A conserved SUMO-Ubiquitin pathway directed by RNF4/SLX5-SLX8 and PIAS4/SIZ1 drives proteasomal degradation of topoisomerase DNA-protein crosslinks

SUMMARYTopoisomerase cleavage complexes (TOPccs) can be stalled physiologically and by the anticancer drugs camptothecins (TOP1 inhibitors) and etoposide (TOP2 inhibitor), yielding irreversible TOP DNA-protein crosslinks (TOP-DPCs). Here we elucidate how TOP-DPCs are degraded via the SUMO-ubiquitin (Ub) pathway. We show that in human cells, TOP-DPCs are promptly and sequentially conjugated by SUMO-2/3, SUMO-1 and Ub. SUMOylation is catalyzed by the SUMO ligase PIAS4, which forms a complex with both TOP1 and TOP2α and β. RNF4 acts as the SUMO-targeted ubiquitin ligase (STUbL) for both TOP1- and TOP2-DPCs in a SUMO-dependent but replication/transcription-independent manner. This SUMO-Ub pathway is conserved in yeast with Siz1 the ortholog of PIAS4 and Slx5-Slx8 the ortholog of RNF4. Our study reveals a conserved SUMO-dependent ubiquitylation pathway for proteasomal degradation of both TOP1- and TOP2-DPCs and potentially for other DPCs.Abstract FigureIn BriefTopoisomerase DNA-protein crosslinks (TOP-DPCs) are the therapeutic mechanism of clinical TOP inhibitors (camptothecin and etoposide). TOP-DPCs induce rapid and sequential conjugation of SUMO-2/3- SUMO-1 and ubiquitin catalyzed by activation of PIAS4 through its DNA-binding SAP domain and RNF4 through its SIM domains. This SUMO-ubiquitin cascade triggers proteasomal degradation of TOP-DPCs.HIGHLIGHTSAbortive topoisomerase I (TOP1) and II (TOP2) cleavage complexes resulting in DNA-protein crosslinks (TOP-DPCs) are rapidly and sequentially modified by SUMO-2/3, SUMO-1 and ubiquitin before their proteasomal degradation.PIAS4 SUMOylates TOP-DPCs via its DNA-binding SAP domain independently of DNA transactions and DNA damage responses.RNF4 ubiquitylates SUMOylated TOP-DPCs and drives their proteasomal degradation.TOP-DPC processing by the SUMO-Ub pathways is conserved in yeast and human cells.

Download Full-text

A conserved SUMO pathway repairs topoisomerase DNA-protein cross-links by engaging ubiquitin-mediated proteasomal degradation

Science Advances ◽

10.1126/sciadv.aba6290 ◽

2020 ◽

Vol 6 (46) ◽

pp. eaba6290 ◽

Cited By ~ 1

Author(s):

Yilun Sun ◽

Lisa M. Miller Jenkins ◽

Yijun P. Su ◽

Karin C. Nitiss ◽

John L. Nitiss ◽

...

Keyword(s):

Ubiquitin Ligase ◽

Dna Cleavage ◽

Topoisomerase I ◽

Human Cells ◽

Sumo Modification ◽

Sumo Ligase ◽

Subsequent Degradation ◽

Cross Links ◽

Sumo Pathway

Topoisomerases form transient covalent DNA cleavage complexes to perform their reactions. Topoisomerase I cleavage complexes (TOP1ccs) are trapped by camptothecin and TOP2ccs by etoposide. Proteolysis of the trapped topoisomerase DNA-protein cross-links (TOP-DPCs) is a key step for some pathways to repair these lesions. We describe a pathway that features a prominent role of the small ubiquitin-like modifier (SUMO) modification for both TOP1- and TOP2-DPC repair. Both undergo rapid and sequential SUMO-2/3 and SUMO-1 modifications in human cells. The SUMO ligase PIAS4 is required for these modifications. RNF4, a SUMO-targeted ubiquitin ligase (STUbL), then ubiquitylates the TOP-DPCs for their subsequent degradation by the proteasome. This pathway is conserved in yeast with Siz1 and Slx5-Slx8, the orthologs of human PIAS4 and RNF4.

