furanocoumarins) and sphondin (angular furanocoumarin) were isolated for the first time from callus tissues of <em>Pastinaca sativa</em> L.(<em>Apiaceae</em>) cultured in vitro on solid medium. The compounds were identified using spectral methods. They are well-known secondary metabolites of the intact plant. This is the first report on the isolation of sphondin from in vitro plant cultures.

Download Full-text

First report of Armillaria gallica on highbush blueberry (Vaccinium corymbosum) in Italy

Plant Pathology ◽

10.1111/j.1365-3059.2006.01420.x ◽

2006 ◽

Vol 55 (4) ◽

pp. 583-583 ◽

Cited By ~ 2

Author(s):

D. Prodorutti ◽

L. Palmieri ◽

D. Gobbin ◽

I. Pertot

Keyword(s):

Vaccinium Corymbosum ◽

Highbush Blueberry ◽

First Report ◽

Armillaria Gallica

Download Full-text

First Report of Colletotrichum acutatum in Blueberry Plants in Spain

Plant Disease ◽

10.1094/pdis.2001.85.12.1285a ◽

2001 ◽

Vol 85 (12) ◽

pp. 1285-1285 ◽

Cited By ~ 3

Author(s):

C. Barrau ◽

B. de los Santos ◽

F. Romero

Keyword(s):

Pink Salmon ◽

Morphological Characteristics ◽

Vaccinium Corymbosum ◽

Fungal Species ◽

Colletotrichum Acutatum ◽

Enzyme Linked Immunosorbent Assay ◽

Conidial Suspension ◽

First Report ◽

Small Areas ◽

Leaf Tissues

An anthracnose disease was observed affecting leaves of high-bush blueberry plants (Vaccinium corymbosum L. ‘Sharpblue’) in small areas within two production fields in Huelva Province of Andalucía, in southwestern Spain. The first symptoms observed in late spring were circular, necrotic lesions, red to salmon in color, and ranging from 3 to 20 mm in diameter. Later, lesions became salmon colored in the center with a brilliant red halo. Fungal isolations were made from the lesions. Infected tissues were surface-disinfected in 1% sodium hypochlorite for 1 min, blotted dry on sterile filter paper, and plated on 2% water agar. The plates were incubated at 25°C for 5 to 10 days. Fungal colonies isolated from the tissues were transferred to potato dextrose yeast agar (PDYA). Only one fungal species was consistently isolated from affected leaf tissues and was identified as Colletotrichum acutatum J.H. Simmonds based on morphological characteristics (2) and enzyme-linked immunosorbent assay (1). Colonies of the fungus on PDYA showed a white-to-gray dense mycelium covered with salmon-colored spore masses. The reverse of the plates was a pink-salmon color. Colony diameter on PDYA averaged 50 mm after 7 days at 25°C. Conidia were hyaline, aseptate, fusiform to cylindrical, and 12.5 × 3.2 μm. Inoculation of leaves and fruits of blueberry cv. Misty with a conidial suspension (106 conidia per ml) of C. acutatum produced lesions on the leaves and fruits similar to those observed on diseased plants in the field. The pathogen was isolated from lesions on inoculated plants. To our knowledge, this is the first report of C. acutatum in high-bush blueberry plants in Spain. References: (1) T. A. Cooke et al. EPPO Bull. 25:57, 1995. (2) B. C. Sutton. The Coelomycetes. CMI, Kew, England, 1980.

Download Full-text

First Report of Blueberry Leaf Rust Caused by Thekopsora minima on Vaccinium corymbosum in Michigan

Plant Disease ◽

10.1094/pdis-12-10-0884 ◽

2011 ◽

Vol 95 (6) ◽

pp. 768-768 ◽

Cited By ~ 4

Author(s):

A. M. C. Schilder ◽

T. D. Miles

Keyword(s):

