First Report of ‘Candidatus Phytoplasma pyri’ Causing Peach Yellow Leaf Roll (PYLR) in Spain

‘Candidatus Phytoplasma prunorum,’ which causes European stone fruit yellows (ESFY), is the prevalent phytoplasma affecting Prunus spp. in Europe. It is closely related to ‘Ca. P. pyri,’ which causes pear decline (PD) in pear trees. Both phytoplasma belong to the ribosomal group 16Sr-X and are naturally transmitted by different species of Cacopsylla spp. (4). In North America, ‘Ca. P. pyri’ is responsible for peach yellow leaf roll (PYLR), transmitted by Cacopsylla pyricola from pear to peach trees (1). In Spain, ‘Ca. P. prunorum’ is widespread on Prunus spp., but its occurrence on Prunus persicae is very low and ‘Ca. P. pyri’ is present in every pear orchard (3). During 2012, a previously unreported syndrome including early reddening, leaf curling, decline, abnormal fruits, and in some cases chlorosis and death of peach trees was reported on peach in Lleida, northern Spain. Symptoms were different to ESFY and PYLR, in that flowering disorders such as ESFY or yellows were not apparent, and reddening and decline were the most common symptoms. The disease was present in a wide range of varieties and rootstocks, suggesting insect transmission in an area where C. pruni, vector of ‘Ca. P. prunorum,’ was not previously reported, but C. pyri was abundant in pear orchards. Shoot samples from 20 symptomatic peach trees were collected in seven orchards within a 2 km2 area with an estimated incidence of 40%, which was higher in the borders. DNA was extracted from 1 g of leaf midribs and phloem tissue and amplified with ribosomal universal primers P1/P7 followed by nested PCR with R16F2n/R16R2 and specific primers fO1/rO1 that target the 16Sr-X group (3). The final PCR products were digested with RsaI enzyme. Amplifications with non-ribosomal specific primers, Imp ESFY, Imp PD A and Imp PD B that amplify sequences of gene Imp, that encode a phytoplasma membrane protein, were also carried out (2). Tissue samples with ESFY and PD and peach seedlings were used as positive and negative controls, respectively. Amplified PCR products were sequenced and compared to sequences deposited in GenBank. Phytoplasmas were detected in 18 of the 20 samples analyzed. No phytoplasmas were detected in negative peach controls. All digestions of fO1/rO1 PCR products from peach samples showed a PD profile, while no ESFY profile was detected. All samples were positive with specific primers Imp PD A and B. None of the peach samples were positive with the specific Imp-ESFY primers. Sequencing of R16 and Imp PDA and B amplicons revealed the presence of a stable isolate. The sequences were submitted to the European nucleotide archive (ENA) with the accession nos. HG737345 and HG737344. Based on the 16S rDNA sequence, this strain is 100% homologous to the reference strain PD1 (GenBank Accession No. AJ542543) and 99.55% homologous to strain PD 33 Lib (GenBank FN600725) based on the Imp gene sequence. This is the first report of PD phytoplasma in peach trees in Spain, and the first report in Europe of PD phytoplasma causing economically important outbreaks in peach orchards, following a pattern that could be similar to PYLR in North America. This strain is genetically closer to some European or Middle Eastern PDs than to North American PYLR. References: (1) C. L. Blomquist et al. Plant Dis. 86:759, 2002. (2) J. L. Danet et al. Microbiology 157:438, 2011. (3) M. Garcia-Chapa et al. J. Phytopathol. 151:584, 2003. (4) E. Seemüller et al. Int. J. Syst. Evol. Microbiol. 54:1217, 2004.

