First Report of Leaf Blotch Caused by Septoria phalaridis on Phalaris paradoxa

Phalaris paradoxa (hood canarygrass) is one of the most abundant weeds in wheat fields of Iran. In a survey conducted from 2005 to 2007 in Ilam (Dehloran City) and Golestan (Gorgan City) provinces, leaf blotch symptoms were prevalent on P. paradoxa. Initial symptoms were pale brown and necrotic lesions that were 3 to 4 mm long on the leaves. Severity of the disease on the lower leaves was higher than on the upper leaves. Pycnidia were observed on the adaxial surface of infected leaves, scattered or sometimes in clusters, dark brown, globose, and 70 to 90 μm in diameter, with the ostiole approximately 10 μm in diameter. Conidia were filiform, hyaline, 0 to 3 septate (mostly 1 septate), and 17 to 40 × 1.5 to 2.0 μm. Conidiogenesis type was holoblastic. On the basis of the above morphological characters, this species was identified as Septoria phalaridis Cocc. & Morini (2,3). Sequencing the internal transcribed spacer (ITS) region of the fungus (GenBank Accession No. GU123926) showed 98% homology to Mycosphaerella graminicola strain 687 and 97% to S. passerinii strain ATCC26515 (GenBank Accession Nos. AB435068.1 and AF181696.1). To confirm pathogenicity of the fungus, 25 P. paradoxa seedlings were inoculated at the three-leaf stage with 20 ml of 1 × 107 spores/ml suspension with a hand sprayer. Plants were covered with a clear polyethylene bag to increase humidity and prevent cross contamination. After 72 h, bags were removed and plants were kept in a greenhouse at 21 ± 2/16 ± 2°C (day/night) and a 16-h photoperiod. Control plants received sterilized distilled water only. Leaves of each plant were visually inspected every day and the appearance of disease symptoms was recorded. After 1 month, all inoculated leaves showed symptoms and signs of the disease such as chlorosis, necrosis, and pycnidia, whereas control plants showed no symptoms or signs of disease. The infected plant tissues were examined with a microscope, the pycnidia and pycnidiospores were measured, and S. phalaridis was reisolated from leaf lesions. The first description of S. phalaridis was on P. brachystachys (1); however, to our knowledge, this is the first report of this pathogen on P. paradoxa. In addition, this is a new fungal species for the mycobiota of Iran. Two voucher specimens (IRAN 14078 F and IRAN 14218 F) were deposited in the Fungus Collection of the Ministry of Jihad-e Agriculture, Tehran, Iran. References: (1) G. Cocconi and F. Morini. Mem. R. Accad. Sci. Ist. Bologna, Cl. Sci. Fis. Ser. 4, 6:371, 1884. (2) M. J. Priest. Fungi of Australia, Septoria. ABRS, Canberra. CSIRO Publishing, Melbourne, 2006. (3) D. N. Teterevnikova-Babayan. Fungi of the Genus Septoria in the USSR. Akademiya Nauk Armyanskoi SSR, Yerevan, 1987.

Download Full-text

First Report of Curvularia inaequalis and Bipolaris spicifera Causing Leaf Blight of Buffalograss in Nebraska

Plant Disease ◽

10.1094/pdis-05-13-0487-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 279-279 ◽

Cited By ~ 6

Author(s):

B. S. Amaradasa ◽

K. Amundsen

Keyword(s):

