First Report of Blossom Blight Caused by Sclerotinia sclerotiorum on Japanese Plum, Nectarine, and Sweet Cherry Orchards in Chile

Blossom blight of Japanese plum (Prunus salicina), nectarine (P. persica var. nectarina), and sweet cherry (P. avium) was observed in commercial orchards in central Chile in 2012. Disease prevalence of 8% and 1% were estimated in 2012 and 2013, respectively. Early symptoms appeared as small pale-brown necrotic lesions on the petals that eventually affected the entire flowers. White and cottony fungal colonies were consistently isolated on potato dextrose agar acidified with 0.5 ml/liter of 92% lactic acid (APDA), incubated for 5 days at 20°C. Black spherical to elongated sclerotia of 2.5 to 4.2 × 2.8 to 5.3 mm (n = 60) were formed on APDA. This fungus was tentatively identified as Sclerotinia sclerotiorum (Lib.) de Bary. The identity of the fungus was confirmed by BLAST analysis of the internal transcribed spacer (ITS) region (GenBank Accession Nos. KF148604 to KF148609) of rDNA, amplified with PCR primers ITS1/ITS4 (3), demonstrating a 99 to 100% similarity with the reference S. sclerotiorum strains (EU082466 and JX307092). The pathogenicity was studied in detached flowers of ‘Larry Ann’ Japanese plum, ‘Summer Bright’ nectarine, and ‘Bing’ sweet cherry that were inoculated with a mycelial suspension (106 fragments/ml) of six isolates of S. sclerotiorum and incubated for 5 days at 20°C in humid chambers (>80% relative humidity). Inoculated flowers developed a light brown petal necrosis that eventually comprised the entire flower. The same S. sclerotiorum isolates were inoculated in mature fruits of ‘Larry Ann’ Japanese plum, ‘Summer Bright’ nectarine, and ‘Staccato’ sweet cherry. Surface disinfected (1% NaOCl for 1 min) fruits were inoculated by placing a mycelium plug (4 mm in diameter) into a wound made with a sterile scalpel and incubated for 3 days at 20°C in humid chambers. Symptoms consisted on light brown soft lesions that varied from 8.7 to 46.5 mm in diameter. A superficial white and cottony septated mycelium was also obtained. An equal number of non-inoculated flowers and wounded but non-inoculated fruits remained healthy. S. sclerotiorum was re-isolated from 100% of the artificially inoculated flowers and fruits, completing Koch's postulates. S. sclerotiorum was reported causing shoot blight on apricot (P. armeniaca), lemon tree (Citrus limon), and table grapes (Vitis vinifera) in Chile (1,2), and to our knowledge, this is the first report of S. sclerotiorum associated with blossom blight in Japanese plum, nectarine, and sweet cherry in Chile. References: (1) R. Acuña. Compendio de Bacterias y Hongos de Frutales y Vides en Chile. Servicio Agrícola y Ganadero, Santiago, Chile, 2010. (2) B. A. Latorre and M. J. Guerrero. Plant Dis. 85:1122, 2001. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Dollar Spot of Sandbur Caused by Sclerotinia homoeocarpa in Oklahoma

Plant Disease ◽

10.1094/pdis-03-14-0244-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1160-1160

Author(s):

F. Flores ◽

N. R. Walker

Keyword(s):

