scholarly journals Strongylodon macrobotrys: new host of soybean mosaic virus in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Viviana Marcela Camelo-Garcia ◽  
Arnaldo Esquivel-Fariña ◽  
Camila Geovana Ferro ◽  
Elliot W. Kitajima ◽  
Jorge Alberto Marques Rezende
Keyword(s):  
Soybean Mosaic Virus ◽  
Nucleotide Sequences ◽  
Symptom Expression ◽  
Rt Pcr ◽  
Biological Assays ◽  
Jack Bean ◽  
Total Rna ◽  
Anticancer Properties ◽  
Bean Plants ◽  
Symptomatic Plant

Strongylodon macrobotrys, commonly known as the jade vine, emerald vine, or turquoise jade vine, is a species of Fabaceae native to the Philippines. The plants have blue-green color inflorescences, which makinge them one of the most admired ornamental plants in Brazil (Muniz et al. 2015). In addition, the plants contain compounds with anticancer properties (Ragasa et al. (2014) isolated compounds from S. macrobotrys with anticancer properties. In March 2019, an adult jade plant, grown under the trellis system in an experimental area at the campus of the University of São Paulo (USP), Piracicaba, state of São Paulo, was found showing mosaic symptoms typical of a virus infection. Preliminary examination of negatively stained leaf extracts by transmission electron microscopy detected elongated, flexuous particles similar tolike thoseat of a potyviruses. Further observations of thin sections of symptomatic leaf tissues revealed the presence of cylindrical inclusions, as well as bundles of thin, elongated, and filamentous particles, typical of potyvirus infection in epidermal, parenchymalparenchymal, and vascular regions, as well as bundles of thin, elongated and filamentous particles. Subsequent molecular and biological assays confirmed the presence of a potyvirusTo identify the species of the virus, .Presence of a potyvirus was confirmed by subsequent molecular and biological assays. Ttotal RNA was extracted from a pool of symptomatic leaves from the plant using the Purelink viral RNA/DNA kit (Thermo Fisher Scientific), and analyzed by one- step RT-PCR using potyviruses universal primers PV1/SP6 and WCIEN-sense (Mackenzie et al. 1998; Maciel et al. 2011), which amplify a 750-bp fragment. Total RNA extracted from an asymptomatic jade vine, obtained from a florist shop, was used as a negative controlincluded in the assay. PCR products at the expected size (~750-bp) were observed in the symptomatic plant but not in the asymptomatic plant. BLASTn analysis of the Nnucleotide sequence of the amplicon obtained only from total RNA of the symptomatic plant (GenBank accession no. MN970030) showed that it shares 90.82% to 97.859% identity with corresponding nucleotide sequences of the Korean isolate WS162 of soybean mosaic virus (SMV) deposited at the GenBank (, accession no. FJ640973, FJ640956, D88616). Extracts from symptomatic leaves of the jade plant wereas mechanically inoculated onto leaves of healthy plants of jade vine, Jack bean (Canavalia ensiformis), soybean cv. NA 5909 (Glycine max), cowpea (Vigna unguiculata), and passion fruit (Passiflora edulis f. flavicarpa). One plant of jade plant and four plants of each other species were inoculated , and infection was assessed based and monitored for symptom expression on symptom expression, and RT-PCR. The jade vine and Jack bean plants were infected by SMV, showingdeveloped mild mosaic symptoms approximately 60 and 15 days after inoculation, respectively , whereas the plants of other species were absent of any visible symptoms . To confirm the potyvirus identity, the jade vine samples were also tested by cConventional RT-PCR with SMV-specific primers pairs CP-F-SMV/CP-R-SMV (Jaramillo Mesa et al., 2018) and SMV-CPf/SMV-CPr (Wang and Ghabrial, 2002), thawhicht amplify fragments of 1000 990-bp and 469-bp90, respectively, nucleotides offrom the CP geneome region of SMV was performed, respectively. Amplicons of expected sizes were obtained from the total RNA of the leaves of field-infected and the mechanically inoculated plant of jade plantsvine as well as the Jack bean plants, but not from the asymptomatic jade plantvine and plants of other species the negative control. The viral nucleotide sequences obtained with the above pairs of primersBLASTn analysis of nucleotide sequences of the amplicons showed that they share 96.81% and 97.63% identity, respectively, with the same Korean SMV isolate WS162. These results demonstrate that… the field-symptomatic jade vine was infected with SMV, which is naturally transmitted by aphids speciess in a non-persistent manner and via soybean infected seeds (Hajimorad et al. 2018)( ). The virus appears to have has a restricted narrow natural host range., Aapart from soybean, and to date, it has only been reported the natural infection has been documented only in soybean, Lagenaria siceraria, Passiflora spp., Pinellia ternata, Senna occidentalis, and Vigna angularis (Almeida et al., 2002; Chakraborty et al. 2016; Hajimorad et al. 2018). To our knowledge, this is the first report of SMV in S. macrobotrys in the world. Further surveys are necessary to determine the incidence of the virus in ornamental jade plants vines and its importance as virus reservoirs for commercial soybean crops.

