First Report of Natural Infection of Greenhouse-Grown Tomato and Weed Species by Pelargonium zonate spot virus in Spain

Tomato (Lycopersicon esculentum Mill.) plants showing severe chlorotic and necrotic ringspots, line patterns on leaves, and concentric chlorotic ringspots on stems and fruits were observed in plastic greenhouse-grown tomato crops cv. Royesta during the spring of 1996 in Zaragoza province, Northeast Spain. Symptoms were similar to those associated with Pelargonium zonate spot virus (PZSV) infection on tomato in Italy (1,2). The causal agent was mechanically transmitted from leaf, fruit, and stem samples to several indicator species. The following host reactions were recorded: chlorotic local lesions on Chenopodium amaranticolor, C. quinoa, Cucumis sativus, and Cucurbita pepo, and systemic reactions, sometimes associated with localized reactions, on Capsicum annuum ‘Doux des Landes’ and ‘Yolo Wonder’, Datura stramonium, Gomphrena globosa, Nicotiana clevelandii, N. glutinosa, N. megalosiphon, N. rustica, N. sylvestris, N. tabacum ‘Paraguay’, ‘Samsun’, and ‘Xanthi nc’, Ocimum basilicum, Petunia hybrida, Physalis floridana, Solanum melongena, and Vigna unguiculata. Symptoms obtained in indicator species were erratic. During the spring of 1999, naturally occurring symptoms appeared again on tomato plants, cultivars Royesta and Bond, growing in greenhouses in the same area. Positive serological reactions with the enzyme-linked immunosorbent assay (ELISA) using a commercial PZSV antiserum (Agdia Inc.), developed against an Italian isolate of PZSV, were obtained with extracts from leaves, stems, and fruits of tomato plants naturally infected (1999) and from systemically infected indicator species mechanically inoculated with sap from tomato samples (1996 and 1999). Serological results were confirmed by molecular hybridization analysis using a PZSV-specific riboprobe (D. Gallitelli, personal communication). Some of the weeds growing around the greenhouses (Capsella bursa-pastoris, Diplotaxis erucoides, Picris echioides, and Sonchus oleraceus) also tested positive for PZSV (A405nm values greater than three times that of healthy plants). However, other weed species such as Anacyclus tomentosus, Beta maritima, Cardaria draba, Malva sylvestris, Medicago sp., Polygonum aviculare, Rumex sp., and Sisymbrium irio tested negative, while results from tests on Borago officinalis, Bromus rigidus, and Convolvulus arvensis were inconclusive. Symptoms like those of naturally infected tomato plants were reproduced by mechanically inoculating tomato seedlings with sap from PZSV-infected tobacco (Nicotiana glutinosa and N. tabacum ‘Paraguay’) or from Physalis floridana plants. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) C. Vovlas et al. Inform. Fitopatol. 2:39, 1986.

Download Full-text

Natural Infection of Field-Grown Borage (Borago officinalis) by Alfalfa mosaic virus in Spain

Plant Disease ◽

10.1094/pdis.2002.86.6.698a ◽

2002 ◽

Vol 86 (6) ◽

pp. 698-698 ◽

Cited By ~ 2

Author(s):

C. Mallor ◽

M. Luis-Arteaga ◽

M. A. Cambra ◽

S. Fernández-Cavada

Keyword(s):