Warm Season ◽

Its Region ◽

Small Subunit ◽

Type I ◽

Academic Press ◽

Sclerotinia Homoeocarpa ◽

Dollar Spot ◽

First Report ◽

Small Subunit Rdna ◽

Disturbed Soils

Sandbur (Cenchrus incertus Curtis) is a warm-season, annual, noxious, grassy weed native to southern North America. It is common in sandy, disturbed soils and can also be found in home lawns and sport fields where low turf density facilitates its establishment. In July 2013, after a period of frequent rainfall and heavy dew, symptoms of dollar spot-like lesions (1) were observed on sandbur plants growing in a mixed stand of turf-type and native warm-season grasses in Logan County, Oklahoma. Lesions, frequently associated with leaf sheaths, were tan and surrounded by a dark margin. Symptomatic leaves were surface sterilized and plated on potato dextrose agar amended with 10 ppm rifampicin, 250 ppm ampicillin, and 5 ppm fenpropathrin. After incubation, a fungus morphologically identical to Sclerotinia homoeocarpa Bennett was consistently isolated. The nuclear ribosomal internal transcribed spacer (ITS) region of two different isolates, SCL2 and SCL3, were amplified using primers ITS4 and ITS5 (2). The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. The sequence for isolate SLC2 was 869 bp, contained a type I intron in the 18S small subunit rDNA, and was identical to accession EU123803. The ITS sequence for isolate SLC3 was 535 bp and identical to accession EU123802. Twenty-five-day-old seedlings of C. incertus were inoculated by placing 5-mm-diameter agar plugs, colonized by mycelia of each S. homoeocarpa isolate, onto two of the plants' leaves. Plugs were held in place with Parafilm. Two plants were inoculated with each isolate and sterile agar plugs were placed on two leaves of another seedling as control. Plants were incubated in a dew chamber at 20°C and a 12-h photoperiod. After 3 days of incubation, water-soaked lesions surrounded by a dark margin appeared on inoculated plants only. Fungi that were later identified as S. homoeocarpa isolates SLC2 and SLC3 by sequencing of the ITS region were re-isolated from symptomatic leaves, fulfilling Koch's postulates. To our knowledge, this is the first report of dollar spot on sandbur. References: (1) R. W. Smiley et al. Page 22 in: Compendium of Turfgrass Diseases. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2005. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Anthracnose of Onion Caused by Colletotrichum coccodes in Ohio

Plant Disease ◽

10.1094/pdis-01-14-0032-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1271-1271 ◽

Cited By ~ 2

Author(s):

F. Baysal-Gurel ◽

N. Subedi ◽

D. P. Mamiro ◽

S. A. Miller

Keyword(s):

Leaf Tissue ◽

Its Region ◽

The United States ◽

Tween 20 ◽

Colletotrichum Coccodes ◽

Academic Press ◽

Conidial Suspension ◽

First Report ◽

Allium Cepa L ◽

Total Dna

Dry bulb onion (Allium cepa L. cvs. Pulsar, Bradley, and Livingston) plants with symptoms of anthracnose were observed in three commercial fields totaling 76.5 ha in Huron Co., Ohio, in July 2013. Symptoms were oval leaf lesions and yellowing, curling, twisting, chlorosis, and death of leaves. Nearly half of the plants in a 32.8-ha field of the cv. Pulsar were symptomatic. Concentric rings of acervuli with salmon-colored conidial masses were observed in the lesions. Conidia were straight with tapered ends and 16 to 23 × 3 to 6 μm (2). Colletotrichum coccodes (Wallr.) S. Hughes was regularly isolated from infected plants (2). Culturing diseased leaf tissue on potato dextrose agar (PDA) amended with 30 ppm rifampicin and 100 ppm ampicillin at room temperature yielded white aerial mycelia and salmon-colored conidial masses in acervuli. Numerous spherical, black microsclerotia were produced on the surface of colonies after 10 to 14 days. To confirm pathogen identity, total DNA was extracted directly from a 7-day-old culture of isolate SAM30-13 grown on PDA, using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (2), and sequenced. The sequence, deposited in GenBank (KF894404), was 99% identical to that of a C. coccodes isolate from Michigan (JQ682644) (1). Ten onion seedlings cv. Ebenezer White at the two- to three-leaf stage of growth were spray-inoculated with a conidial suspension (1 × 105 conidia/ml containing 0.01% Tween 20, with 10 ml applied/plant). Plants were maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterilized water containing 0.01% Tween 20, and maintained in the same environment. After 30 days, sunken, oval lesions each with a salmon-colored center developed on the inoculated plants, and microscopic examination revealed the same pathogen morphology as the original isolates. C. coccodes was re-isolated consistently from leaf lesions. All non-inoculated control plants remained disease-free, and C. coccodes was not re-isolated from leaves of control plants. C. coccodes was reported infecting onions in the United States for the first time in Michigan in 2012 (1). This is the first report of anthracnose of onion caused by C. coccodes in Ohio. Unusually wet, warm conditions in Ohio in 2013 likely contributed to the outbreak of this disease. Timely fungicide applications will be necessary to manage this disease in affected areas. References: (1) A. K. Lees and A. J. Hilton. Plant Pathol. 52:3. 2003. (2) L. M. Rodriguez-Salamanca et al. Plant Dis. 96:769. 2012. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