Download Full-text

First Report of the Spittlebug Lepyronia quadrangularis and the Leafhopper Latalus sp. as Vectors of the Elm Yellows Associated Phytoplasma, Candidatus Phytoplasma ulmi in North America

Plant Disease ◽

10.1094/pdis-06-13-0628-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 154-154 ◽

Cited By ~ 3

Author(s):

C. Rosa ◽

E. McCarthy ◽

K. Duong ◽

G. Hoover ◽

G. Moorman

Keyword(s):

North America ◽

Dutch Elm Disease ◽

Universal Primers ◽

State University ◽

Eastern United States ◽

First Report ◽

Pcr Products ◽

Insect Mortality ◽

Environment Chamber ◽

Elm Yellows

Elm yellows (EY) is a lethal disease of American (Ulmus americana L.) and other elm species (1). On the Pennsylvania State University campus, EY, together with Dutch elm disease, has killed 82 of about 400 mature elms since 2007, the year of first EY detection. Candidatus Phytoplasma ulmi, associated with EY, has been reported to be transmitted by the whitebanded elm leafhopper Scaphoideus luteolus Van Duzee, the meadow spittlebug Philaenus spumarius L., and the leafhopper Allygus atomarius Fabricius (1) in North America, but correlation of these insects with EY in the eastern United States has not been reported. Three Cicadellidae collections using sweep nets and aspirators were performed from July to September 2012 on branches of an EY infected red elm (U. rubra Muh; 40°48.408′N, 77°52.208′W) and on vegetation within a 0.5 km radius. The red elm is in close proximity to trees, shrubs, and a managed meadow and has repeatedly tested positive for EY since 2007. During each collection, about 200 cicadellids were captured in BioQuip No-See-Um catch bags with cups, and the bags were hung around the red elm branches, forcing the insects to feed on the infected tree for 24 h. Insects were transferred to BugDorm rearing tents containing wild grasses, elm seedlings, cowpeas, celery, carrots, and basil, all grown from seed, and were kept for 3 weeks in a controlled environment chamber at 28°C and 70% humidity with a 16-h photoperiod. Insects easily recognized in the same species or individual insects of uncertain identity were then isolated for about 1 week in cages each containing one 6-month-old healthy American elm seedling (grown from seed in growth chamber). Up to 10 morphospecies were found in each collection, with 1 to 20 individuals per morphospecies. The total number of unique morphospecies used in the three transmission trials and later identified as different species was 8. Dead insects collected daily were stored in 80% ethanol and later identified to genus or species level. About 70% insect mortality was recorded, but about 60 individuals from each collection survived the change of diet and environment. After 3 months, individual elm seedlings were tested by RT-PCR (3) for the presence of phytoplasmas using universal primers fU5/rU3 (2). PCR products were visualized on 1.5% agarose gel, and if DNA was amplified, it was cloned and sequenced. Three of 30 seedlings tested positive for phytoplasmas and sequencing of the cloned products (24 clones were sequenced per transformation, per each of the three positive seedlings) confirmed that only Ca. P. ulmi was present in the 3 infected seedlings but not in the remaining 27 or in 46 unexposed control seedlings. The 3 seedlings were each exposed to a single insect and the same insects that were used in the transmission trial were identified. One spittlebug (Cercopidae) Lepyronia quadrangularis Say, one P. spumarius, and one leafhopper in the genus Latalus (Cicadellidae: Deltocephalinae) were identified as vectors. The phytoplasma-positive seedlings showed stunting and yellowing, and died shortly after testing. Other insects captured and identified in the survey were A. atomarius, Neophilaenus lineatus L., Metcalfa pruinosa Say, Amblysellus curtisii Fitch and individuals in the genera Draeculacephala, Elymana, Empoasca, Mesamia, Stroggylocephalus, and Ceratagallia. S. luteolus was not captured during this sampling but was captured on yellow sticky traps and in light traps in previous years at other locations on the campus. This is the first report suggesting that L. quadrangularis and Latalus sp. can serve as natural vectors of EY. References: (1) P. Herath et al. Plant Dis. 94:1355, 2010. (2) H. Lorenz et al. Phytopathology 85:771, 1995. (3) P. Margaria et al. Plant Dis. 91:1496, 2007.

