scholarly journals First Report of Multiple Species of the Botryosphaeriaceae Causing Bot Canker Disease of Indian Laurel-Leaf Fig in California

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 459-459 ◽  
Author(s):  
J. S. Mayorquin ◽  
A. Eskalen ◽  
A. J. Downer ◽  
D. R. Hodel ◽  
A. Liu
Keyword(s):  
Los Angeles ◽  
Fungal Pathogens ◽  
Southern California ◽  
Morphological Characteristics ◽  
Vascular Lesion ◽  
Site Location ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Nattrassia Mangiferae ◽  
Β Tubulin

Indian laurel-leaf fig (Ficus microcarpa L.) is a commonly used indoor and outdoor ornamental tree. F. microcarpa is most frequently encountered as lining city streets, especially in warmer southern California climates. A disease known as ‘Sooty Canker,' caused by the fungus Nattrassia mangiferae (Syd. & P. Syd) B. Sutton & Dyko, is particularly devastating on F. microcarpa. Disease symptoms are characterized by branch dieback, crown thinning, and if the disease progresses to the trunk, eventual tree death (2). Recent taxonomic revisions have renamed Nattrassia mangiferae as Neofusicoccum mangiferae (Syd. & P. Syd.) Crous, Slippers & A. J. L. Phillips (1). An initial survey conducted during the spring of 2011 across four cities in Los Angeles County included, Culver City, Lakewood, Santa Monica, and Whittier. Five symptomatic branches per city were collected from trees showing branch cankers and dieback. Pieces of symptomatic tissue (2 mm2) were plated onto one-half-strength potato dextrose agar. Most isolates initially identified by morphological characteristics, such as growth pattern, speed of growth, and colony color, resembled those in the Botryosphaeriaceae (4). Two representative isolates from each site location were sequenced. Sequences obtained from amplification of the internal transcribed spacer region (ITS1-5.8rDNA-ITS2) and the β-tubulin gene were compared in a BLAST search in GenBank. Results identified isolates as Botryosphaeria dothidea (identity of 99% to EF638767 and 100% to JN183856.1 for ITS and β-tubulin, respectively); Neofusicoccum luteum (100% to EU650669 and 100% to HQ392752); N. mediterraneum (100% to HM443605 and 99% to GU251836); and N. parvum (100% to GU188010 and 100% to HQ392766) and have been deposited in GenBank with the following accession numbers: JN543668 to JN543671 (ITS) and JQ080549 to JQ080552 (β-tubulin). Pathogenicity tests were conducted in the greenhouse on 6-month-old F. microcarpa with one isolate from each previously listed fungal species. Five plants per isolate were stem-wound inoculated with mycelial plugs and wrapped with Parafilm. Uncolonized agar plugs were used as a control. Inoculations were later repeated a second time in the same manner for a total of 10 plants per isolate. Plants were observed for 6 weeks and destructively sampled to measure vascular lesion lengths. Mean vascular lesion lengths were 26, 22, 54, and 46 mm for B. dothidea, N. luteum, N. mediterraneum, and N. parvum, respectively. The mean lesion lengths for all isolates were significantly different (P = 0.05) from the control. Each species was consistently recovered from inoculated plants, except the control, thus fulfilling Koch's postulates. To our knowledge, this is the first report on the pathogenicity of multiple Botryosphaeriaceae species causing branch canker and dieback on F. microcarpa in California. These results are significant since trees along sidewalks in southern California are often crowded and undergo extensive root and branch pruning and some Botryosphaeriaceae spp. are known to enter its host through wounds caused by pruning or mechanical injury (2,3). Further sampling is imperative to better assess the distribution of these canker-causing fungal pathogens on F. microcarpa. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) D. R. Hodel et al. West. Arborist 35:28, 2009. (3) V. McDonald et al. Plant Dis. 93:967, 2009. (4) B. Slippers et al. Fungal Biol. Rev. 21:90, 2007.