Dna Sequences ◽

Its Region ◽

Fungal Species ◽

Transparent Plastic ◽

Disease Symptoms ◽

First Report ◽

Sequence Identity ◽

Foliar Blight ◽

Initial Symptoms ◽

Bipolaris Spicifera

During the summer of 2011, foliar blight was observed on buffalograss (Buchloë dactyloides (Nutt.) Engelm.) lawns in Lincoln and Waverly, Nebraska. Disease symptoms were common when buffalograss was growing above 30°C and in drought conditions. Disease symptoms began as dark brown oblong leaf spots, followed by leaf tip dieback and eventual blighting of entire tillers. Leaf infections would progress into patches of thinning turf. Diseased leaf pieces were rinsed in distilled water and placed on 1.5% water agar. Two mitosporic fungal species having conidial morphology of Curvularia and Bipolaris were isolated. Colonies of Curvularia isolates grown on ¼× PDA at 25°C appeared velvety and dark greenish to grayish black after 1 week while Bipolaris cultures were brownish gray with olive green margins. The two species were identified as Curvularia inaequalis (Shear) Boedijn (1) and Bipolaris spicifera (Bainier) Subram. (2). Conidia of C. inaequalis were mostly straight to slightly curved, 17.4 to 37.1 × 7.2 to 12.6 (n = 24) μm, pale brown to brown, and three to four septate with scarcely protuberant hilum. Conidia of B. spicifera were 18.5 to 30.3 × 7 to 11.4 (n = 20) μm, ellipsoidal or oblong, light brown, 3-distoseptate with a flattened hilum. DNA confirmation was performed using one isolate of each of the two species. The rDNA-ITS region, amplified with ITS1: 5′-TCCGTAGGTGAACCTGCGG-3′ and ITS4: 5′-TCCTCCGCTTATTGATATGC-3′, and the gpd gene, amplified with gpd1: 5′-CAACGGCTTCGGTCGCATTG-3′ and gpd2: 5′-GCCAAGCAGTTGGTTGTGC-3′ (3) were used to confirm taxon of the isolates by comparing DNA sequences to those in GenBank. Our B. spicifera isolate Wv1Bss2 (Accession Nos. KC897667 [ITS] and KC928089 [gpd]) had >99.8% sequence identity to B. spicifera strain CCTU 245 (Accessions JX070077 and JX070078) while our C. inaequalis isolate Wv3YBss2 (GenBank Accession Nos. KC897663 [ITS] and KC928086 [gpd]) showed >98.6% sequence identity to strain ZM020029 (Accessions HM053665 and HM053653). Pathogenicity of the two species was tested on buffalograss cultivar Prestige. Stolons of Prestige were established in 10 cm square pots filled with Fafard 3B Mix potting medium. The pots of buffalograss were kept in a 30°C greenhouse with a 12-h photoperiod for 12 weeks. One isolate of each species representing each collection site (two isolates per each species) were cultured on ¼× PDA plates and conidial suspensions of 1.5 × 106 spores/ml in sterile water were prepared. Each isolate was inoculated to three pots of Prestige by spraying 15 ml of spore suspension per pot. Control pots of Prestige were sprayed with water. Pots were sealed in transparent plastic bags and every other day, opened for a few hours and plants sprayed with water to encourage infection. Isolates of C. inaequalis were more virulent with initial symptoms of foliar spots appearing 7 days after inoculation, followed by leaf tip dieback and necrosis of infected tillers. B. spicifera isolates induced similar symptoms 14 days after inoculation. Control pots were asymptomatic. C. inaequalis and B. spicifera were successfully re-isolated from symptomatic tissue, completing Koch's postulates. To our knowledge, this is the first report of identification of foliar blight causal pathogens on buffalograss in Nebraska. References: (1) A. Sivanesan. Mycol. Pap. 158:1, 1987. (2) H. M. Koo et al. Plant Pathol. J. 19:133, 2003. (3) M. L. Berbee et al. Mycologia 91:964, 1999.

Download Full-text

First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽

10.1094/pdis-08-13-0873-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 843-843 ◽

Cited By ~ 6

Author(s):

N.-H. Lu ◽

Q.-Z. Huang ◽

H. He ◽

K.-W. Li ◽

Y.-B. Zhang

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Avicennia Marina ◽

Optical Microscope ◽

Ethanol Solution ◽

Morphological Observation ◽

Fusarium Equiseti ◽

First Report ◽

Initial Symptoms ◽

Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Sclerotinia Blight Caused by Sclerotinia sclerotiorum on Peanut in Georgia

Plant Disease ◽

10.1094/pd-90-0111b ◽

2006 ◽

Vol 90 (1) ◽

pp. 111-111 ◽

Cited By ~ 5

Author(s):

J. E. Woodward ◽

T. B. Brenneman ◽

R. C. Kemerait ◽

A. K. Culbreath ◽

J. R. Clark

Keyword(s):