Download Full-text

Species-specific duplex PCR for the detection of Pratylenchus penetrans

Nematology ◽

10.1163/156854109x428016 ◽

2009 ◽

Vol 11 (6) ◽

pp. 847-857 ◽

Cited By ~ 21

Author(s):

Lieven Waeyenberge ◽

Nicole Viaene ◽

Maurice Moens

Keyword(s):

Internal Control ◽

Dna Sequences ◽

Rrna Gene ◽

Duplex Pcr ◽

Specific Primers ◽

5.8S Rrna Gene ◽

5.8S Rrna ◽

Wide Range ◽

Pcr Products ◽

Species Specific

Abstract ITS1, the 5.8S rRNA gene and ITS2 of the rDNA region were sequenced from 20 different Pratylenchus species. Additionally, the same region was sequenced from seven populations of P. penetrans. After purifying, cloning and sequencing the PCR products, all sequences were aligned in order to find unique sites suitable for the design of species-specific primers for P. penetrans. Since ITS regions showed variability between and even within populations of P. penetrans, only three small DNA sequences were suitable for the construction of three potentially useful species-specific primers. New species-specific primers were paired with existing universal ITS primers and tested in all possible primer combinations. The best performing primer set, supplemented with a universal 28S rDNA primer set that served as an internal control, was tested in duplex PCR. The ideal annealing temperature, Mg2+ concentration and primer ratios were then determined for the most promising primer set. The optimised duplex PCR was subsequently tested on a wide range of different Pratylenchus spp. and 25 P. penetrans populations originating from all over the world. To test the sensitivity, the duplex PCR was conducted on DNA extracted from a single P. penetrans nematode mixed with varying amounts of nematodes belonging to another Pratylenchus species. Results showed that a reliable and sensitive P. penetrans species-specific duplex PCR was constructed.

Download Full-text

First Report of a Group 16SrII Phytoplasma Infecting Chickpea in Oman

Plant Disease ◽

10.1094/pd-90-0973c ◽

2006 ◽

Vol 90 (7) ◽

pp. 973-973 ◽

Cited By ~ 8

Author(s):

N. A. Al-Saady ◽

A. M. Al-Subhi ◽

A. Al-Nabhani ◽

A. J. Khan

Keyword(s):

Nested Pcr ◽

Animal Feed ◽

Restriction Enzymes ◽

Universal Primers ◽

Polymorphism Analysis ◽

Disease Symptoms ◽

First Report ◽

Pcr Products ◽

Polymerase Chain ◽

Group 2

Chickpea (Cicer arietinum), locally known as “Dungo”, is grown for legume and animal feed mainly in the interior region of Oman. During February 2006, survey samples of chickpea leaves from plants showing yellows disease symptoms that included phyllody and little leaf were collected from the Nizwa Region (175 km south of Muscat). Total nucleic acid was extracted from asymptomatic and symptomatic chickpea leaves using a cetyltrimethylammoniumbromide method with modifications (3). All leaf samples from eight symptomatic plants consistently tested positive using a polymerase chain reaction assay (PCR) with phytoplasma universal primers (P1/P7) that amplify a 1.8-kb phytoplasma rDNA product and followed by nested PCR with R16F2n/R16R2 primers yielding a product of 1.2 kb (2). No PCR products were evident when DNA extracted from healthy plants was used as template. Restriction fragment length polymorphism analysis of nested PCR products by separate digestion with Tru9I, HaeIII, HpaII, AluI, TaqI, HhaI, and RsaI restriction enzymes revealed that a phytoplasma belonging to group 16SrII peanut witches'-broom group (2) was associated with chickpea phyllody and little leaf disease in Oman. Restriction profiles of chickpea phytoplasma were identical with those of alfalfa witches'-broom phytoplasma, a known subgroup 16SrII-B strain (3). To our knowledge, this is the first report of phytoplasma infecting chickpea crops in Oman. References: (1) A. J. Khan et al. Phytopathology, 92:1038, 2002. (2). I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998 (3) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA. 81:8014, 1984.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Cucurbit yellow stunting disorder virus in Morocco

Plant Disease ◽

10.1094/pdis.2000.84.5.596c ◽

2000 ◽

Vol 84 (5) ◽

pp. 596-596 ◽

Cited By ~ 24

Author(s):

C. Desbiez ◽

H. Lecoq ◽

S. Aboulama ◽

M. Peterschmitt

Keyword(s):