Mosaic Virus ◽

Indicator Species ◽

Natural Infection ◽

Alfalfa Mosaic Virus ◽

Solanum Melongena ◽

Enzyme Linked Immunosorbent Assay ◽

Human Consumption ◽

Vegetable Crops ◽

Borago Officinalis ◽

Local Lesions

Alfalfa mosaic virus (AMV) has a wide host range and is distributed throughout the world. It causes disease in several vegetable crops, including bean, celery, lettuce, pea, pepper, and tomato (1). In Spain, it has been found naturally infecting alfalfa, pepper, and tomato. During the autumn of 1999, in the area of Zaragoza (northeastern Spain), several plants expressing foliar yellow mosaic symptoms were observed in borage grown for human consumption in open field plots. The commercial value of the symptomatic plants was greatly reduced. The symptoms were similar to those previously obtained in greenhouse-grown borage plants mechanically inoculated with three tomato isolates of AMV (2). The following indicator species, including virus-free borage plants, were mechanically inoculated with sap from leaves of symptomatic borage plants, and reactions were recorded: chlorotic and necrotic local lesions on Tetragonia expansa and Vigna unguiculata; chlorotic local lesions and systemic mosaic on Chenopodium quinoa, C. amaranticolor, Cucumis sativus ‘Marketmore’, Gomphrena globosa, and Nicotiana glutinosa; systemic mosaic, sometimes associated with localized reactions, on Ocimum basilicum, Capsicum annuum ‘Doux des Landes’ and ‘Yolo Wonder’, N. benthamiana, N. clevelandii, N. rustica, N. sylvestris, N. tabacum ‘Paraguay’ and ‘Xanthi nc’, Petunia hybrida, Physalis floridana, and Solanum melongena ‘Cerna krazavitska’. The reactions are in agreement with the indicator host reactions described for AMV (1). Symptoms on virus-free borage plants mechanically inoculated with sap from symptomatic borage and from inoculated C. amaranticolor and O. basilicum experimental hosts were similar to those observed in naturally infected borage. Positive serological reactions (A405 values more than three times greater than those of the negative controls) in double-antibody sandwich enzyme-linked immunosorbent assay using commercially prepared antiserum against AMV (Agdia, Inc., Elkhart, IN) were obtained with extracts of naturally infected borage leaves and with systemically infected indicator species. Alfalfa plots located in the vicinity of the symptomatic borage plants could be the source of virus for borage infections. To our knowledge, this is the first report of natural AMV infection in Borago spp. References: (1) E. M. J. Jaspars and L. Bos. CMI/AAB. No. 229, 1980. (2) M. Luis-Arteaga and J. M. Alvarez. Inf. Téc. Econ. Agr. 92:70, 1996.

Download Full-text

First Report of an Isolate of Pelargonium zonate spot virus in Commercial Glasshouse Tomato Crops in Southeastern France

Plant Disease ◽

10.1094/pdis.2002.86.9.1052c ◽

2002 ◽

Vol 86 (9) ◽

pp. 1052-1052 ◽

Cited By ~ 8

Author(s):

K. Gebre-Selassie ◽

B. Delecolle ◽

P. Gognalons ◽

O. Dufour ◽

C. Gros ◽

...

Keyword(s):