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 843-843 ◽  
Author(s):  
N.-H. Lu ◽  
Q.-Z. Huang ◽  
H. He ◽  
K.-W. Li ◽  
Y.-B. Zhang
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Avicennia Marina ◽  
Optical Microscope ◽  
Ethanol Solution ◽  
Morphological Observation ◽  
Fusarium Equiseti ◽  
First Report ◽  
Initial Symptoms ◽  
Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

scholarly journals First report of Diaporthe ueckerae causing stem canker on soybean (Glycine max L.) in Colombia

Plant Disease ◽  
2021 ◽  
Author(s):  
Nathali López-Cardona ◽  
YUDY ALEJANDRA GUEVARA ◽  
Lederson Gañán-Betancur ◽  
Carol Viviana Amaya Gomez
Keyword(s):  
Management Strategies ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Stem Canker ◽  
Growth Stages ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Glycine Max L ◽  
Soybean Plants

In October 2018, soybean plants displaying elongated black to reddish-brown lesions on stems were observed in a field planted to the cv. BRS Serena in the locality of Puerto López (Meta, Colombia), with 20% incidence of diseased plants. Symptomatic stems were collected from five plants, and small pieces (∼5 mm2) were surface sterilized, plated on potato dextrose agar (PDA) and incubated for 2 weeks at 25°C in darkness. Three fungal isolates with similar morphology were obtained, i.e., by subculturing single hyphal tips, and their colonies on PDA were grayish-white, fluffy, with aerial mycelium, dark colored substrate mycelium, and produced circular black stroma. Pycnidia were globose, black, occurred as clusters, embedded in tissue, erumpent at maturity, with an elongated neck, and often had yellowish conidial cirrus extruding from the ostiole. Alpha conidia were observed for all isolates after 30 days growth on sterile soybean stem pieces (5 cm) on water agar, under 25ºC and 12 h light/12h darkness photoperiod. Alpha conidia (n = 50) measured 6.0 – 7.0 µm (6.4 ± 0.4 µm) × 2.0 – 3.0 µm (2.5± 0.4 µm), were aseptate, hyaline, smooth, ellipsoidal, often biguttulate, with subtruncate base. Beta conidia were not observed. Observed morphological characteristics of these isolates were similar to those reported in Diaporthe spp. by Udayanga et al. (2015). DNA from each fungal isolate was used to sequence the internal transcribed spacer region (ITS), and the translation elongation factor 1-α (TEF1) gene, using the primer pairs ITS5/ITS4 (White et al. 1990) and EF1-728F/EF1- 986R (Carbone & Kohn, 1999), respectively. Results from an NCBI-BLASTn, revealed that the ITS sequences of the three isolates (GenBank accessions MW566593 to MW566595) had 98% (581/584 bp) identity with D. miriciae strain BRIP 54736j (NR_147535.1), whereas the TEF1 sequences (GenBank accessions MW597410 to MW597412) had 97 to 100% (330-339/339 bp) identity with D. ueckerae strain FAU656 (KJ590747). The species Diaporthe miriciae R.G. Shivas, S.M. Thomps. & Y.P. Tan, and Diaporthe ueckerae Udayanga & Castl. are synonymous, with the latter taking the nomenclature priority (Gao et al. 2016). According to a multilocus phylogenetic analysis, by maximum likelihood, the three isolates clustered together in a clade with reference type strains of D. ueckerae (Udayanga et al. 2015). Soybean plants cv. BRS Serena (growth stages V3 to V4) were used to verify the pathogenicity of each isolate using a toothpick inoculation method (Mena et al. 2020). A single toothpick colonized by D. ueckerae was inserted directly into the stem of each plant (10 plants per isolate) approximately 1 cm below the first trifoliate node. Noncolonized sterile toothpicks, inserted in 10 soybean plants served as the non-inoculated control. Plants were arbitrarily distributed inside a glasshouse, and incubated at high relative humidity (>90% HR). After 15 days, inoculated plants showed elongated reddish-brown necrosis at the inoculated sites, that were similar to symptoms observed in the field. Non-inoculated control plants were asymptomatic. Fungal cultures recovered from symptomatic stems were morphologically identical to the original isolates. This is the first report of soybean stem canker caused by D. ueckerae in Colombia. Due to the economic importance of this disease elsewhere (Backman et al. 1985; Mena et al. 2020), further research on disease management strategies to mitigate potential crop losses is warranted.