South Africa ◽

New York ◽

Leaf Rust ◽

Vaccinium Corymbosum ◽

Economic Losses ◽

Its2 Region ◽

Highbush Blueberry ◽

Alternate Host ◽

First Report ◽

Growing Seasons

Leaf rust symptoms have been noticed sporadically on northern highbush blueberry plants (Vaccinium corymbosum L.) in Michigan for the past 8 years. In 2009, leaf rust was seen in several cultivated blueberry fields and on greenhouse-grown blueberry plants in southwest Michigan. In 2010, leaf rust was widespread throughout western Michigan and particularly evident in the fall, sometimes resulting in premature defoliation. Cultivars Rubel, Jersey, Elliott, Liberty, and Brigitta were most commonly affected. Both the 2009 and 2010 growing seasons were characterized by above-average precipitation in early to mid-summer. Early symptoms on the adaxial leaf surface consisted of roughly circular yellow spots that later developed brown, necrotic centers. Older lesions were more angular and sometimes surrounded by a purplish border. In the fall, a “green island” effect was sometimes apparent around the lesions. On the abaxial side, numerous yellow-to-orange rust pustules (uredinia) were visible. Uredinia were dome shaped, erumpent, 100 to 400 μm in diameter, clustered, and sometimes coalescing. Urediniospores were broadly obovate with dark yellowish content and measured 19 to 25 × 16 to 20 μm (average 22 × 18 μm, n = 30). Spore walls were hyaline, echinulate, and 1.0 to 1.5 μm thick with obscure germ pores. Uredinia were examined with light and scanning electron microscopy for the presence of conspicuous ostiolar cells characteristic of Naohidemyces vaccinii (Wint.) Sato, Katsuya et Y. Hiratsuka, but none were observed. No telia or teliospores were observed. On the basis of morphology, the pathogen was identified as Thekopsora minima P. Syd. & Syd. (3,4) and a sample was deposited in the U.S. National Fungus Collection (BPI 881107). Genomic DNA was extracted from urediniospores of rust isolates from six different locations, and a 267-bp fragment of the ITS2 region was amplified and sequenced using the primers ITS3 and ITS4 (GenBank Accession No. HQ661383). All sequences were identical to each other and shared 99% identity (232 of 234 bp) with a T. minima isolate from South Africa (GenBank Accession No. GU355675). The alternate host, hemlock (mostly Tsuga canadensis L.) is a common and valuable conifer in the Michigan landscape. Hemlock trees were not examined for the presence of aecia but are assumed to play a role in the epidemiology of the disease in Michigan because leaf rust tends to be more severe near hemlock trees. Pucciniastrum vaccinii (G. Wint.) Jorst. was considered the causal agent of blueberry leaf rust until Sato et al. (1,4) identified three unique species. While T. minima has been reported on black huckleberry (Gaylussacia baccata [Wangenh.] K. Koch) in Michigan (4), to our knowledge, this is the first report of T. minima on highbush blueberry in the state. T. minima has been reported on highbush blueberry in Delaware and New York (4), Japan (2), and South Africa (3). The severity of the outbreak in 2010 warrants further research into economic losses, epidemiology, and management of the disease. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Botany and Mycology Laboratory, ARS, UDSA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 2010. (2) T. Kobayashi. Page 1227 in: Index of Fungi Inhabiting Woody Plants in Japan. Host, Distribution and Literature. Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Tokyo, 2007. (3) L. Mostert et al. Plant Dis. 94:478, 2010. (4) S. Sato et al. Trans. Mycol. Soc. Jpn. 34:47, 1993.

Download Full-text

Metabolites of Cercospora arachidicola. The first report of long-chain fatty aldehydes from a fungus

Canadian Journal of Microbiology ◽

10.1139/m85-025 ◽

1985 ◽

Vol 31 (2) ◽

pp. 129-133 ◽

Cited By ~ 4

Author(s):

A. Stoessl

Keyword(s):

Potato Dextrose Agar ◽

Cercospora Arachidicola ◽

First Report ◽

Analytical Procedures ◽

Fatty Aldehydes ◽

First Time ◽

Long Chain

Long-chain fatty aldehydes are reported for the first time as fungal products. They were isolated from potato dextrose agar cultures of Cercospora arachidicola as mixtures that were found by analytical procedures to consist predominantly of penta-and heptadecanal and heptadec-8-enal. Small to trace amounts of tetra-, hexa-, and nonadecanal, tetra- and pentadec-2-, and pentadec-6-enal, and heptadec-8,11 -dienal were also present, together with a mono- and a di-unsaturated C16 aldehyde. Brassicasterol was also isolated.