A PCR-based Technique for Identification of Fusicoccum sp. from Pistachio and Various Other Hosts in California

Plant Disease ◽

10.1094/pdis.2002.86.5.515 ◽

2002 ◽

Vol 86 (5) ◽

pp. 515-520 ◽

Cited By ~ 12

Author(s):

Zhonghua Ma ◽

Themis J. Michailides

Keyword(s):

Host Plants ◽

Extraction Procedure ◽

Its Region ◽

Pcr Primers ◽

Rapid Identification ◽

Fungal Species ◽

Pcr Assay ◽

Shoot Blight ◽

Dna Fragment ◽

Polymerase Chain

Botryosphaeria panicle and shoot blight of pistachio, caused by Fusicoccum sp. is a destructive disease in California. In this study, a pair of group-specific polymerase chain reaction (PCR) primers BDI and BDII, was developed for identification of Fusicoccum sp. from pistachio and other hosts in California based on the sequences of the rDNA internal transcribed spacer (ITS) region. The primers amplified a 356-bp DNA fragment for all 73 tested isolates of Fusicoccum sp. collected from pistachio and other hosts throughout California in different years, but not for the other 33 fungal species isolated from pistachio and the eight isolates of Fusicoccum sp. obtained from pistachio trees in Greece. The PCR assay using this pair of primers was sensitive enough to detect 5 pg of genomic DNA of Fusicoccum sp. A simple DNA extraction procedure was developed that led to the rapid identification of Fusicoccum sp. from pistachio and other host plants in California.

Download Full-text

First Report of Leaf Blight Caused by Nigrospora sphaerica on Curcuma in China

Plant Disease ◽

10.1094/pdis-04-11-0284 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1190-1190

Author(s):

L. X. Zhang ◽

J. H. Song ◽

G. J. Tan ◽

S. S. Li

Keyword(s):

Disease Incidence ◽

Its Region ◽

Leaf Blight ◽

Morphological Data ◽

Future Research ◽

Leaf Margin ◽

Academic Press ◽

First Report ◽

Pathogenicity Tests ◽

Leaf Pathogen

Curcuma (family Zingiberaceae) is commonly cultivated for the use of rhizomes within traditional Chinese medicines. In October 2009 and 2010, severe leaf blight was observed on Curcuma wenyujin Y.H. Chen & C. Ling (4) in fields located in Ruian, China. The area of cultivation in Ruian encompasses 90% of the production in Zhejiang Province. Disease incidence was approximately 90% of plants observed in affected fields. Early symptoms were yellow-to-brown, irregular-shaped lesions on the leaf margin or tip. After several days, lesions expanded along the mid-vein until the entire leaf was destroyed. Blighted leaves turned grayish to dark brown and withered, and severely affected plants died. Eight fungal isolates were recovered from symptomatic C. wenyujin leaves, collected from eight different fields, on potato dextrose agar (PDA). These fungal colonies were initially white, becoming light to dark gray and produced black, spherical to subspherical, single-celled conidia (14 to 17 × 12 to 15 μm), which were borne on a hyaline vesicle at the tip of the conidiophores. On the basis of these morphological features, the isolates appeared to be similar to Nigrospora sphaerica (2). Strain ZJW-1 was selected as a representative for molecular identification. Genomic DNA was extracted from the isolate, and the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1-5.8S-ITS2) was amplified using ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) primers (3). The ITS region was further cloned and sequenced (GenBank Accession No. JF738028) and was 99% identical to N. sphaerica (GenBank Accession No. FJ478134.1). On the basis of morphological data and the ITS rDNA sequence, the isolate was determined to be N. sphaerica. Pathogenicity tests were conducted on four leaves of four C. wenyujin plants by placing agar pieces (5 mm in diameter) from 8-day-old cultures on pushpin-wounded leaves. An equal number of control plants were wounded and inoculated with noncolonized PDA agar pieces. Plants were placed in moist chambers at 25°C with a 12-h photoperiod. Brown-to-black lesions were observed on wounded leaves after 3 days and expanded to an average of 56 × 40 mm 15 days after inoculation. No symptoms developed on the control leaves. The pathogen was reisolated from the margins of necrotic tissues but not from the controls. The pathogen has been reported as a leaf pathogen on several hosts worldwide (1). To our knowledge, this is the first report of N. sphaerica as a leaf pathogen of C. wenyujin in China. Future research will focus primarily on management of this disease. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, USDA-ARS, Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , March 31, 2011. (2) E. W. Mason. Trans. Brit. Mycol. Soc. 12:152, 1927. (3) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (4) J. Zhao et al. Molecules 15:7547, 2010.