Fungal Pathogens ◽

Health Management ◽

Infected Plant ◽

First Report ◽

Small Water ◽

Plant Parts ◽

Sclerotinia Blight ◽

Initial Symptoms ◽

Symptomatic Tissue ◽

Lateral Branches

Sclerotinia blight is one of the most economically important diseases of peanut (Arachis hypogaea L.) in Oklahoma and Virginia. Yield losses of 10% are common in these areas; however, losses may exceed 50% in highly infested fields (1). While Sclerotinia minor is considered the primary causal agent, S. sclerotiorum may also incite the disease. Symptoms typically appear late in the season and are favored by cool temperatures and high relative humidity (RH). Initial symptoms include wilting and yellowing of main or lateral branches. Dense mats of white mycelium develop on diseased areas, and small water-soaked lesions are apparent near the soil line. Lesions become bleached and infected tissues have a shredded appearance. Sclerotia are produced on and inside infected plant parts (2). During October 2004, following a period of heavy rainfall and cool temperatures, peanut plants (cv. Tifrunner) with these symptoms were observed in a field near Surrency, GA. The field had been planted to cotton (Gossypium hirsutum L.) for many years and peanut was strip-tilled into a heavy rye (Secale cereale L.) cover. Disease foci were found throughout the field and final incidence was 20%. Stem sections were surface disinfested in 0.5% sodium hypochlorite for 1 min and plated on potato dextrose agar (PDA). Cultures of S. sclerotiorum (2) were recovered after incubation at 20°C for 2 weeks. Pathogenicity tests were conducted by inoculating wounded peanut mainstems with PDA plugs either with or without the fungus. Inoculation sites were wrapped with moistened cheesecloth, and plants were incubated in a dew chamber at 20°C and 95% RH. There were a total of four replications and the experiment was repeated once. Symptoms consistent with those observed in the field appeared after 3 days and lesion lengths were measured after 5 days. Average lesion lengths were 1.4 and 1.6 cm for cvs. Georgia Green and Tifrunner, respectively Controls remained symptomless. Sections of symptomatic tissue were plated on PDA, and S. sclerotiorum was reisolated from 100% of symptomatic tissue. Although S. sclerotiorum is a common pathogen of various winter crops and weeds found in the southeast, to our knowledge, this is a first report of Sclerotinia blight on peanut in the region. No other occurrences of the disease have been reported since the initial discovery; however, potential losses could be incurred if peanuts are planted in infested fields and harvest is delayed. References: (1) H. A. Melouk and P. A. Backman. Management of soilborne fungal pathogens. Pages 75–85 in: Peanut Health Management. H. A. Melouk and F. M. Shokes, eds. The American Phytopathologicial Society, St. Paul, MN, 1995. (2) D. M. Porter and H. A. Melouk. Sclerotinia blight. Pages 34–36 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathologicial Society, St. Paul, MN, 1997.

Download Full-text

First Report of Nigrospora Leaf Blight on Tea Caused by Nigrospora sphaerica in India

Plant Disease ◽

10.1094/pdis-05-14-0545-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 417-417 ◽

Cited By ~ 11

Author(s):

J. Dutta ◽

S. Gupta ◽

D. Thakur ◽

P. J. Handique

Keyword(s):