Download Full-text

First Report of Root Rot Caused by Fusarium proliferatum on Blueberry in Argentina

Plant Disease ◽

10.1094/pdis-04-11-0307 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1478-1478 ◽

Cited By ~ 3

Author(s):

B. A. Pérez ◽

M. F. Berretta ◽

E. Carrión ◽

E. R. Wright

Keyword(s):

Root Rot ◽

Its Region ◽

Vaccinium Corymbosum ◽

Fusarium Proliferatum ◽

Highbush Blueberry ◽

Buenos Aires Province ◽

Distilled Water ◽

First Report ◽

Potted Plants ◽

Water Plants

In 2009, a highbush blueberry (Vaccinium corymbosum L. ‘O'Neal’) field located in Rojas, Buenos Aires Province showed 30% of plants with dry or dead branches. Disinfected root pieces were placed on water agar and incubated at 24°C. A fungal colony was obtained and purified by successive transfers of an individual hyphal tip from a sparsely growing colony. Colony color and growth rate were evaluated in potato dextrose agar where the fungus produced white-to-pale pink colonies and grew 3.5 cm after 5 days. The fungus was studied on Spezieller Nährstoffarmer agar (2), carnation leaf-piece agar, and KCl agar where it produced abundant single-celled hyaline microconidia in moderate-length chains and in false heads originated from monophialides and polyphialides. Microconidia measured 6 to 12 × 2 to 3 μm (average 8 × 2.3 μm). On KCl, chains of microconidia and tan-to-light cream sporodochia with 3- to 5-septate, slender, relatively straight macroconidia were easily observed after 4 and 10 days, respectively. Macroconidia measured 38 to 48 × 3.5 to 4 μm (average 43.9 × 3.9 μm). Chlamydospores and sclerotia were not present. Data coincided with the description for Fusarium proliferatum (Matsush.) Niremberg ex Gerlach & Niremberg. The isolate was deposited in the IMYZA Microbial Collection as INTA-IMC 144. The fungus was cultured in 100 ml of Czapek-Dox supplemented with sucrose, peptone, yeast extract, sodium nitrate, and vitamins for 4 days. Genomic DNA was obtained with a DNA extraction kit, PCR amplified with primers ITS1 and ITS4 for the internal transcribed spacer (ITS) region of ribosomal genes, and sequenced. The nucleotide sequence (Accession No JF913468) was compared with GenBank records. The sequence shared 99% identity with Accession No HQ113948 for F. proliferatum. Pathogenicity was confirmed in 1-year-old ‘O'Neal’ plants. A 10-ml suspension (2.4 × 106 conidia/ml in sterile distilled water) was applied to six potted plants grown in sterilized potting mix. Roots were superficially wounded with a needle. Control plants were treated with sterile distilled water. Plants were incubated at 24°C and a 12-h photoperiod. After 90 days, plants showed root rot, leaf chlorosis, and branch necrosis followed by plant death. Control plants remained healthy. F. proliferatum was reisolated from diseased roots of inoculated plants. This fungus was previously cited in Argentina on asparagus (1), corn (1,3), and oat (4). To our knowledge, this is the first report of F. proliferatum as a root pathogen of highbush blueberry in Argentina. References: (1) G. Lori et al. Plant Dis. 82:1405, 1998. (2) H. I. Nirenberg. Releases Fed. Biol. Res. Ctr. Agric. For. (Berlin-Dahlem) 169:1, 1976. (3) D. A. Sampietro et al. Fung. Biol. 114:74, 2010. (4) S. A. Stenglein et al. Plant Dis. 94:783, 2010.