Important Change ◽

Enzyme Linked Immunosorbent Assay ◽

Yellow Leaf ◽

Vegetable Crops ◽

Specific Primers ◽

First Report ◽

Large Populations ◽

Healthy Control ◽

Symptomless Plant ◽

Beet Pseudo Yellows Virus

In October, 1999, severe yellowing symptoms were observed in a melon (Cucumis melo L.) crop grown under plastic tunnels in the region of Agadir, Morocco. Large populations of whiteflies (Bemisia tabaci) were noticed during the early stages of the crop. At harvest, leaf samples were collected from two symptomatic plants and one symptomless plant. A mature yellow leaf was assayed from each symptomatic plant and for one of these two plants a younger leaf exhibiting only yellow spots. Cucurbit aphid-borne yellows virus, which causes similar symptoms in melons, was not detected by double-antibody sandwich enzyme-linked immunosorbent assay tests. Total RNA was extracted from fresh leaf tissues and submitted to reverse transcription and polymerase chain reaction with primers specific to two whitefly-transmissible viruses: Beet pseudo-yellows virus (BPYV) and Cucurbit yellow stunting disorder virus (CYSDV) (2). No amplification was obtained with BPYV-specific primers. In contrast, an expected 465-bp product was amplified in all samples from symptomatic plants with CYSDV-specific primers. No amplification was detected in samples from the symptomless plant nor from healthy control plants. B. tabaci-transmitted CYSDV has been reported in the Middle East, southwestern Europe, and North America (1,4). This is the first report of CYSDV in Morocco, and it follows the first report of another B. tabaci-transmitted virus, Tomato yellow leaf curl virus, in tomato (3), suggesting an important change in the viral pathosystem affecting vegetable crops in Morocco. References: (1) Kao et al. Plant Dis. 84:101, 2000. (2) Livieratos et al. Plant Pathol. 47:362, 1998. (3) Peterschmitt et al. Plant Dis. 83:1074, 1999. (4) Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-10-11-0849-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 769-769 ◽

Cited By ~ 4

Author(s):

J. Víchová ◽

B. Staňková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Tomato Fruit ◽

Colletotrichum Acutatum ◽

Distilled Water ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Pcr Products ◽

Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

Download Full-text

First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽

10.1094/pdis-01-12-0101-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1225-1225 ◽

Cited By ~ 31

Author(s):

T. S. Schubert ◽

M. M. Dewdney ◽

N. A. Peres ◽

M. E. Palm ◽

A. Jeyaprakash ◽

...

Keyword(s):

North America ◽

Sweet Orange ◽

Black Spot ◽

The United States ◽

Yield Reduction ◽

Rrna Gene ◽

Specific Primers ◽

Oatmeal Agar ◽

First Report ◽

Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Download Full-text

First report of an isolate of 'Candidatus Phytoplasma australiense' associated with a yellow leaf roll disease of peach (Prunus persicae) in Bolivia

Plant Pathology ◽

10.1111/j.1365-3059.2005.01234.x ◽

2005 ◽

Vol 54 (4) ◽

pp. 558-558 ◽

Cited By ~ 11

Author(s):

P. Jones ◽

Y. Arocha ◽

O. Antesana ◽

E. Montilliano ◽

P. Franco

Keyword(s):

Leaf Roll ◽

Yellow Leaf ◽

First Report

Download Full-text

Cherry leaf roll nepovirus. [Distribution map].

Distribution Maps of Plant Diseases ◽

10.1079/dmpd/20066500800 ◽

2000 ◽

Author(s):

Keyword(s):

South Carolina ◽

Czech Republic ◽

New Zealand ◽

North America ◽

Woody Plants ◽

Leaf Roll ◽

Distribution Map ◽

Wide Range ◽

New Distribution ◽

Distribution In Europe

Abstract A new distribution map is provided for Cherry leaf roll nepovirus Viruses: Comoviridae: Nepovirus Hosts: A wide range of woody plants. Information is given on the geographical distribution in EUROPE, Albania, Belgium, Bulgaria, Croatia, Czech Republic, Finland, France, Germany, Hungary, Italy, Mainland Italy, Netherlands, Norway, Poland, Portugal, Romania, Russia, Slovakia, Slovenia, Spain, Switzerland, UK, England and Wales, Scotland, Yugoslavia (Fed. Rep.), ASIA, China, Turkey, NORTH AMERICA, Canada, British Columbia, USA, Arkansas, California, Iowa, Maryland Minnesota, Nebraska, Ohio, Oregon, Pennsylvania, South Carolina, Washington, Wisconsin, OCEANIA, Australia, New Zealand.