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

scholarly journals First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 279-279 ◽  
Author(s):  
J.-H. Wang ◽  
H.-P. Li ◽  
J.-B. Zhang ◽  
B.-T. Wang ◽  
Y.-C. Liao
Keyword(s):  
Fusarium Species ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Ear Rot ◽  
Tubulin Gene ◽  
Average Growth ◽  
First Report ◽  
Maize Ear Rot ◽  
Maize Ear ◽  
Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

scholarly journals First Report of Sea buckthorn Stem Wilt Caused by Fusarium sporotrichioides in Gansu, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Bo Xia ◽  
Yue Liang ◽  
Jianzhong Hu ◽  
Xiaoling Yan ◽  
Liqiang Yin ◽  
...  
Keyword(s):  
Elongation Factor ◽  
Morphological Characteristics ◽  
Gansu Province ◽  
Sea Buckthorn ◽  
Molecular Characteristics ◽  
Ear Rot ◽  
Fusarium Sporotrichioides ◽  
Tree Roots ◽  
Internal Transcribed Spacer Region ◽  
First Report

Sea buckthorn (Hippophae rhamnoides) is an important deciduous shrub for fruit and ecological restoration in arid and semi-arid regions of China. Twelve Chinese and Russian cultivars (cv. Shenqiuhong, eshi01, ... eshi11) were planted about 1.6 acre area in a seedling nursery, located in Qingyang City of Gansu province in northwest China, where high mortality (more than 70%) of sea buckthorn was observed in late July 2019. Symptoms consisted of massive chlorosis, drooping leaves and dried-up stems on 5-year-old trees. Pieces of tree roots and stems with irregular light-brown discoloration in the xylem vessels were selected. Small pieces of discolored tissue were surface disinfested (1 min in 1% sodium hypochlorite, followed by three rinses with sterile distilled water), air-dried, and placed on potato dextrose agar (PDA) medium for 5 days at 25°C in the dark. A fungus was consistently isolated from both diseased roots and stems tissues. Colonies on PDA grew rapidly. Dense mycelia were pinky-white initially, and became carmine red color with age on the undersurface of the plate. Macroconidia were moderately curved, 3 to 5 marked septa, hyaline, thick walled, and measuring 27.8± 3.6 µm × 4.8 ± 0.5 µm (n = 30). Microconidia were abundant, pear-shaped, ellipsoid to fusoid, often with a papilla at the base, and 8.4 ± 2.2 µm ×3.1 ± 0.3 µm (n = 30). Genomic DNA was extracted for amplification and sequencing of the internal transcribed spacer region (ITS1 and ITS4 primers) (White et al. 1990) of the ribosomal DNA (Accession Nos. MN160235 to MN160238) and translation elongation factor-1 alpha (EF1 and EF2 primers, accession Nos. MN429075 to MN429078) (O’Donnell et al. 1998). The sequences revealed 99% similarity to the sequences of the ITS (AY188917), and 100% identity with EF1-α (JF740808) regions of Fusarium sporotrichioides. Based on morphological and molecular characteristics, the fungus was identified as F. sporotrichioides (Leslie and Summerell 2006). Koch’s postulates were fulfilled on healthy, potted 1-year-old sea buckthorn seedings using two isolates in a greenhouse at 25 °C, 90% relative humidity, and 12-hour light/dark photoperiod. Ten potted seedings were inoculated on the stems by placing a 5-mm-diameter mycelial plug (5-day-old PDA cultures for each isolate) into the surface of a wound created with a needle, and the inoculation sites were covered with Parafilm to maintain moisture. Ten seedings were inoculated with PDA plugs as controls. Seven to ten days after inoculation, typical symptoms of dark-brown necrotic lesions on chlorotic leaf margins were observed. About 2 weeks after inoculation, the inoculated stems were gradually dry up, accompanied by withering and fallen leaves. Control plants remained asymptomatic. Pathogens were successfully isolated from the inoculated stems again, exhibiting morphological characteristics identical to those of F. sporotrichioides. Previous papers reported F. sporotrichioides as a common pathogen caused lavender wilt (Cosic et al. 2012), foliar spots on forage corn (Moya-Elizondo et al. 2013) and maize ear rot (Wang et al. 2019). To our knowledge, this is the first report of sea buckthorn stem wilt caused by F. sporotrichioides on several Chinese and Russian cultivars in Gansu province of China. In Heilongjiang province, the same disease was reported in 2010 (Song et al. 2010), nearly 30 longitudes away from Gansu province. Therefore, this disease appears to be a serious risk for future sea buckthorn production.