scholarly journals First Report of Peanut mottle virus Infecting Soybean in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1285-1285 ◽  
Author(s):  
S. Lim ◽  
Y.-H. Lee ◽  
D. Igori ◽  
F. Zhao ◽  
R. H. Yoo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
South Korea ◽  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Nucleotide Sequences ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Product

In July 2013, soybean (Glycine max) plants at the research field in Daegu, South Korea, showed virus-like symptoms, such as mosaic, mottle, yellowing, and stunting. Overall, there were approximately 1% of soybean plants that showed these symptoms. Sixteen soybean samples were collected based on visual symptoms and subjected to laboratory characterization. Total RNA was extracted from each sample with the Tri Reagent (Molecular Research Center, Cincinnati, OH) and cDNA was synthesized using random N25 primer with RevertAid Reverse Transcriptase (Thermo Scientific, Waltham, MA), according to the manufacturers' instructions. All samples were tested by PCR with Prime Taq Premix (2X) (GeNet Bio, Daejeon, Korea) and primer sets specific to Soybean mosaic virus (SMV; 5′-CATATCAGTTTGTTGGGCA-3′ and 5′-TGCCTATACCCTCAACAT-3′), Peanut stunt virus (PSV; 5′-TGACCGCGTGCCAGTAGGAT-3′ and 5′-AGGTDGCTTTCTWTTGRATTTA-3′), Soybean yellow mottle mosaic virus (SYMMV; 5′-CAACCCTCAGCCACATTCAACTAT-3′ and 5′-TCTAACCACCCCACCCGAAGGATT-3′), and Soybean yellow common mosaic virus (SYCMV; 5′-TTGGCTGAGAGGAGTGGCTT-3′ and 5′-TGCGGTCGTGTAGTCAGTG-3′). Among 16 samples tested, five were positive for SMV and two for SYMMV. Three samples were found infected by both SMV and SYMMV and four by both SMV and PSV. Since two of the symptomatic samples were not infected by viruses described above, a pair of primers specific to Peanut mottle virus (PeMoV; 5′-GCTGTGAATTGTTGTTGAGAA-3′ and 5′-ACAATGATGAAGTTCGTTAC-3′) was tested (1). All 16 samples were subjected to RT-PCR with primers specific to PeMoV. Four were found positive for PeMoV. Two of them were already found infected with SYMMV. In order to identify the complete nucleotide sequences of PeMoV coat protein (CP), another primer set (5′-TGAGCAGGAAAGAATTGTTTC-3′ and 5′-GGAAGCGATATACACACCAAC-3′) was used. RT-PCR product was cloned into RBC TA Cloning Vector (RBC Bioscience, Taipei, Taiwan) and the nucleotide sequence of the insert was determined by Macrogen (Seoul, Korea). CP gene of the PeMoV (GenBank Accession No. KJ664838) showed the highest nucleotide sequence identity with PeMoV isolate Habin (KF977830; 99% identity), and the highest amino acid identity with GenBank Accession No. ABI97347 (100% identity). In order to fulfill Koch's postulates, several G. max cv. Williams 82 were inoculated with the extracts of PeMoV-infected leaf tissue. At 14 days post-inoculation, plants showed systemic mottle symptoms. These symptomatic plants were subjected to RT-PCR, and the nucleotide sequences of the PCR product were found identical to that of the virus in the inoculum. To our knowledge, this is the first report of soybean-infecting PeMoV, a member of the genus Potyvirus in the family Potyviridae, in South Korea. Reference: (1) R. G. Dietzgen et al. Plant Dis. 85:989, 2001.