Download Full-text

First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

Plant Disease ◽

10.1094/pdis-94-8-1071b ◽

2010 ◽

Vol 94 (8) ◽

pp. 1071-1071 ◽

Cited By ~ 6

Author(s):

J. Přibylová ◽

J. Špak ◽

D. Kubelková ◽

K. Petrzik

Keyword(s):

Czech Republic ◽

Reverse Transcriptase ◽

Vaccinium Corymbosum ◽

Ringspot Virus ◽

Tween 20 ◽

Highbush Blueberry ◽

Reverse Transcriptase Gene ◽

The Czech Republic ◽

First Report

A collection of highbush blueberry (Vaccinium corymbosum L.) cultivars planted in the field for propagation in South Bohemia was surveyed in May and July of 2009 for the occurrence of detrimental viruses. A total of 67 plants of 10 cultivars (Berkeley, Burlington, Blue Crop, Bluetta, Darrow, Duke, Gila, Jersey, Late Blue, and Northland), were observed for typical Blueberry red ringspot virus (BRRV) symptoms that appear as reddish ring spots and blotches on stems and fruits, exclusively on the upper surface of the older leaves but not the underside. Samples of leaves were collected and maintained at –20°C until used for DNA extraction, then assayed for BRRV infection using PCR. Controls originated from the same blueberry cultivars in vitro. DNA was extracted from leaf tissue with a NucleoSpin Plant II kit for isolating genomic DNA according to the manufacturer's instructions (Macherey-Nagel, Düren, Germany). Primer pair BRRV15/16, which amplified fragments of the reverse transcriptase gene (1), was used in PCR for BRRV detection. The program used for PCR amplification was 94°C for 2 min, followed by 35 cycles at 94°C for 30 s, 49°C for 30 s, and 70°C for 45 s, followed by a final extension at 70°C for 5 min. The total PCR volume of 25 μl contained 20 ng of DNA, 200 μmol liter–1 dNTPs, 0.5 μl of each primer BRRV15 and BRRV16 (20 pmol μl–1), 75 mM Tris-HCl pH 8.8, 20 mM (NH4)2SO4, 0.01% Tween 20, 2.5 mM MgCl2, 2.5 U of Taq Purple DNA polymerase, and stabilizers (Top-Bio Ltd., Prague, Czech Republic). Amplifications were conducted in an MJ Research (Waltham, MA) thermocycler. Aliquots (4 μl) of each PCR product were analyzed by electrophoresis in tris-acetate-EDTA buffer. No BRRV symptoms were observed on the plants in early spring, yet BRRV was detected in one symptom-free bush of cv. Darrow by PCR. In July, typical symptoms developed on that and another cv. Darrow bush that was also positive by PCR. DNA fragments of the expected sizes were amplified from total nucleic acid samples of both infected blueberry bushes using primers BRRV15/16, while no amplification products were detected in plants without symptoms. The amplicons obtained with primers BRRV15/BRRV16 were sequenced and revealed 97.5%-nt identity to the BRRV putative reverse transcriptase gene (GenBank Accession No. AF404509). The 845 nt of the amplicon has been deposited at GenBank under Accession No. HM107773. The disease was likely introduced in infected planting material, since no highbush blueberry plantations exist in the vicinity and V. corymbosum is not native to the Czech Republic. In conclusion, to our knowledge, this is the first report of Blueberry red ringspot virus (genus Soymovirus, family Caulimoviridae) in V. corymbosum L. in the Czech Republic. Symptom observation and PCR testing for BRRV should therefore, be incorporated into the certification scheme for highbush blueberry in the Czech Republic. Reference: (1) J. J. Polashock et al. Plant Dis. 93:727, 2009.

