Aphelenchoides besseyi parasitizing cowpea (Vigna unguiculata) in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Luciany Favoreto ◽  
Rafaela Bueno ◽  
Angélica Calandrelli ◽  
Patrícia Priscila França ◽  
Mauricio Conrado Meyer ◽  
...  
Keyword(s):  
Common Bean ◽  
Vigna Unguiculata ◽  
Host Reaction ◽  
First Report ◽  
Cowpea Cultivars ◽  
The World ◽  
Cotton Plants ◽  
Aphelenchoides Besseyi ◽  
Leaf Deformation

Several species of nematodes are known to cause losses to cowpea (Vigna unguiculata) throughout the world. In Brazil, Aphelenchoides besseyi was recently described causing damages on soybean, cotton, and common bean, but no report was found about the parasitism of this nematode in cowpea. The present study aimed to verify the host reaction of cowpea cultivars to A. besseyi. The experiment was conducted under greenhouse conditions, using as inoculum two A. besseyi populations, obtained from symptomatic soybean and cotton plants collected in naturally infested fields. Cultivars ‘Imponente’, ‘Aracê’, ‘Guariba’, ‘Tumucumaque’, ‘Nova Era’, and ‘Tracuateua’ were inoculated with 500 A. besseyi of each population, separately, into soil and after 30 days from the inoculation nematodes were extracted from shoot systems. Both populations were able to parasitize all the cowpea cultivars. Independently of the cultivar, cowpea plants exhibited symptoms of leaf deformation similar to those described for soybean, cotton, and common bean and, in addition, severe brooming was observed and the interior of the stems was porous and necrotic. To our knowledge, this is the first report of parasitism by A. besseyi of cowpea in Brazil, under greenhouse conditions, increasing the list of hosts of this nematode.

Aphelenchoides besseyi Parasitizing Common Bean in Brazil

Plant Disease ◽  
2020 ◽  
Author(s):  
Luciany Favoreto ◽  
Mauricio Conrado Meyer ◽  
Angélica Calandrelli ◽  
Michele Corpolato Maia Silva ◽  
Santino Aleandro Silva ◽  
...  
Keyword(s):  
Costa Rica ◽  
Phaseolus Vulgaris ◽  
Common Bean ◽  
Management Strategies ◽  
First Report ◽  
Bean Plants ◽  
Shoot System ◽  
Aphelenchoides Besseyi ◽  
Common Bean Plants ◽  
Foliar Retention

Aphelenchoides besseyi is the causal agent of soybean green stem and foliar retention syndrome known as Soja Louca II. This nematode has recently been reported parasitizing cotton in Brazil. In Costa Rica, it causes the symptoms known as “amachamiento” and false angular spots in common bean (Phaseolus vulgaris). Due to the great importance of beans to Brazilian agriculture, the objective of this research was to study the pathogenicity of A. besseyi in common bean under greenhouse conditions, including its endoparasitic relationships by staining root and shoot system tissues with fuchsin acid. In addition, A. besseyi was collected and quantified from shoot systems 30 days after inoculation by washing the tissue in water and blender centrifugal-flotation. We observed the symptoms of “amachamiento”, leaf and vein deformation in the expanded trifoliate leaves, and also leaves with necrotic, brown to reddish and angular lesions, characteristics from false angular spot, and deformed stems characterized by enlargement of nodes, retortions and necrotic lesions. High numbers of nematodes were found inside common bean plants. This is the first report of the pathogenicity and symptoms caused by A. besseyi in common bean in Brazil. These findings are important for development of management strategies to avoid losses on bean cropped in infested areas.

scholarly journals First Report of Aphelenchoides besseyi Infecting the Aerial Part of Cotton Plants in Brazil

Plant Disease ◽  
2018 ◽  
Vol 102 (12) ◽  
pp. 2662-2662 ◽  
Author(s):  
L. Favoreto ◽  
V. O. Faleiro ◽  
M. A. Freitas ◽  
L. R. Brauwers ◽  
R. Galbieri ◽  
...  
Keyword(s):  
Aerial Part ◽  
First Report ◽  
Cotton Plants ◽  
Aphelenchoides Besseyi

First report of Rinamba opacicollis Cameron (Hymenoptera: Braconidae, Doryctinae) in India as parasitoid of coffee stem borer, Xylotrechus quadripes (Chevrolat) (Coleoptera: Cerambycidae)

ENTOMON ◽  
2020 ◽  
Vol 44 (4) ◽  
pp. 311-314
Author(s):  
A. Roobakkumar ◽  
H.G. Seetharama ◽  
P. Krishna Reddy ◽  
M.S. Uma ◽  
A. P. Ranjith
Keyword(s):  
Integrated Control ◽  
Host Record ◽  
Stem Borer ◽  
Arabica Coffee ◽  
First Report ◽  
The World ◽  
First Time

Rinamba opacicollis Cameron (Hymenoptera: Braconidae) was collected from Chikkamagaluru, Karnataka, India for the first time from the larvae of white stem borer, Xylotrechus quadripes Chevrolat infesting arabica coffee. Its role in the biological or integrated control of X. quadripes remains to be evaluated. White stem borer could be the first host record of this parasitoid all over the world.