Download Full-text

First Report of Postharvest Blue Mold decay caused by Penicillium expansum on Lemon (Citrus limon) fruit in China

Plant Disease ◽

10.1094/pdis-10-20-2239-pdn ◽

2021 ◽

Author(s):

Ibatsam Khokhar ◽

Jianming Chen ◽

Junhuan Wang ◽

Yang Jia ◽

Yanchun Yan ◽

...

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Penicillium Expansum ◽

Citrus Limon ◽

Conidial Suspension ◽

Blue Mold ◽

Causal Organism ◽

Lemon Fruit ◽

First Report ◽

Fungal Isolates

Lemon (Citrus limon) is one of the most important commercial (both dried and fresh) citrus fruits in China. In the spring of 2019, postharvest blue mold decay was observed at an incidence of 3-5% on lemon fruit at the local markets in Beijing, China. Fruit lesions were circular, brown, soft, and watery, and rapidly expanded at 25°C. To isolate the causal organism, small pieces (2 mm3) were cut from the lesions, surface-sterilized for 1 min in 1.5% NaOCl, rinsed three times with sterilized water, dried with sterile filter paper, placed onto potato dextrose agar (PDA) medium, and incubated at 25°C for 6 days. Eight morphologically similar single-colony fungal isolates were recovered from six lemon fruit. Colony surfaces were bluish-green on the upper surface and cream to yellow-brown one the reverse. Hyphae on colony margins were entirely subsurface and cream in color. Mycelium was highly branched, septate, and colorless, and conidiophores were 250 to 450 × 3.0 to 4.0 µm in size. Stipe of conidiophores were smooth-walled, bearing terminal penicilli, typically terverticillate or less commonly birverticillate, rami occurring singly, 16 to 23 × 3.0 to 4.0 µm, metulae in 3 to 6, measuring 12 to 15 × 3.0 to 4.0 µm. Phialides were ampulliform to almost cylindrical, in verticils of 5 to 8, measuring 8 to 11 × 2.5 to 3.2 µm with collula. Conidia were smooth-walled, ellipsoidal, measuring 3.0 to 3.5 × 2.5 to 3.0 µm. According to morphological characteristics, the fungus was identified as Penicillium expansum (Visagie et al. 2014). For molecular identification, genomic DNA of eight fungal isolates was extracted, regions of the beta-tubulin (TUB), and calmodulin (CAL) genes and ITS region, were amplified using Bt2a/Bt2b, CAL-228F/ CAL-737, and ITS1/ITS4 primers respectively. Obtained sequences of all isolates were identical to sequences of the representative isolate YC-IK12, which was submitted in the GenBank. BLAST results of YC-IK12 sequences (ITS; MT856700: TUB; MT856958: CAL; MT856959) showed 98 to 100% similarity with P. expansum accessions (NR-077154, LN896428, JX141581). For pathogenicity tests, 10 μl of conidial suspension (10 × 105 conidia/ml) from seven-day-old YC-IK12 culture was inoculated using a sterilized needle into the surface of each five asymptomatic disinfected lemons. As a control, three lemons were inoculated using sterile distilled water. All inoculated lemons were placed in plastic containers and incubated at 25°C for 7 days. Decay lesions, identical to the original observations, developed on all inoculated lemons, while control lemons remained asymptomatic. Fungus re-isolated from the inoculated lemon was identified as P. expansum on the basis morphology and Bt2a/Bt2b, CAL-228F/ CAL-737, and ITS1/ITS4 sequences. Previously, Penicillium spp. including P. expansum have been reported as post-harvest pathogens on various Citrus spp. (Louw & Korsten 2015). However, P. digitatum has been reported on lemons and P. expansum has been reported on stored Kiwifruit (Actinidia arguta), Malus, and Pyrus species in China (Tai, 1979; Wang et al. 2015). To our knowledge, this is the first report of blue mold caused by P. expansum on lemons in China. References Louw, J. P., Korsten, L. 2015. Plant Dis. 99:21-30. Tai, F.L. 1979. Sylloge Fungorum Sinicorum. Sci. Press, Acad. Sin., Peking, 1527 pages. 8097 Visagie, C.M. et al. 2014. Studies. Mycol.78: 343. Wang, C. W. et al. 2015. Plant Dis. 99:1037.