Camellia Sinensis ◽

West Bengal ◽

Morphological Characteristics ◽

Its Region ◽

Causative Organism ◽

Distilled Water ◽

Conidial Suspension ◽

Tea Leaves ◽

First Report ◽

Initial Symptoms

Tea [Camellia sinensis (L.) O. Kuntze] is an economically important non-alcoholic caffeine-containing beverage crop widely cultivated for leaves in India, especially in the Darjeeling district of West Bengal. In May 2012, distinct blight symptoms were observed on leaves of popular tea cultivars AV-2, Tukdah 78, Rungli Rungliot 17/144, and Bannockburn 157 in commercial tea estates of the Darjeeling district. This disease reduces yield and quality of the leaves. The initial symptoms were frequently observed on the young leaf margins and apices. Foliar symptoms are characterized by grayish to brown, semicircular or irregular shaped lesions, often surrounded by pale yellow zones up to 9 mm in diameter. The lesions later expand and the affected leaves turn grayish to dark brown and eventually the dried tissue falls, leading to complete defoliation of the plant. The disease causes damage to leaves of all ages and is severe in young leaves. A portion of the symptomatic leaf tissues were surface sterilized in 70% ethanol for 30 s, then in 2% NaClO for 3 min, rinsed three times in sterile distilled water, and plated onto potato dextrose agar (PDA). The fungal colonies were initially white and then became grayish to brown with sporulation. Conidia were spherical to sub spherical, single-celled, black, 19 to 21 μm in diameter, and were borne on a hyaline vesicle at the tip of each conidiophore. Morphological characteristics of the isolates were concurring to those of Nigrospora sphaerica (1). Moreover, the internal transcribed spacer (ITS) region of the ribosomal RNA was amplified by using primers ITS1 and ITS4 and sequenced (GenBank Accession No. KJ767520). The sequence was compared to the GenBank database through nucleotide BLAST search and the isolate showed 100% similarity to N. sphaerica (KC519729.1). On the basis of morphological characteristics and nucleotide homology, the isolate was identified as N. sphaerica. Koch's postulates were fulfilled in the laboratory on tea leaves inoculated with N. sphaerica conidial suspension (106 conidia ml−1) collected from a 7-day-old culture on PDA. Six inoculated 8-month-old seedlings of tea cultivars AV-2 and S.3/3 were incubated in a controlled environment chamber at 25°C and 80 to 85% humidity with a 12-h photoperiod. In addition, three plants of each cultivar were sprayed with sterile distilled water to serve as controls. Twelve to 14 days after inoculation, inoculated leaves developed blight symptoms similar to those observed on naturally infected tea leaves in the field. No symptoms were observed on the control leaves. The pathogen was re-isolated from lesions and its identity was confirmed by morphological characteristics. It was reported that N. sphaerica is frequently encountered as a secondary invader or as a saprophyte on many plant species and also as a causative organism of foliar disease on several hosts worldwide (2,3). To our knowledge, this is first report of N. sphaerica as a foliar pathogen of Camellia sinensis in Darjeeling, West Bengal, India, or worldwide. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ July 01, 2013. (3) E. R. Wright et al. Plant Dis. 92:171, 2008.

Download Full-text

First Report of Zonate Leaf Spot Caused by Hinomyces moricola on Japanese Hop in Korea

Plant Disease ◽

10.1094/pdis-01-13-0021-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1117-1117 ◽

Cited By ~ 1

Author(s):

S. E. Cho ◽

J. H. Park ◽

S. H. Hong ◽

H. D. Shin

Keyword(s):

Its Region ◽

The United States ◽

Infected Leaf ◽

Invasive Weed ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms ◽

Wide Range ◽

Humulus Japonicus

Japanese hop (Humulus japonicus Siebold & Zucc. = H. scandens (Lour.) Merr.), native to East Asia, is an annual, climbing or trailing vine. The vines can spread to cover large areas of open ground or low vegetation, eventually blanketing the land and vegetation. Pollen of H. japonicus is allergenic, and this species is considered as one of the important causes of pollinosis in Korea and China. It is a notorious invasive weed in the United States and also in France, Hungary, and Italy (1). In September 2012, zonate leaf spots were observed on Japanese hops growing in wetlands in Yeongdong County of Korea. A voucher specimen was preserved in the Korea University Herbarium (KUS-F26901). Initial symptoms included grayish-green to grayish-brown spots without border lines. As the lesions enlarged, they coalesced, leading to leaf blight. Sporophores on the leaf lesions were dominantly hypophyllous, rarely epiphyllous, solitary, erect, easily detachable, and as long as 700 μm. The upper portion of the sporophores consisted of a pyramidal head was ventricose, 320 to 520 μm long and 110 to 150 μm wide. The fungus was isolated from leaf lesions and maintained on potato dextrose agar (PDA). Sclerotia were produced on PDA after 4 to 5 weeks at 18°C without light, but conidia were not observed in culture. These morphological and cultural characteristics were consistent with those of Hinomyces moricola (I. Hino) Narumi-Saito & Y. Harada (= Cristulariella moricola (I. Hino) Redhead) (3,4). An isolate was preserved in the Korean Agricultural Culture Collection (Accession No. KACC46955). Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequence of 452 bp was deposited in GenBank (Accession No. KC460209). A BLAST search in GenBank revealed that the sequence showed an exact match with those of C. moricola (JQ036181 ex Acer negundo and JQ036182 ex Glycine max). To determine the pathogenicity of the fungus, according to the procedure of Cho et al. (2), sporophores with the pyramidal head were carefully detached from a lesion on the naturally infected leaf using a needle. Each sporophore was transferred individually onto five places of four detached healthy leaves. The leaves were placed in dew chambers and incubated at 16°C. Symptoms were observed after 2 days on all inoculated leaves. A number of sporophores and immature sclerotia which were morphologically identical to the ones observed in the field were formed on the abaxial surface of the leaf 2 weeks after inoculation. The pathogen was reisolated from lesions on the inoculated leaves, confirming Koch's postulates. No symptoms were observed on the control leaves kept in humid chambers for 2 weeks. H. moricola was known to cause zonate leaf spots and defoliation on a wide range of woody and annual plants (3). To the best of our knowledge, this is the first report of Hinomyces infection on Japanese hops in Korea. References: (1) Anonymous. Humulus japonicus (Cannabaceae): Japanese hop. Eur. Medit. Plant Prot. Org. (EPPO). 2012. (2) S. E. Cho et al. Plant Dis. 96:906, 2012. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved December 8, 2012. (4) S. A. Redhead. Can. J. Bot. 53:700, 1975.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Podosphaera aphanis Causing Powdery Mildew on Wild Blackberry Species (Rubus spp.) in Mexico