Type Strain ◽

Datura Stramonium ◽

Enzyme Linked Immunosorbent Assay ◽

Fresh Market ◽

Spot Virus ◽

Chenopodium Amaranticolor ◽

Mesophyll Cells ◽

Mediterranean Countries ◽

Field Samples ◽

Systemic Symptoms

In summer 2000, symptoms similar to Pelargonium zonate spot virus (PZSV) were observed for the first time on tomato plants in southeastern France. The plants were from commercial glasshouse fresh-market crops. Symptoms observed were chlorotic mottling with bright yellow distinct rings on leaves and curved line patterns on stems. Fruit symptoms included chlorotic and necrotic spotting, marked concentric ring patterns, and distortions. Diagnosis was made from symptomatic leaves and fruits by mechanical inoculation on a set of host plants. Local chlorotic and necrotic lesions were observed on Chenopodium amaranticolor, C. quinoa, Cucumis sativus cv. Marketer, Cucumis melo cv. Vedrantais, Phaseolus vulgaris cv. Pinto, Vicia faba cv. D'Aguadulce, Vigna unguiculata cv. Black Eye, and systemic symptoms were observed on Capsicum annuum cvs. Yolo Wonder, Yolo Y, Florida VR2, and Criollo de Morelos 334, Datura stramonium, Lycopersicon esculentum cvs. Momor and Stevens, L. hirsutum (PI 134417 and PI 247087), Nicotiana benthamiana, N. clevelandii, N. tabacum cv. Xanthi nc, Ocimum basilicum cv. Latino, Petunia hybrida cv. Rose du ciel, and Physalis floridana. No reaction was observed on Pisum sativum cv. Douce Provence, Salvia splendens cv. Etna, or Zinnia elegans cv. Liliput. Symptoms on tomato of PZSV, Parietaria mottle virus (PMoV), and Tomato spotted wilt virus (TSWV) are similar, particularly those elicited in fruits. Therefore, the field samples were checked using double-antibody sandwich enzyme-linked immunosorbent assay against antisera of the type-strain of PZSV and tomato strain of PMoV and their homologous antigenes, which were supplied by D. Gallitelli and P. Roggero respectively, and our antiserum of TSWV. Electron microscopy of negatively stained preparations from leaves of tomato and D. stramonium showed that the sap contained very few paraspheric shaped particles, 26 to 29 nm in diameter. Three isolates collected from two different regions (Vaucluse and Bouches du Rhône) showed a very close serological relationship with the Italian type-strain of PZSV and tested negative against antisera of PMoV and TSWV. The French isolates were biologically different from the type-strain, but were similar to the Spanish strain of PZSV because they infected D. stramonium, N. benthamiana, O. basilicum, and V. unguiculata (2). Moreover, in transverse tissue sections, virions were not observed in the nucleus and tubular structures, unlike the Italian isolates, (1) but were present in the cytoplasm and particularly in the mesophyll cells. There are only a few records of the occurrence and distribution of PZSV in Mediterranean countries. References: (1) M. A Castellano and G. P Martelli. Phytopathol. Mediterr. 20:64, 1981. (2) M. Luis-Arteaga. Plant Dis. 84:807, 2000.

Download Full-text

First Report of Pepino mosaic virus on Tomato in Spain

Plant Disease ◽

10.1094/pdis.2001.85.12.1292c ◽

2001 ◽

Vol 85 (12) ◽

pp. 1292-1292 ◽

Cited By ~ 5

Author(s):

C. Jordá ◽

A. Lázaro Pérez ◽

P. Martínez-Culebras ◽

P. Abad ◽

A. Lacasa ◽

...

Keyword(s):

Mosaic Virus ◽

Canary Islands ◽

Plant Protection ◽

Polyclonal Antibodies ◽

Datura Stramonium ◽

Enzyme Linked Immunosorbent Assay ◽

Chenopodium Amaranticolor ◽

Pepino Mosaic Virus ◽

Tomato Plants ◽

First Report

At the beginning of 2000, a damaging disease developed on protected tomato (Lycopersicon esculentum) crops grown in polyethylene greenhouses in different regions of Spain. Production losses were estimated at 15 to 80%. The tomato plants showed a variety of symptoms. The most common symptoms were leaf distortion, chlorosis, and mosaic. Some plants showed a dark green mosaic and bubbling of the leaf surface. Green striations were also observed on the stem and sepals. Most of the diseased plants had discolored fruits. Symptoms decreased as environmental temperature increased. The involvement of Pepino mosaic virus (PepMV) was suspected. To identify the etiological agent, ≈500 symptomatic tomato plants were collected from several locations in Alicante, Murcia, Almeria and the Canary Islands. Flexuous viral particles 510 nm long were observed by transmission electron microscopy, suggesting the presence of a potexvirus in the tissue extracts analyzed. All samples were tested by ELISA (enzyme-linked immunosorbent assay), using polyclonal antibodies to Narcissus mosaic virus (Adgen, Auchincriuve, Scotland), a virus serologically related to PepMV, and two antisera specific to PepMV (Adgen, Scotland and DMSZ, Braunschweig, Germany). PepMV was detected in 35% of the samples. Like PepMV, the virus infected (as confirmed by ELISA) greenhouse-grown Datura stramonium, Nicandra physalodes, Nicotiana benthamiana, N. clevelandii, Solanum tuberosum, and Vigna sinensis and did not infect Capsicum anuum, Cucumis sativus, Chenopodium amaranticolor, C. quinoa, Petunia × hybrida, Phaseolus vulgaris, Physalis floridana, N. glutinosa, N. rustica, or N. tabacum. The virus did infect Gomphrena globosa, which normally is not infected by PepMV. The first report of PepMV was on pepino (Solanum muricatum) in Peru in 1974 (1), but this virus has been recently reported in the Netherlands, England, Germany, and France on protected tomato crops (2). To our knowledge, this is the first report of PepMV in Spain, including the Canary Islands. References: (1) R. A. C. Jones et al. Ann. Appl. Biol. 94:61, 1980. (2) European and Mediterranean Plant Protection Organisation (EPPO). Alert List Viruses. On-line publication/2000/003.

