scholarly journals Sawadaea tulasnei Powdery Mildew of Norway Maple (Acer platanoides) in Oregon

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 281-281
Author(s):  
G. Stanosz ◽  
D. Smith
Keyword(s):  
New York ◽  
North America ◽  
Powdery Mildew ◽  
Sequence Data ◽  
Acer Platanoides ◽  
Aesthetic Value ◽  
Norway Maple ◽  
Restrict Movement ◽  
Exotic Pathogen ◽  
The Aesthetic

In August 2012, Norway maple ‘Crimson Century’ trees affected by powdery mildew were observed in Portland, OR. A majority of leaves throughout the crowns on each of the five trees planted in the street terrace on one side of a single city block were affected. White mycelium was present in irregular, discrete, scattered spots or almost continuously on the upper surfaces of leaves and also was present on some petioles. The affected area of the upper surface of leaf blades was estimated to typically be >50%. Chasmothecia were present singly or in groups on the mycelium, and bore simple and bifid appendages (originating from the upper half of the chasmothecia) including some with uncinate or circinate apices that allowed tentative identification to the genus Sawadaea (1). Mean diameter of the chasmothecia was 160 (standard error [SE] = 3.9) μm, and mean appendage length was 72 (SE = 4.9) μm. Asci averaged 77 (SE = 1.2) × 52 (SE = 1.2) μm and ascospores averaged 24 (SE = 0.4) × 12 (SE = 0.3) μm. Braun (1) reported ranges in dimensions of these features as: chasmothecia, (min. 125) 140 to 190 μm; appendages, 40 to 80 μm; asci, 60 to 80 (max. 100) × (min. 30) 35 to 50 (max. 55) μm; and ascospores 15 to 25 (max. 30) × 10 to 15 μm. Nuclear rDNA sequence data was obtained for ITS1, 5.8S, and ITS2 regions using primers PMITS1 and PMITS2. A BLASTn search revealed that the data (430 bp) obtained (GenBank Accession No. KF258718) exactly matched respective sequences of Sawadaea tulasnei (AB193363, AB193385, AB193390, AB193391, and EU247884), and differed from respective sequence data for S. bicornis (AB193380) by 22 nucleotides. S. tulasnei is a European species previously found on maples including Acer platanoides. However, this pathogen has been reported only rarely in North America in the states of New York, Ohio, and Wisconsin, and the province of Quebec (2,3,4). Although not likely to seriously affect the growth or survival of established trees, severe powdery mildew can detract from the aesthetic value of trees. Further, S. tulasnei might seriously damage small seedlings, and detection of this exotic pathogen in nurseries should restrict movement of stock. To our knowledge, this is the first report of S. tulasnei in western North America, and it indicates the distribution of this pathogen is transcontinental. Specimens have been deposited in the U.S. National Fungus Collections (BPI 892675). References (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena-Stuttgart-New York, 1995. (2) S. Hirose, et al. Mycol. Res. 109:912, 2005. (3) B. Hudelson, et al. Plant Dis. 92:485, 2008. (4) J. Weiland and G. Stanosz. Plant Dis. 90:830, 2006.

scholarly journals Sawadaea tulasnei Powdery Mildew of Norway Maple (Acer platanoides) in North America

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 830-830
Author(s):  
J. Weiland ◽  
G. Stanosz
Keyword(s):  
United States ◽  
New York ◽  
North America ◽  
Powdery Mildew ◽  
Acer Saccharum ◽  
The United States ◽  
Rdna Its ◽  
Maple Leaves ◽  
Norway Maple ◽  
Genus 2