Download Full-text

First Report of Blueberry scorch virus in Black Huckleberry in British Columbia

Plant Disease ◽

10.1094/pdis-91-3-0328c ◽

2007 ◽

Vol 91 (3) ◽

pp. 328-328 ◽

Cited By ~ 4

Author(s):

L. A. Wegener ◽

Z. K. Punja ◽

R. R. Martin

Keyword(s):

British Columbia ◽

Reverse Transcription ◽

Direct Sequencing ◽

Sandwich Elisa ◽

Leaf Tissue ◽

Vaccinium Corymbosum ◽

Negative Control ◽

Highbush Blueberry ◽

First Report ◽

Sequence Identity

Blueberry scorch virus (BlScV), an aphid-borne carlavirus, causes a serious disease of highbush blueberry (Vaccinium corymbosum L.) in North America and Europe. Symptoms of BlScV infection on highbush blueberry include necrosis of flower blossoms and young leaves, shoot blight, and chlorosis. Currently, cranberry (Vaccinium macrocarpon L.) is the only other natural host of BlScV. In July 2004, wild black huckleberry (Vaccinium membranaceumL.) was sampled in the Kootenay Region of southeastern British Columbia. Foliar tissues were sampled during 2004 from 11 bushes from a clearing on the side of a mountain near Crawford Bay, BC, Canada and tested by double-antibody sandwich-ELISA using polyclonal antiserum (Agdia Inc., Elkhart, IN). BlScV was detected in 6 of the 11 bushes sampled and in the positive control (BlScV-infected blueberry leaf tissue) and was not detected in the negative control (healthy blueberry leaf tissue). To confirm the presence of the virus, total nucleic acid was extracted from ELISA-positive huckleberry samples according to an established protocol (A. Rowhani et al. Proc. Int. Counc. Stud. Viruses Virus-Like Dis. Grapevine, Extended Abstr. 13:148, 2000). Reverse transcription-PCR was performed using pd(T)12-18 random primer (Amersham Biosciences, Piscataway, NJ) for reverse transcription and BlScV-specific primers developed against the published NJ-2 sequence of BlScV (GenBank Accession No. NC_003499). Using the forward primer, BS708F, (5′-TCAATCCGTGGTGCTACGAG-3′), and the reverse primer, BS1188R, (5′-ACAGTGCGCAATGTTCCAGT-3′), a 480-bp amplicon was obtained from each of the ELISA-positive samples, while no ampli-cons were observed for the negative control (ELISA-negative huckleberry tissue). Direct sequencing of one selected amplicon revealed 90, 84, and 77% nucleotide sequence identity and 97, 96, and 88% amino acid sequence identity with strains NJ-2, BC-1 (GenBank Accession No. AY941198) and BC-2 (GenBank Accession Nos. AY941199), respectively. BlScV-infected huckleberries were asymptomatic. The presence of BlScV in alternate hosts has implications for disease epidemiology. Testing for BlScV in Vaccinium species in and around commercial highbush blueberry plantings, as well as lowbush blueberry (V. angustifolium Aiton), rabbiteye blueberry (V. ashei Reade), other native Pacific Northwest species (V. ovatum Pursh and V. parvifolium Smith), and ornamental Vaccinium species is warranted. To our knowledge, this is the first report of BlScV infecting black huckleberry.

Download Full-text

First Report of Pestalotiopsis clavispora Causing Twig Blight on Highbush Blueberry (Vaccinium corymbosum) in Anhui Province of China

Plant Disease ◽

10.1094/pdis-04-15-0455-pdn ◽

2016 ◽

Vol 100 (4) ◽

pp. 859 ◽

Cited By ~ 8

Author(s):

Y. Chen ◽

A.-F. Zhang ◽

X. Yang ◽

C.-Y. Gu ◽

E. P. Kyaw ◽

...

Keyword(s):

Vaccinium Corymbosum ◽

Anhui Province ◽

Highbush Blueberry ◽

First Report ◽

Twig Blight

Download Full-text

First report of Tobacco ringspot virus in highbush blueberry in Washington State

Plant Disease ◽

10.1094/pdis-01-21-0183-pdn ◽

2021 ◽

Author(s):

Arunabha Mitra ◽

Sridhar Jarugula ◽

Gwen Hoheisel ◽

Naidu Rayapati

Keyword(s):

South Korea ◽

Vaccinium Corymbosum ◽

Washington State ◽

Ringspot Virus ◽

Highbush Blueberry ◽

Korean Isolate ◽

Total Rna ◽

First Report ◽

Tobacco Ringspot Virus ◽

Cherry Leaf Roll Virus

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Download Full-text