scholarly journals First report of costus stripe mosaic virus infecting Tradescantia spathacea plants in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Gabriel Madoglio Favara ◽  
Felipe Franco de Oliverira ◽  
Camila Geovana Ferro ◽  
Heron Delgado Kraide ◽  
Eike Yudi Nishimura Carmo ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Protein Gene ◽  
Infected Plant ◽  
Nucleotide Sequences ◽  
Mild Mosaic ◽  
Rt Pcr ◽  
Chenopodium Amaranticolor ◽  
Capsid Protein Gene ◽  
Total Rna ◽  
First Report

Tradescantia spathacea (family Commelinaceae) is cultivated worldwide as an ornamental (Golczyk et al., 2013) and as medicinal plant (Tan et al., 2020). In 2019, 90 of ~180 plants of T. spathacea, grown in two beds of 4 m2 and exhibiting leaf mosaic were found in an experimental area at ESALQ/USP (Piracicaba municipality, São Paulo state, Brazil). Potyvirus-like flexuous filamentous particles were observed by transmission electron microscopy in foliar extracts of two symptomatic plants stained with 1% uranyl acetate. Total RNA was extracted using the Purelink viral RNA/DNA kit (Thermo Fisher Scientific) from leaves of two symptomatic plants and separately subjected to a reverse transcription polymerase chain reaction (RT-PCR). The potyviruses degenerate pairs of primers CIFor/CIRev (Ha et al. 2008), which amplifies a fragment corresponding to part of the cylindrical inclusion protein gene, and WCIEN/PV1 (Maciel et al. 2011), which amplifies a fragment containing part of the capsid protein gene and the 3′ untranslated region, were used. The expected amplicons (~700bp) were obtained from both total RNA extracts. Two amplicons from one sample were purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) and directly sequenced in both directions at Macrogen Inc (Seoul, South Korea). The obtained nucleotide sequences (GenBank MW430005 and MW503934) shared 95.32% and 97.79% nucleotide identity, respectively, with the corresponding sequences of the Brazilian isolate of the potyvirus costus stripe mosaic virus (CoSMV, MK286375) (Alexandre et al. 2020). Extract from an infected plant of T. spathacea was mechanically inoculated in 10 healthy plants of T. spathacea and two plants each of the following species: Capsicum annuum, Chenopodium amaranticolor, Commelina benghalensis, Datura stramonium, Gomphrena globosa, Nicandra physaloides, Nicotiana tabacum cvs. Turkish and Samsun, Solanum lycopersicum, T. palida, and T. zebrina. All T. spathacea plants exhibited mosaic and severe leaf malformation. C. benghalensis plants developed mild mosaic, whereas infected T. zebrina plants were asymptomatic. The plants of other species were not infected. RT-PCR with specific CoSMV primers CoSMVHC-F and CoSMVHC-R (Alexandre et al. 2020) confirmed the infection. Nucleotide sequences of amplicons obtained from experimentally inoculated T. spathacea and T. zebrina (MW430007 and MW430008) shared 94.56% and 94.94% identity with the corresponding sequence of a Brazilian CoSMV isolate (MK286375). None of eight virus-free plants of T. spathacea inoculated with CoSMV using Aphis craccivora exhibited symptoms, nor was CoSMV detected by RT-PCR. Lack of CoSMV transmission by A. solanella, Myzus persicae, and Uroleucon sonchi was previously reported (Alexandre et al. 2020). T. spathacea plants are commonly propagated vegetatively, and by seeds. Virus-free seeds, if available, can provide an efficient and easy way to obtain healthy plants. Only three viruses were reported in plants of the genus Tradescantia: Commelina mosaic virus, tradescantia mild mosaic virus, and a not fully characterized potyvirus (Baker and Zettler, 1988; Ciuffo et al., 2006; Kitajima 2020). CoSMV was recently reported infecting Costus spiralis and C. comosus (Alexandre et al. 2020). As far as we know, this is the first report of CoSMV infecting T. spathacea plants.