Download Full-text

Effect of Stage of Growth on Metribuzin Tolerance

Weed Science ◽

10.1017/s0043174500063050 ◽

1976 ◽

Vol 24 (6) ◽

pp. 612-615 ◽

Cited By ~ 12

Author(s):

J.F. da Silva ◽

G.F. Warren

Keyword(s):

Chenopodium Album ◽

Solanum Melongena ◽

Datura Stramonium ◽

Amaranthus Retroflexus ◽

Weed Species ◽

Tomato Plants ◽

True Leaf ◽

Resistant Species ◽

Polygonum Lapathifolium ◽

Common Purslane

Six species of Solanaceae including tomato (Lycopersicon esculentumMill ‘Campbell 28′) were sprayed in the greenhouse at weekly intervals for 4 weeks starting when tomato plants had one true leaf. All species gained tolerance to metribuzin [4-amino-6-tert-butyl-3-(methylthio)-as-triazine-5(4H)one] with age but tomato and black nightshade (Solarium nigrumL.) were the most tolerant and gained tolerance fastest with age. Jimsonweed (Datura stramoniumL.) and eggplant (Solanum melongenaL. ‘Black Beauty’) were the most susceptible species and the ones that gained least tolerance with age. Potato (Solanum tuberosumL.) from true seeds and pepper (Capsicum annuumL. ‘Yolo wonder’) were intermediate in tolerance. In the field, tomato and nine weed species planted in separate plots and kept free from competition were sprayed at weekly intervals starting when tomato plants had one true leaf. Tomato, large crabgrass (Digitaria sanguinales(L.) Scop.), ivyleaf morningglory (Ipomoea hederaceae(L.) Jacq.) and yellow foxtail (Setaria glauca(L.) Beauv.) were the most resistant species to metribuzin and the ones that gained tolerance fastest with age. The most susceptible weeds were velvetleaf (Abutilon theophrastiMedic), common purslane (Portulaca oleraceaL.), pale smartweed (Polygonum lapathifoliumL.), redroot pigweed (Amaranthus retroflexusL.), common lambsquarters (Chenopodium albumL.), and jimsonweed. Low amounts of sunlight during the 3 days before spraying greatly reduced the resistance of tomato to metribuzin.

Download Full-text

Occurrence of Tospoviruses in Ornamental and Weed Species in Markazi and Tehran Provinces in Iran

Plant Disease ◽

10.1094/pd-89-0425 ◽

2005 ◽

Vol 89 (4) ◽

pp. 425-429 ◽

Cited By ~ 51

Author(s):

T. Ghotbi ◽

N. Shahraeen ◽

S. Winter

Keyword(s):

Polyclonal Antibodies ◽

Sandwich Elisa ◽

Impatiens Necrotic Spot Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Weed Species ◽