Download Full-text

Binding mode and affinity studies of DNA-binding agents using topoisomerase I DNA unwinding assay

Bioorganic & Medicinal Chemistry Letters ◽

10.1016/j.bmcl.2006.11.038 ◽

2007 ◽

Vol 17 (4) ◽

pp. 1013-1017 ◽

Cited By ~ 22

Author(s):

Ruel E. McKnight ◽

Aaron B. Gleason ◽

James A. Keyes ◽

Sadia Sahabi

Keyword(s):

Dna Binding ◽

Topoisomerase I ◽

Binding Mode ◽

Dna Unwinding ◽

Binding Agents ◽

Dna Binding Agents

Download Full-text

Two Distinct Signaling Pathways Activate the Latent DNA Binding Function of p53 in a Casein Kinase II-independent Manner

Journal of Biological Chemistry ◽

10.1074/jbc.270.30.18165 ◽

1995 ◽

Vol 270 (30) ◽

pp. 18165-18174 ◽

Cited By ~ 66

Author(s):

Ted R. Hupp ◽

David P. Lane

Keyword(s):

Dna Binding ◽

Signaling Pathways ◽

Casein Kinase Ii ◽

Casein Kinase ◽

Independent Manner ◽

Binding Function

Download Full-text

The Biological Impact of the Human Master Regulator p53 Can Be Altered by Mutations That Change the Spectrum and Expression of Its Target Genes

Molecular and Cellular Biology ◽

10.1128/mcb.26.6.2297-2308.2006 ◽

2006 ◽

Vol 26 (6) ◽

pp. 2297-2308 ◽

Cited By ~ 60

Author(s):

Daniel Menendez ◽

Alberto Inga ◽

Michael A. Resnick

Keyword(s):

Dna Binding ◽

Target Genes ◽

Tumor Development ◽

Human Tumor ◽

Human Cells ◽

Binding Domain ◽

Dna Binding Domain ◽

Missense Mutations ◽

The Relationship ◽

Biological Outcomes

ABSTRACT Human tumor suppressor p53 is a sequence-specific master regulatory transcription factor that targets response elements (REs) in many genes. p53 missense mutations in the DNA-binding domain are often cancer associated. As shown with systems based on the yeast Saccharomyces cerevisiae, p53 mutants can alter the spectra and intensities of transactivation from individual REs. We address directly in human cells the relationship between changes in the p53 master regulatory network and biological outcomes. Expression of integrated, tightly regulated DNA-binding domain p53 mutants resulted in many patterns of apoptosis and survival following UV or ionizing radiation, or spontaneously. These patterns reflected changes in the spectra and activities of target genes, as demonstrated for P21, MDM2, BAX, and MSH2. Thus, as originally proposed for “master genes of diversity,” p53 mutations in human cells can differentially influence target gene transactivation, resulting in a variety of biological consequences which, in turn, might be expected to influence tumor development and therapeutic efficacy.

Download Full-text

Minor groove dimeric bisbenzimidazoles inhibit in vitro DNA binding to eukaryotic DNA topoisomerase I

Biochemistry (Moscow) ◽

10.1134/s0006297910060039 ◽

2010 ◽

Vol 75 (6) ◽

pp. 695-701 ◽

Cited By ~ 12

Author(s):

O. Yu. Susova ◽

A. A. Ivanov ◽

S. S. Morales Ruiz ◽

E. A. Lesovaya ◽

A. V. Gromyko ◽

...

Keyword(s):

Dna Binding ◽

Topoisomerase I ◽

Minor Groove ◽

Dna Topoisomerase I ◽

Dna Topoisomerase ◽

Dimeric Bisbenzimidazoles ◽

Eukaryotic Dna

Download Full-text

Co(III) complexes based on α-N-heterocyclic thiosemicarbazone ligands: DNA binding, DNA cleavage, and topoisomerase I/II inhibitory activity studies

Journal of Molecular Structure ◽

10.1016/j.molstruc.2018.04.074 ◽

2018 ◽

Vol 1167 ◽

pp. 33-43 ◽

Cited By ~ 7

Author(s):

JunGang Deng ◽

Tao Li ◽

Gaoxing Su ◽

Qi-Pin Qin ◽

Yani Liu ◽

...

Keyword(s):

Dna Binding ◽

Inhibitory Activity ◽

Dna Cleavage ◽

Topoisomerase I

Download Full-text

DNA-binding protein activated by gamma radiation in human cells

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279-5285.1990 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text