Download Full-text

First Report of Diaporthe australafricana Associated with Stem Canker on Blueberry in Chile

Plant Disease ◽

10.1094/pdis-12-11-1025-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 768-768 ◽

Cited By ~ 3

Author(s):

B. A. Latorre ◽

K. Elfar ◽

J. G. Espinoza ◽

R. Torres ◽

G. A. Díaz

Keyword(s):

Vitis Vinifera ◽

Vascular Tissue ◽

Its Region ◽

Pathogenic Fungi ◽

Stem Canker ◽

Vaccinium Corymbosum ◽

Academic Press ◽

First Report ◽

Potted Plants ◽

Blastn Analysis

Stem cankers of blueberry (Vaccinium corymbosum L.) have been observed on as much as 15% of the plants in plantations in central and southern Chile since 2006. Symptoms consisted of apical necrosis of the shoots and brown-to-reddish necrotic lesions on the stems. Internally, a brown-to-reddish discoloration of the vascular tissue can be observed. Twenty, single-plant samples were collected in 12 blueberry plantings (approximately 33°27′ to 40°53′S). Isolations from the margins of the necrotic lesions on the stems were made by plating small pieces (5 mm) on potato dextrose agar acidified with 0.5 μl/ml of 92% lactic acid (APDA). The plates were incubated at 20°C for 5 to 7 days, and hyphal tips of white colonies with septate and hyaline mycelium were transferred to APDA. Colonies were then transferred to autoclaved Pinus radiata needles on 2% water agar and incubated for 20 days at 20°C. Twelve isolates producing black pycnidia and alpha conidia were tentatively identified as a Phomopsis sp. (teleomoph Diaporthe Nitschke). Other fungi, including Botryosphaeriaceae spp. and Pestalotiopsis spp., were also isolated. Alpha conidia were smooth, unicellular, hyaline, fusoid, biguttulate, and 6.4 to 7.9 × 2.3 to 3.3 μm (n = 20). Beta conidia were not observed. The internal transcribed spacer (ITS) region of the rDNA was amplified using primers ITS1 and ITS2 (4) and sequenced. BLASTn analysis of the 473-bp fragment (GenBank Accession No. JQ045712) showed 100% identity to Diaporthe australafricana Crous & J.M. van Niekerk from Vitis vinifera (3). The pathogenicity of D. australafricana was studied on blueberry cv. O'Neal using detached stems (n = 4) in the laboratory, on 2-year-old potted plants (n = 4) in a greenhouse, and on attached stems of mature plants (n = 4) established in the ground. Inoculations were done by placing mycelial plugs taken from 7-day-old APDA cultures in a 7-mm long incision made on the stems. Inoculations with sterile mycelium plugs served as negative controls. Inoculation sites were wrapped with Parafilm to avoid rapid dehydration. Dark brown, necrotic lesions on the internal tissues were obtained on all inoculated stems 15 days after inoculation. Mean lesion lengths were 18.0 ± 7.4 mm on detached stems, 7.8 ± 6.9 mm on stems of 2-year-old plants, and 7.3 ± 2.5 mm on mature plants in the field. No symptoms developed on control stems. Reisolations were successful in 100% of the inoculated stems and D. australafricana was confirmed by the presence of pycnidia and alpha conidia. To our knowledge, this is the first report of D. australafricana causing stem canker in V. corymbosum. Previously, this pathogen has been reported to be affecting Vitis vinifera in Australia and South Africa (3). These results do not exclude that other plant-pathogenic fungi may be involved in this syndrome (1,2). References: (1) J. G. Espinoza et al. Plant Dis 92:1407, 2008. (2) J. G. Espinoza et al. Plant Dis. 93:1187, 2009. (3) J. M. van Niekerk et al. Australas. Plant Pathol. 34:27, 2005. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, NY, 1990.