RENDIMENTO DE CULTIVARES DE CAUPI (Vigna unguiculata L Walp.) SUBMETIDAS À DIFERENTES LÂMINAS DE IRRIGAÇÃO

Irriga ◽  
1999 ◽  
Vol 4 (3) ◽  
pp. 139-144 ◽  
Author(s):  
Gianini Peixoto Bezerra Lima ◽  
José Vanglesio de Aguiar ◽  
Raimundo Nonato Távora Costa ◽  
Vital Pedro da Silva Paz
Keyword(s):  
Vigna Unguiculata ◽  
Irrigation System ◽  
Northeast Brazil ◽  
Marginal Product ◽  
Applied Water ◽  
Cowpea Cultivars ◽  
The North ◽  
Significant Difference ◽  
Caixa Postal ◽  
Water Depths

RENDIMENTO DE CULTIVARES DE CAUPI (Vigna unguiculata L Walp.) SUBMETIDAS À DIFERENTES LÂMINAS DE IRRIGAÇÃO1       Gianini Peixoto Bezerra Lima José Vanglesio de Aguiar Raimundo Nonato Távora Costa Universidade Federal do Ceará – Departamento de Engenharia Agrícola. Campus do Pici. Bloco 804. CEP 60455-760 – Fortaleza-CE Vital Pedro da Silva Paz Escola Superior de Agricultura Luiz de Queiroz – Departamento de Engenharia Rural, bolsista da FAPESP. Av. Pádua Dias, 11 – Caixa Postal 11. 13418-900 – Piracicaba-SP       1 RESUMO       O caupi é um dos cultivos mais tradicionais do Norte e Nordeste do Brasil, constituindo alimento básico nestas regiões. Com este trabalho foi possível estabelecer relações entre a quantidade de água aplicada e produtividade de grãos, para três variedades de feijão caupi submetidas a diferentes lâminas de água. Para caracterização das lâminas de água foi utilizado um sistema de irrigação por aspersão convencional em linha. O controle da irrigação foi realizado a partir de tensiômetros instalados à 15 cm de profundidade. Os resultados mostraram que: i) a cultivar João Paulo II apresentou melhores resultados de produtividade para as lâminas de água aplicadas que variaram de T1 = 291,8 mm a T5 = 141,2 mm; ii) sob condições de reduzida disponibilidade de água, ou seja, menor lâmina aplicada, não ocorreu diferença estatística  para a produtividade entre as cultivares estudadas; e iii) para as condições do estudo, a cultivar Setentão apresentou a menor taxa de redução do produto marginal.       UNITERMOS: caupi, irrigação, função de produção       LIMA, G. P. B., AGUIAR, J. V., COSTA, R. N. T., PAZ, V. P. S. Responses OF cowpea cultivars (Vigna unguiculata L Walp) at differents irrigation deficits     2 ABSTRACT       The caupi is one of the most traditional cultivation of the north and northeast - Brazil, constituting a basic food in these areas. With this work it was possible to establish relationships between the amount of water applied and productivity of grains, for three caupi varieties submitted to different irrigation sheets. To diferentiate water depths in the irrigation system, the aspersion in line was used. The control of the irrigation was accomplished using tensiometers installed to 15 cm of depth. The results showed that: i) the João Paulo II variety presented better productivity for the applied water depths; ii) under reduced conditions of water avai lability for study conditions, these was no significant difference in the productivity reached among the cultivars studied; and iii) for the conditions of the study, the variety Setentão presented the smallest rate of reduction of the marginal product.       KEYWORDS: cowpea, irrigation, production function  

scholarly journals First report on the prevalence of Fasciola hepatica in the endangered Père David’s deer (Elaphurus davidianus) in China

2020 ◽  
Vol 16 (1) ◽  
Author(s):  
Si-Yang Huang ◽  
Jing-Zhi Gong ◽  
Yi-Jun Ren ◽  
Ming Pan ◽  
Wei-Min Cai ◽  
...  
Keyword(s):  
Fasciola Hepatica ◽  
Potential Threat ◽  
Prevalence Data ◽  
First Report ◽  
Natural Reserve ◽  
Zoonotic Parasite ◽  
The World ◽  
Père David’S Deer ◽  
Microscopy Examination ◽  
Elaphurus Davidianus