scholarly journals First report of groundnut ringspot virus infecting Zinnia sp. in Brazil

Plant Disease ◽  
2021 ◽  
Author(s):  
Felipe Franco de Oliveira ◽  
Gabriel Madoglio Favara ◽  
Camila Geovana Ferro ◽  
Heron Delgado Kraide ◽  
Eike Yudi Nishimura Carmo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Nucleotide Sequences ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Concentric Ring ◽  
Leaf Extracts ◽  
Total Rna ◽  
First Report ◽  
Two Samples

Zinnia sp. is a genus belonging to Asteraceae family, originated in Mexico and adapted to a warm-hot climate (Hemmati and Mehrnoosh, 2017). Several types of zinnias with different flower color and forms are cultivated in Brazil (Min et al., 2020 and Souza Jr. et al., 2020). Characteristic symptoms of infection caused by orthotospovirus, including chlorotic spots and concentric rings on the leaves, were observed in two plants of Zinnia sp. of a florist located in the city of Piracicaba, State of São Paulo, Brazil. Orthotospovirus-like particles were observed by transmission electron microscope in leaf extracts from both plants, stained negatively with 1% uranyl acetate. By analyzing ultrathin sections of infected leaf tissues, particles of 80-100 nm in diameter were found in the lumen of the endoplasmic reticulum and nucleocapsid aggregates in the cytoplasm. Total RNA extracted separately from the leaves of both samples, using the Purelink Viral DNA / RNA kit (Thermo Fisher Scientific), was used to detect the virus by reverse transcription polymerase chain reaction (RT-PCR), using the universal primers for orthotospovirus BR60, complementary to the 3’ end of the non-translated region of the S RNA (position 1 to 15 nt), and BR65, matching the nucleocapsid gene (N) (position 433 to 453 nt), generating and amplicon of 453 nt (Eiras et al., 2001). Amplicons of the expected size were obtained for the two samples. An amplicon was purified with the Wizard SV Gel and PCR Clean-Up System kit (Promega) and sequenced in both directions at Macrogen Inc (South Korea). The nucleotide sequence (GenBank MW629018) showed 99.29-99.76% identity with nucleotide sequences of the orthotospovirus groundnut ringspot virus (GRSV) isolates (GenBank MH686229 and KY400110). Leaf extracts from symptomatic plants were also analyzed by plate-trapped antigen-enzyme-linked immunosorbent assay (PTA-ELISA), using polyclonal antiserum produced against the GRSV nucleocapsid protein (Esquivel et al., 2019). The absorbance values obtained for the extracts of the two symptomatic plants of Zinnia sp. (1.3 and 1.7) were twice as high as the value obtained for the healthy plant extract (0.5). Leaf extract of symptomatic Zinnia sp. was inoculated mechanically onto leaves of healthy plants of Zinnia sp., Capsicum annuum cv. Dara, Cucumis sativus, Cucurbita pepo cv. Caserta, Chenopodium amaranticolor, Datura stramonium, Nicotiana tabacum cv. Turkish and Solanum lycopersicum cv. Compack. At 5 days post inoculation (dpi), inoculated leaves of D. stramonium reacted with local lesions, and at 9 dpi, newly developed leaves of inoculated S. lycopersicum plants showed necrotic spot and concentric ring symptoms, whereas C. annuum exhibited concentric rings at 10 dpi. Inoculated zinnia plants showed systemic chlorotic spot and concentric ring symptoms at 20 dpi, indistinguishable from those observed under natural infection. The other inoculated plant species were not symptomatic, nor the virus was detected. PTA-ELISA and RT-PCR confirmed infection with GRSV in symptomatic plants. The amplicons generated by RT-PCR of total RNA extracted from an experimentally infected plant of C. annuum and D. stramonium, and two plants of Zinnia sp. were sent for nucleotide sequencing. The obtained nucleotide sequences (MW629019, MW629020, MW629021, MW629022) shares 100% identity with the nucleotide sequence corresponding to the original GRSV isolate (MW629018) identified in Zinnia sp. This is the first report of the natural occurrence of GRSV in Zinnia sp. in Brazil. Studies on incidence and damage are needed to recommend alternatives for management.