Plant Disease ◽

10.1094/pdis-05-21-0932-pdn ◽

2021 ◽

Author(s):

Alma Rosa Solano-Báez ◽

Santos Gerardo Leyva-Mir ◽

Moises Camacho-Tapia ◽

Alfonso Arellano Victoria ◽

Geremias Rodríguez-Bautista ◽

...

Keyword(s):

Phylogenetic Analysis ◽

Powdery Mildew ◽

Primary Source ◽

Morphological Characters ◽

Morphological Data ◽

Wild Populations ◽

First Report ◽

Voucher Specimens ◽

New Varieties ◽

Germ Tubes

Wild blackberry species (Rubus spp. L.; Rosaceae) represents an invaluable source of genes for the generation of new varieties, but also serve as a primary source of disease inoculum. During April of 2020, symptoms of powdery mildew were observed on four populations of wild blackberry species located in the states of Chiapas (16°59'11"N, 92°59'07"W; 16°47'08"N, 92°31'05"W) and Michoacán (19°37'17"N, 100°08'59"W; 19°29'25"N, 101°32'54"W), Mexico. Signs of the pathogen were white powdery masses mainly on the top of new shoots. Symptoms included yellowing, necrosis, and early defoliation of the plants. Hyphae were tin-walled, hyaline, smooth, and 4.0–9.0 mm wide. Appressoria were indistinct -to- nipple-shaped. Conidiophores (n=30, 75–225 × 10.5–13.5 μm) were straight, and unbranched with cylindrical foot cells (n=30, 31.5–158 × 8–13.5 μm), straight, somewhat widening upwards, followed by 1–3 shorter cells. Conidia (n=100; 25.5–38.5 × 9.5–22.5 μm) were catenulate, ellipsoid-ovoid -to- doliiform, containing fibrosin bodies (in 3% KOH). Germ tubes (n=30, 13.5–40.5 × 4.5 μm) emerged laterally, and were unbranched with slightly swollen tips. Chasmothecia were not found. Morphological characters of the fungus in all samples corresponded to the previous descriptions of Podosphaera aphanis by Braun and Cook (2012) and Stevanovi´c et al. (2020). Voucher specimens were deposited in the Department of Agricultural Parasitology Herbarium at the Chapingo Autonomous University under accessions UACH421, UACH423, UACH425, UACH426. To confirm the species identification, the internal transcribed spacer (ITS) of one sample was amplified using the primers ITS5 (White et al. 1990) and P3 (Kusaba and Tsuge, 1995) and sequenced. The sequence was deposited in GenBank (accession number MW988591). A phylogenetic analysis using Bayesian inference and maximum likelihood was performed (Hernández-Restrepo et al. 2018) and included other Podosphaera species (Takamatsu et al. 2010). The sequence from the isolate UACH426 clustered with the strain MUMH1871 of P. aphanis forming a definite clade and remained as a sister taxon of P. pannosa. Pathogenicity was verified through inoculation by gently dusting conidia from one powdery mildew patch onto leaves of five healthy blackberry plants of each specie. The same number of noninoculated plants served as controls. All plants were maintained in a greenhouse at 25–30°C with 75% relative humidity. All inoculated plants developed powdery mildew symptoms after 12 days, whereas no symptoms were observed on noninoculated plants. The fungus recovered from the inoculated plants was morphologically identical to that originally observed on diseased blackberry plants, demonstrating the pathogenicity of the fungus. Based on morphological data and phylogenetic analysis, the fungus was identified as P. aphanis. This fungus has been reported to cause powdery mildew on blackberry plants in Serbia (Stevanovi´c et al. 2020). This is the first report of P. aphanis causing powdery mildew on wild backberry species in Mexico according to Farr and Rossman (2021). The primary source of inoculum of powdery mildew for commercial plantings is wild blackberry plants from noncultivated areas and may warrant control of wild populations.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera xanthii on Calendula officinalis in Italy