Norway maple leaves bearing powdery mildew were collected from one location in the fall of 2003 and four locations (as much as 1.5 km apart) in the fall of 2005 in Buffalo, NY. No powdery mildew was observed on leaves collected from sugar maples (Acer saccharum) that were present in the vicinity of affected Norway maples at two locations. Trees were located along streets and in yards. Diseased leaves were present throughout tree crowns but lower leaves were more commonly affected. White mycelium was present in irregular, discrete, scattered spots only on the upper surface of leaves and on both sides of wings of samaras. Typically, <10% of the upper leaf area bore visible mycelium. Cleistothecia were present singly or in groups on the mycelium. Morphology of cleistothecia on leaves collected each year, including simple and bifid appendages with uncinate to circinate apices, was sufficient to identify the pathogen to the genus Sawadaea (1). Other characteristics were not sufficiently distinct to make an identification of S. bicornis or S. tulasnei (1), each a European species found on Acer spp. However, a sample from 2003 was supplied by the authors for use in a study of phylogeny of the genus (2) that served as a first report of the species in the United States. Analysis of nuclear rDNA ITS sequence of this specimen (GenBank Accession No. AB193390) placed the sample in a clade with S. tulasnei specimens from Europe. In the same study, powdery mildew samples from Acer spp. in Ohio and Montreal, Canada also were placed in this clade. Thus, occurrence of S. tulasnei in North America is confirmed. S. bicornis was recently identified (based on morphology) on Norway maple in the western United States (3). Specimens from Buffalo, NY have been deposited in the U.S. National Fungus Collections (BPI 871210). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena-Stuttgart-New York, 1995. (2) S. Hirose et al. Mycol. Res. 109:912, 2005. (3) C. Nischwitz and G. Newcombe. Plant Dis. 87:451, 2003.

scholarly journals Sawadaea Powdery Mildew of Box Elder (Acer negundo) in Wisconsin

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 636-636 ◽  
Author(s):  
G. Stanosz ◽  
D. Smith ◽  
J. Stanosz
Keyword(s):  
New York ◽  
North America ◽  
Powdery Mildew ◽  
Lower Surface ◽  
Rdna Its ◽  
Powdery Mildews ◽  
Box Elder ◽  
Norway Maple ◽  
White Mycelium ◽  
Powdery Mildew Pathogen

Box elder leaves affected by powdery mildew were collected from a single tree in an urban yard in the fall of 2006 in Madison, WI. As much as half of the area of the leaf blades, when viewed from above or below, was pale green-to-tan and necrotic. Mycelium was not visible to the eye on either the upper or lower leaf surfaces, but very sparse white mycelium was observed on the lower surface of leaves with the aid of a dissecting microscope. Chasmothecia were present singly or in groups of a few on the lower surface of leaves. Morphology of the chasmothecia, including simple and bifid appendages with uncinate to circinate apices, was sufficient to identify the pathogen to the genus Sawadaea (1). Other characters were not sufficiently distinct to make an identification of the species. However, DNA was extracted from the chasmothecia, and analysis of a 542-bp sequence of nuclear rDNA ITS (GenBank Accession No. EF122238) revealed a 100% match with the respective sequence obtained from Genbank for S. bicornis (Accession No. AB193380). A specimen from which these chasmothecia were obtained has been deposited in the U.S. National Fungus Collections (BPI 877328). S. bicornis is a European pathogen of maples, including box elder when grown there (1). Knowledge of the geographic distribution and hosts of Sawadaea powdery mildews in North America is extremely limited. S. bicornis was first reported in North America only recently, occurring in the states of Idaho and Washington on Norway maple (Acer platanoides) (3). The morphologically very similar European powdery mildew pathogen of maples, S. tulasnei, is known only from New York, Ohio, and Montreal, Canada (4), and an unidentified Sawadaea species on box elder has been reported from California (2). References (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena-Stuttgart-New York, 1995. (2) S. Hirose et al. Mycol. Res. 109:912, 2005. (3) C. Nischwitz and G. Newcombe. Plant Dis. 87:451, 2003. (4) J. Weiland and G. Stanosz. Plant Dis. 90:830, 2006.

scholarly journals First Report of Sawadaea tulasnei Powdery Mildew of Norway Maple (Acer platanoides) in Wisconsin

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 485-485
Author(s):  
B. Hudelson ◽  
D. Smith ◽  
G. Stanosz ◽  
M. Hanson
Keyword(s):  
New York ◽  
Powdery Mildew ◽  
Acer Platanoides ◽  
Rdna Its ◽  
Powdery Mildews ◽  
Beaver Dam ◽  
Norway Maple ◽  
Leaf Surfaces ◽  
White Mycelium ◽  
Powdery Mildew Pathogen