Per-unit-living tissue normalization of real-time RT-PCR data in ischemic rat hearts

2012 ◽  
Vol 44 (12) ◽  
pp. 651-656 ◽  
Author(s):  
S. Ellefsen ◽  
M. Bliksøen ◽  
A. Rutkovskiy ◽  
I. B. Johansen ◽  
M.-L. Kaljusto ◽  
...  
Keyword(s):  
Infarct Size ◽  
Real Time ◽  
Reference Genes ◽  
Stable Expression ◽  
Unit Weight ◽  
Living Tissue ◽  
Rt Pcr ◽  
Internal Reference ◽  
Total Rna ◽  
Rat Hearts

In studies of gene expression in acute ischemic heart tissue, internal reference genes need to show stable expression per-unit-living tissue to hinder dead cells from biasing real-time RT-PCR data. Until now, this important issue has not been appropriately investigated. We hypothesized that the expression of seven internal reference genes would show stable per-unit-living tissue expression in Langendorff-perfused rat hearts subjected to ischemia-reperfusion. This was found for cyclophilin A, GAPDH, RPL-32, and PolR2A mRNA, with GAPDH showing the highest degree of stability ( R = 0.11), suggesting unchanged rates of mRNA transcription in live cells and complete degradation of mRNA from dead cells. The infarct size-dependent degradation of GAPDH was further supported by a close correlation between changes in GAPDH mRNA and changes in RNA quality measured as RNA integrity number (R = 0.90, P < 0.05). In contrast, β-actin and 18S rRNA showed stable expression per-unit-weight tissue and a positive correlation with infarct size (R = 0.61 and R = 0.77, P < 0.05 for both analyses). The amount of total RNA extracted per-unit-weight tissue did not differ between groups despite wide variation in infarct size (7.1–50.1%). When β-actin expression was assessed using four different normalization strategies, GAPDH and geNorm provided appropriate per-unit-living expression, while 18S and total RNA resulted in marked underestimations. In studies of ischemic tissues, we recommend using geometric averaging of carefully selected reference genes for normalization of real-time RT-PCR data. A marked shift in the mRNA/rRNA ratio renders rRNA as useless for normalization purposes.

Disease-resistant transgenic adzuki bean plants obtained through an efficient transformation system

2012 ◽  
Vol 63 (12) ◽  
pp. 1090 ◽  
Author(s):  
Huatao Chen ◽  
Xin Chen ◽  
Heping Gu ◽  
Xingxing Yuan ◽  
Hongmei Zhang ◽  
...  
Keyword(s):  
Soybean Mosaic Virus ◽  
Shoot Elongation ◽  
Zeatin Riboside ◽  
Medium Composition ◽  
Adventitious Bud ◽  
Adzuki Bean ◽  
Transformation System ◽  
Bean Plants ◽  
Bud Induction

An efficient regeneration and transformation system was established and optimised for adzuki bean (Vigna angularis (Willd.) Ohwi & Ohashi). 6-Benzylaminopurine at 5 mg L–1 was used to increase adventitious bud induction frequency. The highest frequency of shoot elongation was 92.8% when using a medium composition of MS salts combined with 0.1 mg L–1 of IAA, 0.5 mg L–1 of GA3, 1.0 mg L–1 of zeatin-riboside, 50 mg L–1 of aspartic acid, and 50 mg L–1 of glutamic acid. In vitro rooting was 100% when shoots were cultured on the solid MS medium supplemented with 1.0 mg L–1 of NAA. Reproducible transformation of epicotyl explants was developed using the A. tumefaciens EHA105 strain. Using a concentration of 40 mg L–1 of acetosyringone, 20 mm MES, and 5 mg L–1 of 6-benzylaminopurine in the co-cultivation medium, a transformation efficiency of 12.6% was attained. Using this transformation protocol, we obtained transgenic adzuki bean plants resistant to soybean mosaic virus by introducing the V. angularis VaPR3 gene.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

scholarly journals Lamium maculatum is a Natural Host for Cucumber mosaic virus

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 150-150 ◽  
Author(s):  
R. Bešta-Gajević ◽  
A. Jerković-Mujkić ◽  
S. Pilić ◽  
I. Stanković ◽  
A. Vučurović ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Natural Ecosystems ◽  
New Host ◽  
Total Rna ◽  
Negative Controls ◽  
Das Elisa