Download Full-text

First Report of Diaporthe amygdali Associated with Twig Canker and Shoot Blight of Nectarine in Spain

Plant Disease ◽

10.1094/pdis-10-20-2283-pdn ◽

2021 ◽

Author(s):

Francisco Beluzán ◽

Diego Olmo ◽

Maela León ◽

Paloma Abad-Campos ◽

Josep Armengol

Keyword(s):

Prunus Persica ◽

Tap Water ◽

Elongation Factor ◽

Its Region ◽

Sodium Hypochlorite Solution ◽

First Report ◽

Potted Plants ◽

Randomized Design ◽

Shoot Blight ◽

One Year

Nectarine (Prunus persica (L.) Batsch var. nucipersica (Suckow) C. K. Schneid.) is a fruit crop widely cultivated throughout the Mediterranean basin. In Spain, it is mainly grown in eastern regions of the country. In March 2018, 5-year-old nectarine trees showing twig canker symptoms were observed after a rainy spring period in a 0.5 ha orchard located at Alaior, Menorca island (Spain). Cankers were frequent on affected trees (approximately, 80% of the total trees), thus leading to shoot blight. Ten twig segments of one-year old wood with cankers were cut, washed under running tap water, surface disinfected for 1 min in a 1.5% sodium hypochlorite solution and rinsed twice in sterile distilled water. Small pieces (2 mm) of affected tissues were taken from the margin of the cankers and plated on potato dextrose agar (PDA) supplemented with 0.5 g/L of streptomycin sulphate (PDAS). The plates were then incubated at 25 ºC in the dark for 7 to 10 d. Actively growing colonies were first hyphal-tipped and then transferred to PDA and 2% water agar supplemented with sterile pine needles and incubated at 21-22ºC under a 12h/12h near UV / darkness cycle during 21 d (León et al. 2020). Colonies were white at first, becoming light cream, with visible solitary and aggregate pycnidia at maturity. Alpha conidia were aseptate, fusiform, hyaline, multi-guttulated (mean ± SD = 7.4 ± 0.7 × 2.8 ± 0.4 µm, n = 100). Beta and gamma conidia were not observed. The morphological and cultural characteristics of the isolates were congruent with those of Diaporthe spp. (Gomes et al. 2013). The ITS1-5.8S-ITS2 (ITS) region and fragments of β-tubulin (tub2), the translation elongation factor 1-alpha (tef1-α) gene regions, histone H3 (his3) and calmodulin (cal) genes of representative isolate DAL-59 were amplified and sequenced (Santos et al. 2017). The BLASTn analysis revealed 100% similarity with sequences of D. mediterranea (Synonym D. amygdali) (Hilário et al. 2021) isolate DAL-34 from almond (ITS: MT007489, tub2: MT006686, tef1-α: MT006989, his3: MT007095 and cal: MT006761). Sequences of isolate DAL-59 were deposited in GenBank Database (ITS: MT007491, tub2: MT006688, tef1-α: MT006991, his3: MT007097 and cal: MT006763). Pathogenicity tests were conducted using one-year-old potted plants of nectarine cv. Boreal, which were inoculated with isolate DAL-59. In each plant, a 3 mm wound was made in the center of the main branch (about 30 cm length) with a scalpel. Colonized agar plugs with 3 mm diameter, which were obtained from active 10-day-old colonies growing on PDA, were inserted underneath the epidermis and the wounds sealed with Parafilm. Inoculated plants were incubated in a growth chamber at 23 ºC with 12 h of light per day. Controls were inoculated with uncolonized PDA plugs. There were twelve plants per treatment, which were arranged in a completely randomized design. Five days after inoculation necrosis development was observed in the area of inoculation. Wilting and twig blight symptoms over the lesion occurred 3-wk after inoculation and pycnidia were detected, while the controls remained asymptomatic. Diaporthe amygdali was re-isolated from symptomatic tissues and identified as described above to satisfy Koch’s postulates. To our knowledge, this is the first report of D. amygdali causing twig canker and shoot blight disease on nectarine in Spain.