Leaves affected by powdery mildew were collected from a Norway maple tree in early October 2007 in Beaver Dam, WI (Dodge County). Diseased leaves were present throughout the crown of this tree, with white mycelium in irregular and often vein-associated spots and often covering as much as 50% of the upper surfaces of leaves. Examination of the lower surfaces revealed necrosis of the areas underlying mycelium. Blades of samaras also bore white mycelium. Chasmothecia were present singly or in groups on the mycelium. Morphology of chasmothecia, including simple and bifid appendages with uncinate to circinate apices, was sufficient to identify the pathogen to the genus Sawadaea (1). Data for nuclear rDNA ITS sequence (546 bp) obtained for a specimen (GenBank Accession No. EU247884) exactly matched sequences for Sawadea tulasnei (GenBank Accession Nos. AB 193363, 478 bp; AB193385, 490 bp; AB193390 and AB193391, 546 bp). This data was 96% similar (528 of 552 nucleotides) to that of another European powdery mildew pathogen, S. bicornis (GenBank Accession No. AB193380), which is also reported to occur on maples in Idaho, Washington, and Wisconsin (2,3). A further survey revealed the same fungus on several additional nearby Norway maples along streets and in yards (including varieties with both darkly colored and variegated leaves), but on these trees very few leaves were affected and usually less than 5% of the upper leaf surfaces bore mycelium. This pathogen was not observed on leaves of either red (A. rubrum) or silver maples (A. saccharinum) examined in the same area. S. tulasnei was previously known in North America only by collections in New York, Ohio, and Montreal, Canada (4), but our observation indicates that the geographic distribution of this pathogen is probably much broader and overlaps with that of S. bicornis. Specimens from Beaver Dam, WI have been deposited in the U.S. National Fungus Collections (BPI 878273). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena-Stuttgart, New York, 1995. (2) C. Nischwitz and G. Newcombe. Plant Dis. 87:451, 2003. (3) G. Stanosz et al. Plant Dis. 91:636, 2007. (4) J. Weiland and G. Stanosz. Plant Dis. 90:830, 2006.

Morphology and molecular studies on large Neidium species (Bacillariophyta) of North America, including an examination of Ehrenberg’s types

Phytotaxa ◽  
2015 ◽  
Vol 220 (3) ◽  
pp. 201 ◽  
Author(s):  
Keely E Lefebvre ◽  
Paul B Hamilton
Keyword(s):  
New York ◽  
North America ◽  
Phylogenetic Trees ◽  
Sequence Data ◽  
New York State ◽  
Central Area ◽  
Large Species ◽  
Sem Images ◽  
Wide Range ◽  
Future Work

The genus Neidium contains a large array of diatoms with a wide range in structural and morphological forms. Many of the larger species in this genus are old taxa dating back to the 1800s. However, there continues to be confusion over these large species including N. iridis, N. dilatatum, N. firma, and N. amphigomphus. In this study, selected Neidium taxa from North America were examined using LM and SEM images from both Ehrenberg’s original samples and present day samples from Ontario (Canada) and New York State (USA). As well, Neidium individuals were isolated from Adriondack Park, NY (USA) and Ontario (Canada), amplified using a nested PCR protocol and sequenced for rbcL and 18S barcoding genes. The sequence data was concatenated to construct phylogenetic trees using Maximum Likelihood and Bayesian Analysis techniques. Here we present emended species descriptions and sequence data of four previously named Neidium taxa: N. tumescens, N. hitchcockii, N. dilatatum and N. amphigomphus. In addition, we designate isolectotypes for N. hitchcockii, N. dilatatum and N. amphigomphus. A new species is also formally described—N. fossum, sp. nov.—with a designated holotype and sequence data. Neidium fossum is distinguished by its size, longitudinal canal structure, central area and proximal raphe ends. Future work combining traditional morphological methods and phylogenetic methods will allow for further delineation of Neidium species and other diatom taxa.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽  
2010 ◽  
Vol 94 (2) ◽  
pp. 279-279 ◽  
Author(s):  
A. M. Minnis ◽  
A. Y. Rossman ◽  
D. L. Clement ◽  
M. K. Malinoski ◽  
K. K. Rane
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Dna Sequence ◽  
Sequence Data ◽  
Its Region ◽  
Podosphaera Leucotricha ◽  
First Report ◽  
Pyrus Calleryana ◽  
Dna Sequence Data ◽  
Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

scholarly journals First Report of Powdery Mildew on Flamboyant Tree Caused by Erysiphe quercicola in Brazil

Plant Disease ◽  
2012 ◽  
Vol 96 (4) ◽  
pp. 589-589 ◽  
Author(s):  
L. J. Dallagnol ◽  
F. R. de Castro ◽  
G. Frare ◽  
L. E. A. Camargo
Keyword(s):  
Powdery Mildew ◽  
Developmental Stages ◽  
Its Region ◽  
Negative Control ◽  
Its2 Region ◽  
Academic Press ◽  
Aesthetic Value ◽  
Floral Buds ◽  
Erysiphe Quercicola ◽  
The Aesthetic