Lamium maculatum L. (spotted dead-nettle) is a flowering perennial ornamental that is commonly grown as a landscape plant for an effective ground cover. In June 2010, severe mosaic accompanied by reddish brown necrosis and leaf deformation was noticed on 80% of L. maculatum growing in shade under trees and shrubs in Sarajevo (Bosnia and Herzegovina). Leaves from 10 symptomatic L. maculatum plants were sampled and analyzed by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba AG, Reinach, Switzerland) against Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV), the most important viral pathogens of ornamental plants (1,2). Commercial positive and negative controls and extracts from healthy L. maculatum leaves were included in each assay. All samples tested negative for TSWV and INSV and positive for CMV. The virus was mechanically transmitted to test plants and young virus-free plants of L. maculatum using 0.01 M phosphate buffer (pH 7). The virus caused chlorotic local lesions on Chenopodium quinoa, while systemic mosaic was observed on Capsicum annuum ‘Rotund,’ Nicotiana rustica, N. glutinosa, N. tabacum ‘White Burley,’ and Phaseolus vulgaris ‘Top Crop.’ The virus was transmitted mechanically to L. maculatum and induced symptoms resembling those observed on the source plants. Inoculated plants were assayed by DAS-ELISA and all five inoculated plants of each species tested positive for CMV. The presence of CMV in L. maculatum as well as mechanically infected N. glutinosa plants was further confirmed by RT-PCR. Total RNA from symptomatic leaves was isolated using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was performed with the One-Step RT-PCR Kit (Qiagen) following the manufacturer's instructions. The primer pair, CMVAu1u/CMVAu2d, that amplifies the entire coat protein (CP) gene and part of 3′- and 5′-UTRs was used for both amplification and sequencing (4). Total RNA obtained from the Serbian CMV isolate from pumpkin (GenBank Accession No. HM065510) and a healthy L. maculatum plant were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (850 bp). No amplicon was observed in the healthy control. The amplified product derived from isolate 3-Lam was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions and deposited in GenBank (JX436358). Sequence analysis of the CP open reading frame (657 nt), conducted with MEGA5 software, revealed that the isolate 3-Lam showed the highest nucleotide identity of 99.4% (99.1% amino acid identity) with CMV isolates from Serbia, Australia, and the USA (GQ340670, U22821, and U20668, respectively). To our knowledge, this is the first report of the natural occurrence of CMV on L. maculatum worldwide and it adds a new host to over 1,241 species (101 plant families) infected by this virus (3). This is also an important discovery for the ornamental industry since L. maculatum is commonly grown together with other ornamental hosts of CMV in nurseries and the urban environment as well as in natural ecosystems. References: (1) Y. K. Chen et al. Arch. Virol. 146:1631, 2001. (2) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. Jacquemond. Adv. Virus Res. 84:439, 2012. (4) I. Stankovic et al. Acta Virol. 55:337, 2011.

Human endothelial cells produce orosomucoid, an important component of the capillary barrier

1999 ◽  
Vol 276 (2) ◽  
pp. H530-H534 ◽  
Author(s):  
Jenny Sörensson ◽  
Göran L. Matejka ◽  
Maria Ohlson ◽  
Börje Haraldsson
Keyword(s):  
Endothelial Cells ◽  
Primary Cultures ◽  
Rnase Protection Assay ◽  
Cell Types ◽  
Endothelial Glycocalyx ◽  
Rt Pcr ◽  
Rnase Protection ◽  
Total Rna ◽  
Main Site ◽  
Charge Selectivity