scholarly journals First report of Eutypa lata causing cankers and dieback in sweet cherry in Chile

Plant Disease ◽  
2021 ◽  
Author(s):  
Daina Grinbergs ◽  
Javier Chilian ◽  
Andrés France
Keyword(s):  
Fungal Pathogens ◽  
Sweet Cherry ◽  
Prunus Avium ◽  
Tap Water ◽  
Central Area ◽  
Wood Decay ◽  
Internal Transcribed Spacer Region ◽  
Indole Butyric Acid ◽  
First Report ◽  
Eutypa Lata

Sweet cherry (Prunus avium) is one the most important fruit crops in Chile. Its production has significantly grown in recent years, reaching 228,448 tons exported in 2019/2020, to 47 countries. One of the main threats for this expanding crop are fungal pathogens, especially those that cause wood diseases. Cherry orchards (n=35) located in the central area of Chile, from Curicó (34°58'58''S 71°14.366'W) to Angol (37°47'42.7''S 72°42.982'W), were surveyed during 2020. Wood samples were collected (n= 72) from living branches and trunks showing dieback, cankers and dark necrosis, mostly wedge shaped. Small wood sections (0.5-cm) were cut off from the margin of the necrosis and surface disinfected using 0.5% v/v sodium hypochlorite. Sections were plated on a quarter-strength potato dextrose agar amended with 1mg/L tetracycline (PDA-tet). Plates were incubated at 25°C until mycelial development and subsequently the isolates were purified transferring excised fungal tips to PDA. Colonies (n=21) developed white cottony mycelia, which turned slightly greyish and flatter after 10-days at 25°C. Isolates developed black pycnidia which released beige conidial matrixes after subsequent 15-days at 25 +/-2°C and 12-h photoperiod. Conidia were hyaline, curved and filiform, measuring 19.8-(27.9)-36.7 μm length (lineal) x 1.2-(1.7)-1.9 μm width (n=70), according to Eutypa lata (Rappaz, 1984). DNA was extracted from mycelia of the representative isolates HMCe30a, HMCe41a, HMCe109c and HMCe110a. The partial β-tubulin gene was amplified using bt2A/bt2B primers (Glass & Donaldson 1995) and the internal transcribed spacer region was amplified using ITS1/ITS4 primers (White et al. 1990). Sequences were BLAST analyzed, finding that ITS shared 99% and βTUB 100% identity with E. lata strain CBS 208.87 (Rolshausen et al. 2006). Sequences were accessioned to GenBank (MW363035, MW363034, MW363033 and MW363032 [ITS], and MW366820, MW366819, MW366818and MW366817 [βTUB]). The isolates were inoculated on sweet cherry healthy plants cv. Kordia, produced by rooting scions in tap water amended with 500 ppm of indole-butyric acid, for 30 days. An injury was made in the upper third of the shoot using a sterile 0.5-cm diameter corkborer. Mycelial plugs were placed on the injuries and covered with plastic film, using sterile agar for controls (n=25). Plants were incubated in aerated tap water for 60 days at 23 +/-3 °C. After incubation, plants were cut exposing dark-brown necrotic lesions, while control plants remained asymptomatic. Moreover, 2-year old potted plants cv. Lapins were inoculated (n=3 per isolate) with mycelial plugs, on fresh cuts of their main lateral branches, in January 20th, and remained under partial shade for 72-days. After incubation, bark was removed from inoculated branches and the necrotic lesions length was measured. HMCe109c was the most virulent isolate (3.6 cm), followed by HMCe30a (2.1 cm), HMCe41a (1.9 cm) and HMCe110a (1.1 cm), while symptoms were not reproduced in controls. Fulfilling Koch’s postulates, fungi were reisolated from all inoculated plants in both pathogenicity tests and no fungus was recovered from controls. To our knowledge this is the first report of Eutypa lata causing wood decay in sweet cherry in Chile. The pathogen was recently reported causing dieback of grapevines in Chile (Lolas et al. 2020). These are significant findings due to the frequent proximity of sweet cherry orchards and vineyards, which facilitates cross infections.