Spot Virus ◽

Chlorotic Spot ◽

Ornamental Crops ◽

Plant Sampling ◽

Wilt Virus

Damage to agricultural crops by tospoviruses has occurred sporadically in Iran in the past; however, since 2000, outbreaks of tospoviruses have been recorded every year. The most affected ornamental crops were surveyed in two main cultivation areas in provinces of Markazi (Mahallat) and Tehran in 2000-01 and 2001-02. A few weed species also were collected. In all, 513 samples (with or without any conspicuous virus symptoms) were collected and analyzed by double- and triple-antibody sandwich enzyme-linked immunosorbent assay (ELISA) with polyclonal antibodies to Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), and Tomato Varamin virus (ToVV), a new Tospovirus sp. from Iran. These viruses frequently were detected in samples of many different ornamentals and often in mixed infections, whereas Iris yellow spot virus (IYSV) was detected in only four samples. ToVV also was found in weeds growing in Chrysanthemum fields and in a Cuscuta sp. Applying double-antibody sandwich ELISA, no positive reactions were found with Tomato chlorotic spot virus (TCSV). Of the total of 513 samples tested, 345 samples did not react with any Tospovirus antisera. In Tehran, INSV was identified in 21 samples (10%), IYSV in 4 samples (2%), TSWV in 16 samples (8%), and ToVV in 22 samples (11%). In Markazi province, INSV was identified in 24 samples (8%), IYSV in 1 sample (0.5%), TSWV in 40 samples (13%), and ToVV in 36 samples (12%). ToVV was found to prevail in Tehran province and TSWV in Markazi. Thrips spp. present at the plant sampling sites also were collected and identified.

Download Full-text

First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain

Plant Disease ◽

10.1094/pdis-93-12-1346b ◽

2009 ◽

Vol 93 (12) ◽

pp. 1346-1346 ◽

Cited By ~ 4

Author(s):

F. Escriu ◽

M. A. Cambra ◽

M. Luis-Arteaga

Keyword(s):

Indicator Species ◽

The United States ◽

Natural Host ◽

Spot Virus ◽

Tomato Plants ◽

First Report ◽

Systemic Symptoms ◽

Line Patterns ◽

Das Elisa ◽

Pepper Plants

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2). In Spain, PZSV was first detected in 1996 in tomato plants of cv. Royesta from greenhouses in Zaragoza Province (3) and subsequently in tomato in the Catalonia and Navarra areas. In April 2006, symptoms of PZSV were found at high incidence on tomato in a greenhouse in Huesca, Aragón (northeastern Spain). Randomly distributed pepper plants (Capsicum annuum L.) of cv. Estilo F1 growing in the same greenhouse showed severe foliar chlorotic ringspots and line patterns similar to those observed in tomato. Samples from symptomatic peppers and tomatoes and one asymptomatic weed of Rubia tinctorum L. tested positive by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against PZSV (Agdia Inc., Elkhart, IN and DSMZ, Braunschweig, Germany) as did a Spanish PZSV isolate used as a positive control (3). Sap extracts from two tomatoes, three peppers, and the single R. tinctorum plant were mechanically inoculated to 22 indicator species, including pepper and tomato. On 17 of 22 species inoculated, sap from symptomatic tomatoes and peppers elicited local or systemic symptoms similar to those reported earlier for PZSV isolates (3). Systemic symptoms were mainly mosaic, chlorotic, and necrotic line patterns and ringspots on leaves of most indicator species, closely resembling those observed on the greenhouse pepper and tomato plants. Symptoms on inoculated tomatoes also included stem necrosis and death. Reactions of indicator species did not indicate the presence of any other pepper- or tomato-infecting viruses. Both field infected and mechanically inoculated plants of pepper cvs. Yolo Wonder and Doux des Landes were maintained in the greenhouse until the development of fruit symptoms. Only fruits of cv. Yolo Wonder showed dark green and slightly depressed circles on their surface. Local and systemic infection by PZSV was confirmed by DAS-ELISA in most inoculated plants. Total RNA from leaves of field or inoculated plants was used as template for amplification by reverse transcription (RT)-PCR with primers R3-F and R3-R that are specific for the PZSV 3a gene (2), and amplicons were sequenced directly. The sequences of 697 nt from pepper and tomato isolates from the same greenhouse were identical (GenBank Accession Nos. CQ178217 and CQ178216, respectively) and had 96.1% identity to nucleotides 384 to 1,080 in PZSV RNA-3 (NC_003651). Our results confirm the natural infection of pepper plants in Huesca by PZSV. To our knowledge, this is the first report of pepper as a natural host for PZSV, a significant finding considering the potential risks of PZSV dispersion whenever tomato and pepper coexist, particularly in greenhouses and nurseries. References: (1) M. Finetti-Sialer and D. Gallitelli. J. Gen. Virol. 84:3143, 2003. (2) H. Y. Liu and J. L. Sears. Plant Dis. 91:633, 2007. (3) M. Luis-Arteaga and M. A. Cambra. Plant Dis. 84:807, 2000.