Download Full-text

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China

Plant Disease ◽

10.1094/pdis-02-12-0166-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 283-283

Author(s):

C. J. You ◽

C. M. Tian ◽

Y. M. Liang ◽

X. B. Dong ◽

C. Tsui

Keyword(s):

Pinus Sylvestris ◽

Early Stage ◽

Aerial Mycelium ◽

Its Region ◽

Distilled Water ◽

Academic Press ◽

Conidial Suspension ◽

Pitch Canker ◽

Canker Disease ◽

First Report

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Rhexocercosporidium panacis Causing Rusty Root of Panax ginseng in Northeastern China

Plant Disease ◽

10.1094/pdis-01-14-0082-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 4

Author(s):

X. H. Lu ◽

A. J. Chen ◽

X. S. Zhang ◽

X. L. Jiao ◽

W. W. Gao

Keyword(s):

Panax Ginseng ◽

Agar Plate ◽

Its Region ◽

Culture Collection ◽

Northeastern China ◽

Post Inoculation ◽

Academic Press ◽

First Report ◽

Irregular Shapes ◽

Its Sequence Analysis

In northeastern China, Asian ginseng (Panax ginseng) roots exhibited reddish brown lesions of various sizes, irregular shapes, and diffuse margins, typical of rusty root disease. The lesions remain superficial, smooth, and limited to the epidermal and peridermal tissues. In September 2013, 10 symptomatic roots were collected from each of three fields in Jilin and Heilongjiang provinces. One piece of symptomatic skin tissue from each root was excised, surface-disinfested in 1% NaClO for 3 min, rinsed three times with sterile water, and then placed on tetracycline-amended (50 μg/ml) potato dextrose agar. After incubation at 22 ± 1°C in the dark for a week, small olivaceous black colonies developed from the symptomatic tissue from five of the 30 samples. No spores were observed. A single hyphal tip of each colony was transferred to a fresh V8 agar plate to purify the culture. Two-week-old colonies on V8 agar were olivaceous gray, and 42 to 46 mm in diameter with an outer white margin (3 to 5 mm wide). Conidia produced in V8 broth after 3 weeks with a 12-h photoperiod were straight and hyaline, cylindrical or subcylindrical with no or one septum. Mature conidia were 12.8 to 21.8 × 2.2 to 4.5 μm (mean 18.2 × 3.0 μm, n = 100 conidia for each of three isolates). Three isolates selected randomly were further identified by analyzing the partial sequences of the ITS region of rDNA with primers ITS4 and ITS5 (5), and partial sequences of β-tubulin with the primers tub2F and tub2R (1). Sequences of the three isolates (GenBank Accession Nos. KJ149287, KJ149288, and KJ149290 to 93) showed 99% to 100% homology with previously identified and deposited Rhexocercosporidium panacis isolates (DQ2499992 and DQ457119) for both loci (3). Therefore, the three isolates were identified as R. panacis and deposited in China General Microbiological Culture Collection Center (CGMCC3.17259 to 61). Pathogenicity of R. panacis in Asian ginseng was investigated using these three isolates as described previously with slight modifications (4). Bare roots of 3-year-old Asian ginseng were surface-disinfested as described above, and inoculated with mycelial plugs (4 mm diameter) cut from the margin of actively growing colonies of the isolates on V8 agar. Three mycelial plugs were placed on each root at 3-cm intervals and four roots (replicates) were inoculated for each isolate. Four additional roots were inoculated with non-colonized agar plugs as control. The treated roots were placed on moist filter paper in an enamel tray. The plates were sealed with plastic wrap to prevent desiccation and incubated in the dark at 18 ± 1°C. Four weeks post inoculation, all the inoculated ginseng roots showed red-brown lesions, which turned to dark red or black over time. R. panacis was recovered from symptomatic roots for all isolates and confirmed by ITS sequence analysis. The mock-inoculated control roots remained symptomless and no R. panacis was isolated. The inoculation experiment was repeated and showed the same results. R. panacis was reported in 2006 to infect roots of Panax quinquefolius (2,3,4). To our knowledge, this is the first report of R. panacis causing rusty root of P. ginseng. References: (1) P. R. Hirsch et al. Mycol. Res. 104:435, 2000. (2) Z. K. Punja et al. Can. J. Plant Pathol. 35:503, 2013. (3) R. D. Reeleder. Mycologia. 99:91, 2007. (4) R. D. Reeleder et al. Phytopathology 96:1243, 2006. (5) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe betae on Swiss Chard in China