scholarly journals First Report of Fusarium ipomoeae Causing Peanut leaf Spot in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Manlin Xu ◽  
Xia Zhang ◽  
Jing Yu ◽  
zhiqing Guo ◽  
Ying Li ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Genomic Dna ◽  
Block Design ◽  
Management Strategies ◽  
Morphological Characteristics ◽  
Ethanol Solution ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
First Report

Peanut (Arachis hypogaea L.) is one of the most economically important crops as an important source of edible oil and protein. In August 2020, circular to oval-shaped brown leaf spots (2-6 mm in diameter) with well-defined borders surrounded by a yellow margin were observed on peanut plant leaves in Laixi City, Shandong Province, China. Symptomatic plants randomly distributed in the field, the incidence was approximately 5%. Leave samples were collected consisted of diseased tissue and the adjacent healthy tissue. The samples were dipped in a 70% (v/v) ethanol solution for 30 s and then soaked in a 0.1% (w/v) mercuric chloride solution for 60 s. The surface-sterilized tissues were then rinsed three times with sterile distilled water, dried and placed on Czapek Dox agar supplemented with 100 μg/ml of chloramphenicol. The cultures were incubated in darkness at 25 °C for 3–5 days. Fungal colonies were initially white and radial, turning to orange-brown in color, with abundant aerial mycelia. Macroconidia were abundant, 4 to 7 septate, with a dorsiventral curvature, and were 3.3–4.5 × 18.5–38.1 μm (n=100) in size; microconidia were absent; chlamydospores were produced in chains or clumps, ellipsoidal to subglobose, and thick walled. The morphological characteristics of the conidia were consistent with those of Fusarium spp. To identify the fungus, an EasyPure Genomic DNA Kit (TransGEN, Beijing, China) was used to extract the total genomic DNA from mycelia. The internal transcribed spacer region (ITS rDNA) and the translation elongation factor 1-α gene (TEF1) were amplified with primers ITS1/ITS4 (White et al. 1990) and EF1/EF2 (O’Donnell et al. 1998), respectively. Based on BLAST analysis, sequences of ITS (MT928727) and TEF1 (MT952337) showed 99.64% and 100% similarity to the ITS (MT939248.1), TEF1 (GQ505636.1) of F. ipomoeae isolates. Sequence analysis confirmed that the fungus isolated from the infected peanut was F. ipomoeae (Xia et al. 2019). The pathogenicity of the fungus was tested in the greenhouse. Twenty two-week-old peanut seedlings (cv. Huayu20) grown in 20-cm pots (containing autoclaved soil) were sprayed with a conidial suspension (105 ml−1) from a 15-day-old culture. Control plants were sprayed with distilled water. The experiment was conducted as a randomized complete block design, and placed at 25 °C under a 12-h photoperiod with 90% humidity. Symptoms similar to those in the field were observed on leaves treated with the conidial suspension ten days after inoculation, but not on control plants. F. ipomoeae was re-isolated from symptomatic leaves but not from the control plants. Reisolation of F. ipomoeae from inoculated plants fulfilled Koch's postulates. To our knowledge, this is the first report of F. ipomoeae causing peanut leaf spot in China. Our report indicates the potential spread of this pathogen in China and a systematic survey is required to develop effective disease management strategies.

scholarly journals First report of Fusarium incarnatum causing fruit rot of litchi in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Zhaoyin Gao ◽  
Jiaobao Wang ◽  
Zhengke Zhang ◽  
Min Li ◽  
Deqiang Gong ◽  
...  
Keyword(s):  
Southern China ◽  
Fusarium Species ◽  
Morphological Characteristics ◽  
Fruit Rot ◽  
Conidial Suspension ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Litchi Fruit ◽  
His3 Gene