Download Full-text

First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽

10.1094/pdis-91-5-0633b ◽

2007 ◽

Vol 91 (5) ◽

pp. 633-633 ◽

Cited By ~ 8

Author(s):

H.-Y. Liu ◽

J. L. Sears

Keyword(s):

United States ◽

The United States ◽

Rt Pcr ◽

Spot Virus ◽

Chenopodium Amaranticolor ◽

Tomato Plants ◽

First Report ◽

Chenopodium Murale ◽

Tomato Field ◽

Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Download Full-text

Sources of Iris yellow spot virus in New York

Plant Disease ◽

10.1094/pdis-05-10-0353 ◽

2011 ◽

Vol 95 (6) ◽

pp. 735-743 ◽

Cited By ~ 12

Author(s):

Cynthia L. Hsu ◽

Christine A. Hoepting ◽

Marc Fuchs ◽

Erik A. Smith ◽

Brian A. Nault

Keyword(s):

New York ◽

Host Plants ◽

New York State ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Enzyme Linked Immunosorbent Assay ◽

Molecular Testing ◽

Weed Species ◽

Spot Virus ◽

Rumex Crispus

Iris yellow spot virus (IYSV) has been found consistently in commercial dry bulb onion fields throughout New York State since 2006. Yearly recurrence of IYSV may result from annual reintroductions of the virus or persistence of the virus in overwintering host plants. To identify potential sources of IYSV, we surveyed onion transplants imported into New York as well as volunteer onion plants and weeds using a double-antibody sandwich enzyme-linked immunosorbent assay. IYSV was not found in any of 1,097 transplant samples tested in 2007 but 4 of 760 (0.53%) transplant samples tested positive in 2008. IYSV was found in volunteer onion plants in 3 of 10 (30%) onion fields sampled in 2007, in 4 of 27 (15%) onion fields sampled in 2008, and in 6 of 12 (50%) onion cull piles sampled in 2008. In all, 4 of 17 weed species (i.e., chicory [Cichorium intybus], common burdock [Arctium minus], curly dock [Rumex crispus], and dandelion [Taraxacum officinale]), were confirmed to be infected with IYSV using serological and molecular testing methods. IYSV may be reintroduced annually into New York through imported onion transplants but it also persists in volunteer onion plants and selected weed species.

Download Full-text

First Report of Broad bean wilt virus on Thyme (Thymus vulgaris L.)

Plant Disease ◽

10.1094/pdis.2001.85.1.99b ◽

2001 ◽

Vol 85 (1) ◽

pp. 99-99 ◽

Cited By ~ 3

Author(s):

M. G. Bellardi ◽

C. Rubies-Autonell

Keyword(s):