Flamboyant (Delonix regia) is an ornamental tree that is native to Madagascar and frequently used in gardens and parks worldwide. Powdery mildew was observed on flamboyant plants in the cities of Piracicaba and São Carlos (State of São Paulo, Brazil) during the springs of 2010 and 2011. All sampled plants (~15 plants) were affected by the disease. Affected plants had abundant, white powdery masses of conidia and mycelium on floral buds that is typical of powdery mildew, but these structures were not observed on leaves and petioles. Diseased buds were observed at all developmental stages. The fungus was identified as Erysiphe quercicola on the basis of scanning electron microscopy, light microscopy, and sequence analysis of the internal transcribed spacer (ITS) region. Conidia were produced in short chains of four to five spores on erect conidiophores. Conidiophores were unbranched, cylindrical, 50 to 80 μm long (mean 68.8 ± 10.8 μm), composed of a cylindrical foot cell 25 to 40 μm long (mean 32.2 ± 4.9 μm), and one to two shorter cells. Conidia were ellipsoid-ovoid to subcylindrical, 22 to 37 μm long (mean 30.9 ± 4.4 μm), and 10 to 18 μm wide (mean 15.1 ± 2.8 μm). Germ tubes were produced apically and ended in a lobed appressorium. Colonizing hyphae also had a well-developed lobed appressorium. Chasmothecia were not observed on buds. DNA was extracted from conidia, conidiophores, and mycelium and used to amplify the ITS (ITS1-5.8s-ITS2) region using the ITS1 and ITS4 primers (2) and its sequence (612 nt) was deposited under Accession No. JQ034229 in the GenBank. Searches with the BLASTn algorithm revealed 100% similarity with E. quercicola from oak (Accession Nos. AB292693.1, AB292691.1, and AB292690.1) (1). To fulfill Koch's postulates, 10 detached young floral buds, 0.4 to 0.8 cm in diameter, were inoculated with five to eight conidia collected on floral buds using an eyelash brush. Inoculated buds were placed on moistened filter paper in petri dishes. The negative control consisted of noninoculated young floral buds. Inoculated and noninoculated buds were incubated in a growth chamber at 25°C and a 12-h photoperiod. Powdery mildew structures were observed 6 to 8 days after inoculation. To our knowledge, E. quercicola has not been reported previously as a pathogen of flamboyant tree since there is no record in the Erysipahales database ( http://erysiphales.wsu.edu/ ). Although the economic impact of the disease is limited, its incidence might induce the abortion of floral buds and accelerate the senescence of flowers, thus reducing the aesthetic value of the trees. References: (1) S. Takamatsu et al. Mycol Res. 111:809, 2007. (2) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera (Sphaerotheca) fusca on Euryops pectinatus in North America

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1048-1048 ◽  
Author(s):  
G. S. Saenz ◽  
S. T. Koike ◽  
N. Shishkoff
Keyword(s):  
United States ◽  
New York ◽  
North America ◽  
Powdery Mildew ◽  
Fungal Growth ◽  
The United States ◽  
Voucher Specimen ◽  
First Report ◽  
Humidity Chamber ◽  
Powdery Mildew Pathogen