Plant Disease ◽

10.1094/pdis-92-1-0174c ◽

2008 ◽

Vol 92 (1) ◽

pp. 174-174 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

M. L. Gullino

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Pathogenicity Test ◽

Podosphaera Xanthii ◽

Calendula Officinalis ◽

First Report ◽

Potted Plants ◽

Blastn Analysis ◽

Voucher Specimens ◽

Pot Marigold

Calendula officinalis L. (Asteraceae) (pot marigold or English marigold) is an ornamental species grown in gardens and as potted plants for the production of cut flower. It was also used in ancient Greek, Roman, Arabic, and Indian cultures as a medicinal herb as well as a dye for fabrics, foods, and cosmetics. During the summer of 2007, severe outbreaks of a previously unknown powdery mildew were observed on plants in several gardens near Biella (northern Italy). Both surfaces of leaves of infected plants were covered with dense, white mycelia and conidia. As the disease progressed, infected leaves turned yellow and died. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, born in short chains (four to six conidia per chain), and measured 27.0 to 32.1 (31.4) × 12.9 to 18.4 (18.2) μm. Conidiophores measured 49 to 77.3 (67.2) × 8 to 13.3 (10.8) μm and showed a foot cell measuring 44 to 59 (51.9) × 9.3 to 12.6 (11.3) μm followed by one shorter cell measuring 15.6 to 18.9 (17.6) × 10.4 to 13.6 (12.2) μm. Fibrosin bodies were present. Chasmothecia were spherical, amber colored, with a diameter of 89 to 100 (94.5) μm. Each chasmothecium contained one ascus with eight ascospores. On the basis of its morphology, the causal agent was determined to be a Podosphaera sp. (2). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 588 bp showed a 100% homology with the sequence of Podosphaera xanthii (2). The nucleotide sequence has been assigned GenBank Accession No. EU100973. Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy C. officinalis plants. Five plants were inoculated. Five noninoculated plants served as control. Plants were maintained in a greenhouse at temperatures ranging from 20 to 26°C. Eleven days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on C. officinalis in Italy. C. officinalis was previously described as a host to Sphaerotheca fuliginea (synonym S. fusca) in Great Britain (4) as well as in Romania (3). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (3) E. Eliade. Rev. Appl. Mycol. 39:710, 1960. (4) F. J. Moore. Rev. Appl. Mycol. 32:380, 1953.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces cichoracearum on English Daisy (Bellis perennis) in Italy

Plant Disease ◽

10.1094/pdis-92-3-0484a ◽

2008 ◽

Vol 92 (3) ◽

pp. 484-484 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

A. Minuto ◽

M. L. Gullino

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Northern Italy ◽

Flowering Plant ◽

Pathogenicity Test ◽

First Report ◽

Golovinomyces Cichoracearum ◽

Blastn Analysis ◽

Commercial Farms ◽

Voucher Specimens

Bellis perennis (English daisy) is a flowering plant belonging to the Asteraceae and is increasingly grown as a potted plant in Liguria (northern Italy). In February 2007, severe outbreaks of a previously unknown powdery mildew were observed on plants in commercial farms at Albenga (northern Italy). Both surfaces of leaves of affected plants were covered with white mycelia and conidia. As the disease progressed, infected leaves turned yellow. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, borne in chains (as many as three conidia per chain), and measured 27.7 × 16.9 (15.0 to 45.0 × 10.0 to 30.0) μm. Conidiophores measured 114.0 × 12.0 (109.0 to 117.0 × 11.0 to 13.0) μm and showed a foot cell measuring 78.0 × 11.0 (72.0 to 80.0 × 11.0 to 12.0) μm followed by two shorter cells. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 415 bp obtained showed an E-value of 7e–155 with Golovinomyces cichoracearum (3). The nucleotide sequence has been assigned the GenBank Accession No. AB077627.1 Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy B. perennis plants. Twenty plants were inoculated. Fifteen noninoculated plants served as a control. Plants were maintained in a greenhouse at temperatures ranging from 10 to 30°C. Seven days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. The fungus observed on inoculated plants was morphologically identical to that originally observed. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on B. perennis in Italy. The disease was already reported in other European countries (2). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) U. Braun The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (3) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000.

Download Full-text