Broad Bean ◽

Protein A ◽

Enzyme Linked Immunosorbent Assay ◽

Thymus Vulgaris ◽

Chenopodium Amaranticolor ◽

Borago Officinalis ◽

First Report ◽

Chlorotic Mottle ◽

Wilt Virus ◽

Broad Bean Wilt Virus

In the spring and summer of 1998, a severe virus-like disease consisting of chlorotic mottle on leaves, yellowing, and stunting was observed at the Giardino delle Erbe of Casola-Valsenio (Emila-Romagna region, northern Italy). Most of the symptomatic plants were infected with a filamentous virus that was not identified. Moreover, one thyme plant showing yellow leaves was also found infected by an isometric virus, the identity of which was established by the following host reactions and serological assay. It was mechanically transmitted to 33 species belonging to 11 botanical families. All the Chenopodiaceae (Chenopodium amaranticolor Coste et Reyn., C. murale L., C. foliosum Ash., and C. quinoa Willd.) tested showed local and systemic symptoms in 3 to 4 days; among Leguminosae, broad bean (Vicia faba L.) showed necrotic local lesions and wilt. Virus particles reacted in protein A sandwich-enzyme-linked immunosorbent assay with the antiserum to Broad bean wilt virus (BBWV), serotype I (supplied from the Istituto di Fitovirologia Applicata, CNR, Turin, Italy). BBWV in the field was in all probability transmitted to thyme by aphids from weeds and/or other medicinal and aromatic species cultivated in the same herb garden, all recently shown to be hosts for BBWV: Polygonum fagopyrum L., Hedisarum coronarium L., Borago officinalis L., Phytolacca Americana L., Digitalis lanata Ehrh., and D. purpurea L. (1). This is the first report of BBWV in T. vulgaris and demonstrates that it is more prevalent in Italy than previously reported. References: (1) C. Rubies-Autonell and M. G. Bellardi. 1999. 7th International Plant Virus Epidemiology Symposium, Aguadulce, Spain.

Download Full-text

Wild Allium spp. as Natural Hosts of Iris yellow spot virus

Plant Disease ◽

10.1094/pd-90-0378a ◽

2006 ◽

Vol 90 (3) ◽

pp. 378-378 ◽

Cited By ~ 7

Author(s):

H. R. Pappu ◽

B. C. Hellier ◽

F. M. Dugan

Keyword(s):

Natural Infection ◽

The State ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Spot Virus ◽

Sequence Comparisons

The incidence of Iris yellow spot virus (IYSV) of genus Tospovirus, family Bunyaviridae in a commercial onion crop was first confirmed in Washington state during 2003 (1). First found in Adams County, IYSV has rapidly spread to all onion-producing counties in the state, affecting seed and bulb crops. The USDA-ARS Western Regional Plant Introduction Station (WRPIS) collects, maintains, and distributes various Allium (garlic and onion) accessions. As part of the regeneration process, accessions are grown under field conditions at the WRPIS farms in two locations: Pullman and Central Ferry, WA. Symptoms indicative of viral infection, now known to be caused by IYSV, first appeared in field-grown accessions in 1999. In June 2005, leaf and scape tissues were collected from WRPIS accessions of wild onions (Allium pskemense, A. vavilovii, and A. altaicum) in Central Ferry that had symptoms indicative of IYSV infection (2). IYSV infection was confirmed using enzyme-linked immunosorbent assay with a commercially available kit (Agdia Inc., Elkhart, IN). Virus infection was further verified using reverse transcription-polymerase chain reaction (RT-PCR) with primers derived from the small (S) RNA of IYSV. The primers flanked the IYSV N gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′). RT-PCR gave a PCR product of expected size (≈1.2 kb). The DNA amplicon was cloned and sequenced. Nucleotide sequence comparisons with known IYSV N gene sequences showed 95 to 98% sequence identity. The prevalence of the vector, onion thrips (Thrips tabaci), combined with the widespread incidence of IYSV in seed and bulb production areas of the state may have resulted in natural infection of wild relatives of cultivated onion. The potential role of wild Allium spp. in IYSV epidemiology remains to be determined. Information on the extent of IYSV infection of onion germplasm would be useful in identifying potential sources of host plant resistance to IYSV. References: (1) L. J. du Toit et al. Plant Dis. 88:222, 2004. (2) B. Hellier et al. APSnet Image of the Week. Online publication, iw000049.asp, 2004.

Download Full-text