The serum protein orosomucoid (α1-acid glycoprotein) is needed to maintain the high capillary permselectivity required for normal homeostasis. It is not known how the protein executes its action, but it seems to contribute to the charge barrier. Moreover, recent studies suggest that the endothelial glycocalyx is essential for the charge barrier. The main site of orosomucoid synthesis is the liver, but we wanted to explore the possibility that orosomucoid was synthesized in endothelial cells. Primary cultures of human microvascular endothelial cells (HMVEC) from dermal tissue were established. Human liver cells were used as positive controls, and total RNA was prepared from both cell types. Reverse transcription-polymerase chain reaction (RT-PCR) was performed and demonstrated orosomucoid expression. After RT-PCR, the identities of the PCR products were confirmed by sequencing. RNase protection assay performed on total RNA from the HMVEC confirmed the results from the RT-PCR, i.e., orosomucoid mRNA is expressed by endothelial cells. Synthesis of orosomucoid in both liver and endothelial cells was demonstrated by immunoprecipitation. In conclusion, endothelial cells normally produce orosomucoid, which is essential for capillary charge selectivity. We suggest that orosomucoid exerts its effect by interacting with other components of the endothelial glycocalyx.

scholarly journals First Genome Sequence of Newcastle Disease Virus of Genotype VIIi from Jordan

2018 ◽  
Vol 7 (23) ◽  
Author(s):  
Mustafa Ababneh ◽  
Helena L. Ferreira ◽  
Mohammad Khalifeh ◽  
David L. Suarez ◽  
Claudio L. Afonso
Keyword(s):  
Reverse Transcriptase ◽  
Newcastle Disease Virus ◽  
Disease Virus ◽  
Genome Sequence ◽  
Illumina Sequencing ◽  
Newcastle Disease ◽  
Rt Pcr ◽  
Total Rna ◽  
Reverse Transcriptase Pcr ◽  
Chicken Spleen

Newcastle disease virus (NDV) was detected by reverse transcriptase PCR (RT-PCR) from total RNA isolated from a chicken spleen of a backyard flock in Jordan. The complete coding genome sequence of NDV/chicken/Jordan/J11-spleen/2018 was obtained with MiSeq (Illumina) sequencing.

Regional variation in myosin isoforms and phosphorylation at the resting tone in urinary bladder smooth muscle

2001 ◽  
Vol 280 (2) ◽  
pp. C254-C264 ◽  
Author(s):  
Joseph A. Hypolite ◽  
Michael E. DiSanto ◽  
Yongmu Zheng ◽  
Shaohua Chang ◽  
Alan J. Wein ◽  
...  
Keyword(s):  
Smooth Muscle ◽  
Urinary Bladder ◽  
Smooth Muscles ◽  
Urinary Continence ◽  
Myosin Isoforms ◽  
Bladder Smooth Muscle ◽  
Rt Pcr ◽  
Total Rna ◽  
Bladder Dome ◽  
Significant Difference

Urinary bladder filling and emptying requires coordinated control of bladder body and urethral smooth muscles. Bladder dome, midbladder, base, and urethra showed significant differences in the percentage of 20-kDa myosin light chain (LC20) phosphorylation (35.45 ± 4.6, 24.7 ± 2.2, 13.6± 2.1, and 12.8 ± 2.7%, respectively) in resting muscle. Agonist-mediated force was associated with a rise in LC20 phosphorylation, but the extent of phosphorylation at all levels of force was less for urethral than for bladder body smooth muscle. RT-PCR and quantitative competitive RT-PCR analyses of total RNA from bladder body and urethral smooth muscles revealed only a slight difference in myosin heavy chain mRNA copy number per total RNA, whereas mRNA copy numbers for NH2-terminal isoforms SM-B (inserted) and SM-A (noninserted) in these muscles showed a significant difference (2.28 × 108 vs. 1.68 × 108 for SM-B and 0.12 × 108 vs. 0.42 × 108 for SM-A, respectively), which was also evident at the protein level. The ratio of COOH-terminal isoforms SM2:SM1 in the urethra was moderately but significantly lower than that in other regions of the bladder body. A high degree of LC20phosphorylation and SM-B in the bladder body may help to facilitate fast cross-bridge cycling and force generation required for rapid emptying, whereas a lower level of LC20 phosphorylation and the presence of a higher amount of SM-A in urethral smooth muscle may help to maintain the high basal tone of urethra, required for urinary continence.

Sign in / Sign up

Export Citation Format

Share Document