Litchi (Litchi chinensis Sonn.) is an indigenous tropical and subtropical fruit in Southern China with an attractive appearance, delicious taste, and good nutritional value (Jiang et al. 2003). In March 2020, brown rots were observed on nearly ripe litchi fruits (cv. Guihuaxiang) in an orchard of Lingshui county, Hainan province of China (18.615877° N, 109.948871° E). About 5% fruits were symptomatic in the field, and the disease caused postharvest losses during storage. The initial infected fruits had no obvious symptoms on the outer pericarp surfaces, but appeared irregular, brown to black-brown lesions in the inner pericarps around the pedicels. Then lesions expanded and became brown rots. Small tissues (4 mm × 4 mm) of fruit pericarps were cut from symptomatic fruits, surface-sterilized in 1% sodium hypochlorite for 3 min, rinsed in sterilized water three times, plated on potato dextrose agar (PDA) and incubated at 28℃ in the darkness. Morphologically similar colonies were isolated from 85% of 20 samples after 4 days of incubation. Ten isolates were purified using a single-spore isolation method. The isolates grown on PDA had abundant, fluffy, whitish to yellowish aerial mycelia, and the reverse side of the Petri dish was pale brown. Morphological characteristics of conidia were further determined on carnation leaf-piece agar (CLA) (Leslie et al. 2006). Macroconidia were straight to slightly curved, 3- to 5-septates with a foot-shaped basal cell, tapered at the apex, 2.70 to 4.43 µm × 18.63 to 37.58 µm (3.56 ± 0.36 × 28.68 ± 4.34 µm) (n = 100). Microconidia were fusoid to ovoid, 0- to 1-septate, 2.10 to 3.57 µm × 8.18 to 18.20 µm (2.88 ± 0.34 × 11.71 ± 1.97 µm) (n = 100). Chlamydospores on hyphae singly or in chains were globose, subglobose, or ellipsoidal. Based on cultural features and morphological characteristics, the fungus was identified as a Fusarium species (Leslie et al. 2006). To further confirm the pathogen, DNA was extracted from the 7-day-old aerial mycelia of three isolates (LZ-1, LZ-3, and LZ-5) following Chohan et al. (2019). The sequences of the internal transcribed spacer region of rDNA (ITS), translation elongation factor-1 alpha (tef1) gene, and histone H3 (his3) gene were partially amplified using primers ITS1/ITS4, EF1-728F/EF1-986R, and CYLH3F/CYLH3R, respectively (Funnell-Harris et al. 2017). The nucleotide sequences were deposited in GenBank (ITS: 515 bp, MW029882, 533 bp, MW092186, and 465 bp, MW092187; tef1: 292 bp, MW034437, 262 bp, MW159143, and 292 bp, MW159141; his3: 489 bp, MW034438, 477 bp, MW159142, and 474 bp, MW159140). The ITS, tef1, and his3 genes showed 99-100% similarity with the ITS (MH979697), tef1 (MH979698), and his3 (MH979696) genes, respectively of Fusarium incarnatum (TG0520) from muskmelon fruit. The phylogenetic analysis of the tef1 and his3 gene sequences showed that the three isolates clustered with F. incarnatum. Pathogenicity tests were conducted by spraying conidial suspension (1×106 conidia/ml) on wounded young fruits in the orchid. Negative controls were sprayed with sterilized water. Fruits were bagged with polythene bags for 24 hours and then unbagged for 10 days. Each treatment had 30 fruits. The inoculated fruits developed symptoms similar to those observed in the orchard and showed light brown lesions on the outer pericarp surfaces and irregular, brown to black-brown lesions in the inner pericarps, while the fruits of negative control remained symptomless. The same fungus was successfully recovered from symptomatic fruits, and thus, the test for the Koch’s postulates was completed. F. semitectum (synonym: F. incarnatum) (Saha et al. 2005), F. oxysporum (Bashar et al. 2012), and F. moniliforme (Rashid et al. 2015) have been previously reported as pathogens causing litchi fruit rots in India and Bangladesh. To our knowledge, this is the first report of Fusarium incarnatum causing litchi fruit rot in China.