Download Full-text

First Report of Verticillium Wilt Caused by Verticillium dahliae on Mango Trees (Mangifera indica) in Southern Spain

Plant Disease ◽

10.1094/pdis-94-3-0380c ◽

2010 ◽

Vol 94 (3) ◽

pp. 380-380 ◽

Cited By ~ 3

Author(s):

L. Baeza-Montañez ◽

R. Gómez-Cabrera ◽

M. D. García-Pedrajas

Keyword(s):

Verticillium Wilt ◽

Verticillium Dahliae ◽

Mangifera Indica ◽

Southern Spain ◽

Reference Sequence ◽

Universal Primers ◽

First Report ◽

Wide Range ◽

Race 1 ◽

Disease Rating

Verticillium wilt, primarily caused by Verticillium dahliae Klebahn and V. albo-atrum Reinke & Berthold, affects a wide range of economically important crops. This disease is an increasing problem in areas where young mango trees are planted on land previously planted in vegetable crops. In 2008, symptoms of Verticillium wilt were observed in mango cvs. Kent and Osteen in the subtropical fruit-producing area of Málaga in southern Spain. In a new mango grove of cv. Kent, previously planted in potatoes and tomatoes, ~20% of 200 1-year-old trees had one-sided branch dieback. In many of these trees the symptoms expanded, leading to decline and eventual death. Cross sections of affected branches revealed brown vascular discoloration. Verticillium was isolated from surface-sterilized segments of symptomatic branches placed on acidic potato dextrose agar (PDA). Plates were incubated at 24°C. After 3 days, slow-growing colonies were transferred to PDA. Verticillium was similarly isolated from symptomatic potato plants grown in a nearby field. Identification of V. dahliae was initially based on morphology and further confirmed by molecular methods. All isolates tested produced microsclerotia, a defining feature that distinguishes V. dahliae from V. albo-atrum. For molecular characterization, V. dahliae specific primers 19 and 22 (1) and universal primers ITS1 and ITS4, which amplify the rRNA internal transcribed spacer (ITS) region (4), were used. Bands of expected size were amplified with both primer combinations. ITS fragments were sequenced and identical to the V. dahliae reference sequence (GenBank AY555948) (3). Pathogenicity assays were conducted with a selected isolate from mango using tomato plants from the susceptible line ‘Moneymaker’ and the near isogenic ‘Motabo’ line carrying the Ve gene conferring resistance to race 1 isolates. Five 1-month-old plants (four-leaf stage) were inoculated by root immersion in a suspension of 107 conidia/ml. Five control plants were mock inoculated with distilled water. As a positive control, five plants were inoculated with the previously described race 1 strain Dvd-T5 (2), which induces severe symptoms in susceptible tomato cultivars. Symptoms were scored visually at various time points up to 40 days by a 0 to 5 scale in which 0 = negligible chlorosis or wilting, 1 = chlorosis and wilting and/or curling in individual leaves, 2 = necrosis in leaves, 3 = at least one branch dead, 4 = wilt and/or chlorosis in upper leaves and/or two or more branches dead, and 5 = plant dead or all leaves and most of stem necrotic. The isolate from mango caused typical Verticillium wilt symptoms with a mean disease rating of 3.6 at 40 days postinoculation in both lines. The mean disease rating for Dvd-T5 in Moneymaker 40 days postinoculation was 4.0. V. dahliae was reisolated from symptomatic plants but not from noninoculated controls. To our knowledge, this is the first report of Verticillium wilt on mango in Spain. More problems with Verticillium wilt are expected because of the increasing planting of mango in fields previously dedicated to horticultural crops. References: (1) J. H. Carder et al. Modern Assays for Plant Pathogenic Fungi: Identification, Detection and Quantification. CAB International, Oxford, 1994. (2) K. F. Dobinson et al. Can. J. Plant. Pathol. 18:55, 1996. (3) M. P. Pantou et al. Mycol. Res. 109:889, 2005. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Amplification. Academic Press, San Diego, 1990.

Download Full-text