Gray-leaved Euryops (Euryops pectinatus Cass., Asteraceae) is an evergreen shrub that is widely planted in landscapes in the United States. In the fall of 1999, powdery mildew was observed on E. pectinatus planted in landscapes in Redlands (San Bernardino County), CA. Symptoms consisted only of slight cupping of leaves. Fungal growth was observed on stems, leaves, petioles, and pedicels and was ectophytic and amphigenous. The white mycelium was patchy to effuse. Hyphal appressoria were indistinct (1). Conidiophore foot cells were cylindric and sometimes were tapered toward or constricted at the base. Foot cells measured 30 to 50 by 10 to 12 μm and were followed by one to two shorter cells. Conidia were cylindric to slightly doliform, borne in chains of two to three, and measured 26 to 38 by 14 to 18 μm. Conidial length to width ratios ranged from 1.7 to 2.4. Catenate conidia had crenate edge lines (3). Conidia possessed conspicuous fibrosin bodies and from their sides produced short germ tubes without appressoria. Cleistothecia were not observed. Based on these characters, the fungus was identified as Podosphaera fusca (Fr.) U. Braun & N. Shishkoff (Podosphaera sect. Sphaerotheca) (1,2). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of healthy E. pectinatus plants. Plants were incubated in a humidity chamber at 22 to 24°C and after 12 to 14 days powdery mildew colonies developed. E. pectinatus cv. Viridis, a cultivar that lacks the extensive pubescence of E. pectinatus, also developed disease when inoculated. This appears to be the first report of powdery mildew on E. pectinatus in North America. A voucher specimen has been deposited into the University of California Herbarium (accession # UC1738635). P. fusca was also observed on cv. Viridis in a nursery in New York in 1999. It is unclear where this pathogen originated. P. fusca parasitizes a large number of asteraceous species including dandelion (Taraxacum officinalis) and sowthistle (Sonchus spp.) weeds, which occur in the area and sometimes are infected with powdery mildew. The Euryops powdery mildew pathogen may be a race that is different than those found on other composites in the United States. The fungus was observed on plants in shaded areas but not on plants in full sun. References: (1) U. Braun. Nova Hedwigia 89:1, 1987. (2) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (3) H. D. Shin and Y. J. La. Mycotaxon 46:445, 1993.

scholarly journals Low Genetic Diversity Suggests the Recent Introduction of Dogwood Powdery Mildew to North America

Plant Disease ◽  
2019 ◽  
Vol 103 (11) ◽  
pp. 2903-2912
Author(s):  
Christopher R. Wyman ◽  
Denita Hadziabdic ◽  
Sarah L. Boggess ◽  
Timothy A. Rinehart ◽  
Alan S. Windham ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Population Structure ◽  
North America ◽  
Powdery Mildew ◽  
The United States ◽  
Data Sets ◽  
Flowering Dogwood ◽  
Low Genetic Diversity ◽  
Length Data ◽  
Exotic Pathogen

Cornus florida (flowering dogwood) is a popular understory tree endemic to the eastern hardwood forests of the United States. In 1996, dogwood powdery mildew caused by Erysiphe pulchra, an obligate biotrophic fungus of large bracted dogwoods, reached epidemic levels throughout the C. florida growing region. In the late 1990s, both sexual and asexual stages of E. pulchra were regularly observed; thereafter, the sexual stage was found less frequently. We examined the genetic diversity and population structure of 167 E. pulchra samples on C. florida leaves using 15 microsatellite loci. Samples were organized into two separate collection zone data sets, separated as eight zones and two zones, for the subsequent analysis of microsatellite allele length data. Clone correction analysis reduced the sample size to 90 multilocus haplotypes. Our study indicated low genetic diversity, a lack of definitive population structure, low genetic distance among multilocus haplotypes, and significant linkage disequilibrium among zones. Evidence of a population bottleneck was also detected. The results of our study indicated a high probability that E. pulchra reproduces predominately via asexual conidia and lend support to the hypothesis that E. pulchra is an exotic pathogen to North America.[Formula: see text] Copyright © 2019 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Sea Lamprey (Petromyzon marinus) Populations in Northeastern North America: Genetic Differentiation and Affinities

1985 ◽  
Vol 42 (4) ◽  
pp. 776-784 ◽  
Author(s):  
Janet Wright ◽  
Charles C. Krueger ◽  
Peter F. Brussard ◽  
Marjorie Collings Hail
Keyword(s):  
New York ◽  
North America ◽  
Petromyzon Marinus ◽  
Spatial Differentiation ◽  
Invasion History ◽  
Genetic Population ◽  
Upper Great Lakes ◽  
Northeastern North America ◽  
Sea Lampreys ◽  
Restrict Movement

We examined genetic population structure in 3253 sea lampreys (Petromyzon marinus) sampled at 53 sites in northeastern North America and the British isles. Hierarchical F-statistics of allozyme frequencies indicated that genetic divergence from lake to lake and river to river was greater than divergence among sites within fakes or rivers and also greater than that attributable to the separation of landlocked freshwater from coastal anadromous systems. Lampreys from different lakes varied considerably in the amount of spatial differentiation evident. New York freshwater populations of uncertain invasion history were no more genetically differentiated than were recently introduced upper Great Lakes populations. The apparent reproductive isolation of lampreys in Lake Erie from Lake Ontario populations, despite canal connections, suggests that movement is limited between lakes. Future studies should determine the cause so that management techniques to restrict movement can be developed to control populations.

Sign in / Sign up

Export Citation Format

Share Document