scholarly journals First Report of Phytophthora syringae on Cedrus libani in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 846-846 ◽  
Author(s):  
T. Doğmuş-Lehtijärvi ◽  
A. G. Aday Kaya ◽  
A. Lehtijärvi ◽  
T. Jung
Keyword(s):  
Average Length ◽  
Morphological Characteristics ◽  
Soil Samples ◽  
Morphological Identification ◽  
First Report ◽  
Cedrus Libani ◽  
Initial Symptoms ◽  
Lebanon Cedar ◽  
Forest Nurseries ◽  
Β Tubulin

Cedrus libani, commonly known as Lebanon cedar, is one of the most important coniferous tree species in Turkey. Its main distribution is in the Taurus Mountains in the Mediterranean Region. The total area of pure Taurus cedar forest covers 109,440 ha in Turkey, all located in the southwestern regions of the country. Due to its drought resistance, Taurus cedar has been commonly used for afforestations in these semi-arid areas (1). In September 2011, during surveys for Phytophthora spp. in forest nurseries in Adapazari and İzmir in eastern Turkey, initial symptoms such as death of fine roots, yellowing, and wilting of Taurus cedar seedlings were observed. Soil samples were collected from 10 symptomatic C. libani seedlings and isolation tests for Phytophthora species were carried out using leaflets from young Quercus suber, Azalea sp., and Rhodendron sp. saplings as baits floated over flooded soil. Necrotic baits were blotted dry, cut into small pieces, and placed on selective PARPNH carrot agar. Out growing colonies were subcultured on carrot agar and kept at 12°C for morphological and molecular identifications (2). In total, six Pythiaceous isolates were obtained from the C. libani soil samples. The isolates were investigated using a light microscope and grouped according to their morphological characteristics (3). DNA was extracted from two representative isolates using Qiagen DNeasy Plant Mini Kit following the manufacturer's instructions. PCR amplifications and sequencing of the internal transcribed spacer (ITS) region of rDNA and the β-tubulin gene were performed using ITS1 and ITS4 and Tub1 and Tub2 primer sets (4). Sequencing of the PCR products in both directions was conducted by IonTek Inc. (Istanbul, Turkey) in an ABI PRISM automated sequencer. The obtained sequences were compared with those in the GenBank and Phytophthora database using BLAST search. On the basis of morphological features and molecular analyses, the two isolates were identified as Phytophthora syringae. Morphological characteristics on carrot agar were identical with the description of P. syringae (2). At 20°C, colonies reached 7 cm in diameter after 1 week. Sporangia were semipapillate to non-papillate, ovoid, with average length of 59 μm (SD ± 2.8) (range 58 to 70 μm). Oogonia were 38 μm (SD ± 5.4) in diameter (range 30 to 47 μm) with paragynous antheridia. The morphological identification was confirmed by sequence comparison at GenBank with 99% homology for both ITS and β-tubulin. The ITS sequences of the two isolates were deposited in GenBank with the accession nos. KF430614 and KF944377. Under-bark inoculation tests with mycelia plugs were conducted with both isolates of P. syringae at 18°C in a growth chamber on a total of six 1-year-old shoots cut from two C. libani trees. Lesions with an average length of 19 mm (SD ± 6) developed after 10 days. P. syringae was consistently re-isolated from the margins of necrotic tissues. Control shoots remained symptomless. To our knowledge, this is the first report of damage caused by P. syringae on C. libani seedlings in forest nursery in Turkey. References: (1) T. Çalışkan. Pages 109-130 in: Proceedings of Workshop “Hızlı gelişen türlerle ilgili rapor,” Ankara, Turkey, 1998. (2) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (3) T. Jung et al. Mycol. Res. 107:772, 2003. (4) L. P. N. M. Kroon et al. Fung. Genet. Biol. 41:766, 2004.

Sign in / Sign up

Export Citation Format

Share Document