Abstract Background Fasciola hepatica is an important zoonotic parasite that causes fasciolosis in a broad range of animals. No information is available about the prevalence of F. hepatica in Père David’s deer (Elaphurus davidianus), an endangered species in the world. Therefore, the purpose of the study was to evaluate the prevalence of fasciolosis in Père David’s deer in the Dafeng Elk National Natural Reserve, Jiangsu province, China. Results In this study, 142 fecal samples from Père David’s deer were analyzed for F. hepatica by microscopy and nest-PCR. Only one sample was positive for F. hepatica according to microscopy examination, while 18 of 142 (12.68, 95%CI: 2.841–22.45%) samples were positive for F. hepatica according to nest-PCR results. Conclusions This is the first report of prevalence of F. hepatica in Père David’s deer. The prevalence data indicated that F. hepatica was also present in this endangered animal, which may cause a potential threat to this precious species.

scholarly journals Changes in growth and nutrient uptake in response to foliar application of sodium and calcium chloride in cowpea cultivars (Vigna unguiculata L. Walp)

2014 ◽  
Vol 13 (47) ◽  
pp. 4382-4389 ◽  
Author(s):  
Desire Taffouo Victor ◽  
Ekwel Sondi Serge ◽  
Tekam Meguekam Liliane ◽  
Erve Nouck, Oscar Fotsop Wamba Alphonse ◽  
Youmbi Emmanuel
Keyword(s):  
Nutrient Uptake ◽  
Calcium Chloride ◽  
Vigna Unguiculata ◽  
Foliar Application ◽  
Cowpea Cultivars

scholarly journals Genetic diversity and population structure of a mini-core subset from the world cowpea (Vigna unguiculata (L.) Walp.) germplasm collection

2018 ◽  
Vol 8 (1) ◽  
Author(s):  
Christian Fatokun ◽  
Gezahegn Girma ◽  
Michael Abberton ◽  
Melaku Gedil ◽  
Nnanna Unachukwu ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Population Structure ◽  
Vigna Unguiculata ◽  
Germplasm Collection ◽  
Core Subset ◽  
The World

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Common Bean (Phaseolus vulgaris) Stem Rot Caused by Colletotrichum spaethianum in China

Plant Disease ◽  
2019 ◽  
Vol 103 (1) ◽  
pp. 151
Author(s):  
L. Yang ◽  
X. H. Lu ◽  
Y. L. Jing ◽  
S. D. Li ◽  
B. M. Wu
Keyword(s):  
Phaseolus Vulgaris ◽  
Common Bean ◽  
Stem Rot ◽  
First Report

scholarly journals Exposure of Domestic Cats to Distinct Ehrlichia canis TRP Genotypes

2021 ◽  
Vol 8 (12) ◽  
pp. 310
Author(s):  
Ísis Assis Braga ◽  
Isis Indaiara Gonçalves Granjeiro Taques ◽  
Estefânia Crivelatti Grontoski ◽  
Ingrid Savino de Oliveira Dias ◽  
Nathalia Assis Pereira ◽  
...  
Keyword(s):  
Antibody Test ◽  
Ehrlichia Canis ◽  
Indirect Fluorescence Antibody Test ◽  
Domestic Cats ◽  
Serum Samples ◽  
Specific Antibodies ◽  
First Report ◽  
The World ◽  
Fluorescence Antibody ◽  
Indirect Fluorescence Antibody

Cats naturally exposed to Ehrlichia canis have been described in different regions of the world, but little is known about the genotypes associated with infection in these animals. To detect E. canis-specific antibodies and investigate the E. canis TRP genotypes in cats, serum samples from 76 domestic cats reactive to crude E. canis antigens by the indirect fluorescence antibody test (IFAT) were analyzed by ELISA, using E. canis-specific peptides (i.e., TRP19 and TRP36 /BR/US/CR). Of these, 25 (32.9%) cats reacted to at least one TRP peptide, confirming their specific exposure to E. canis. Eighteen (23.7%) cats reacted to TRP19, 15 (19.8%) to BRTRP36, and 11 (14.5%) to USTRP36, but none of them reacted to CRTRP36. Eight (10.5%) cats reacted to TRP19 but not to any TRP36 genotype, demonstrating the possible existence of a new E. canis genotype infecting felines. Nevertheless, this study provides the first report of anti-E. canis-specific antibodies in domestic cats.

Sign in / Sign up

Export Citation Format

Share Document