Plant Disease ◽

10.1094/pdis-02-14-0166-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1429-1429 ◽

Cited By ~ 1

Author(s):

Y. Zhang ◽

F. L. Zhang ◽

P. Cao ◽

Y. Liu ◽

K. Liu ◽

...

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Central China ◽

Growth Chamber ◽

Universal Primers ◽

Academic Press ◽

First Report ◽

Swiss Chard ◽

Microscopic Evaluation ◽

Erysiphe Betae

Swiss chard (Beta vulgaris L. subsp. cicla) is a widely planted vegetable in China. From May to June 2013, an outbreak of powdery mildew on Swiss chard cultivar Fangzheng was observed in the commercial fields in Zhoukou city of Henan Province, located in central China. More than 80% of the plants exhibited symptoms of the disease. At the beginning of infection, circular, white, dust-like colonies of powdery mildew occurred mainly on adaxial surfaces of leaves. As the disease progressed, white mycelia covered the foliar parts of plant. No cleistothecia were found on or in collected samples. Upon microscopic evaluation, conidiophores were unbranched with the length of 63 to 126 and width of 7 to 10 μm (n = 50), produced conidia singly, and composed of a cylindrical foot cell followed by one to three short cells. Conidia were colorless, hyaline, ovoid, measured 29 to 40 × 12 to 18 μm (n = 100), lacked fibrosin bodies, and produced germ tubes on the ends of the conidia. The fungus was identified as Erysiphe betae according to the morphological features (1). To verify the identity, the internal transcribed spacer (ITS) region was amplified with the universal primers ITS1 and ITS4 (2) and sequenced. The ITS sequence obtained was assigned as Accession No. KF268348 in GenBank, which showed 100% homogeneity with two ITS sequences of E. betae isolates from UK (DQ164432 and DQ164436). Koch's postulates were conducted by inoculating 15 healthy 5-week-old plants (cv. Fangzheng) with detached infected leaves, which grew in a growth chamber under 22/16°C (day/night), 50% relative humidity, 120 μmol/m2/s light and a 16-h photoperiod. Fifteen non-inoculated plants grew in another growth chamber with the same conditions as control. Symptoms consistent with the infected field plants were observed on the inoculated plants, while no symptoms were found on the control plants. Microscopic observation revealed that the pathogen growing on the inoculated plants was consistent with the morphology of the original fungus. To our knowledge, this is the first report of E. betae infection on Swiss chard in China (3). References: (1) S. Francis. Mol. Plant Pathol. 3:119, 2002. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, CA, 1990. (3) R. Y. Zheng et al. Page 63 in: Flora Fungorum Sinicorum, Vol. 1, Erysiphales. Science Press, Beijing, 1987.

Download Full-text