Selecting for and Checking Cells with HGPRT Deficiency for Hybridoma Production

2021 ◽  
Vol 2021 (9) ◽  
pp. pdb.prot103325
Author(s):  
Edward A. Greenfield
Keyword(s):  
Cell Lines ◽  
De Novo ◽  
Myeloma Cell ◽  
Drug Selection ◽  
De Novo Synthesis ◽  
Myeloma Cells ◽  
Selective Media ◽  
Dna And Rna ◽  
Dna Biosynthesis

For drug-selective media to work for hybridoma selection, myeloma cells expressing a mutation abrogating the function of their HGPRT gene (and subsequently unable to produce purines for DNA biosynthesis) are used. HGPRT will recognize 8-AG as a substrate and convert it to the monophosphate nucleotide. The 8-AG-containing nucleotide is then processed further and incorporated into DNA and RNA, where it is toxic. Therefore, cells with a functional HGPRT enzyme grown in the presence of 8-AG will die. Cells that are deficient in HGPRTase cannot incorporate 8-AG in vivo and thus continue to grow. Cells that have been selected for resistance to 8-AG should be checked periodically to ensure that they maintain sensitivity to drugs that block the de novo synthesis of DNA. In addition, all myeloma cell lines should be checked periodically for reversion of their drug selection markers. Any line that is not killed completely by drug selection should either be reselected or replaced with a new line.

Interfering with Arginine Metabolism As a New Treatment Strategy for Multiple Myeloma

Blood ◽  
2015 ◽  
Vol 126 (23) ◽  
pp. 3005-3005
Author(s):  
Bjoern Jacobi ◽  
Lea Stroeher ◽  
Nadine Leuchtner ◽  
Hakim Echchannaoui ◽  
Alexander Desuki ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Death ◽  
Cell Lines ◽  
Caspase 3 ◽  
Xenograft Model ◽  
Myeloma Cell ◽  
Intracellular Protein ◽  
Myeloma Cells ◽  
Induction Of Apoptosis

Abstract Introduction Starvation of tumor cells from the amino acid arginine has recently gained particular interest because of the downregulation of the rate-limiting enzyme argininosuccinate synthethase 1 (ASS1) in various cancer entities. ASS1-deficient cells cannot resynthesize arginine from citrulline and are therefore considered arginine auxotrophic. The arginine depleting enzyme arginine deiminase (ADI-PEG20, Polaris Pharmaceuticals) is currently tested in phase I-III clinical trials for different arginine auxotrophic cancers. The natural arginine analogue canavanine can compete with arginine for arginyl-tRNA-binding sites and consequently be incorporated into nascent proteins instead of arginine. Canavanine could therefore potentially further disturb intracellular protein homeostasis, especially under arginine deprivation. The sensitivity of myeloma cells towards arginine depletion strategies has not been analyzed so far. Methods Human myeloma cell lines and CD138-sorted primary human myeloma cells from patient bone marrow were screened for ASS1 expression by western blotting (WB). The cells were cultured in arginine free medium and assessed for proliferation and metabolic activity (CFSE/MTT assays), apoptosis (caspase-3 cleavage) and cell death (annexinV/propidium iodide). Canavanine was supplied in both arginine-sufficient and -deficient conditions. The level of intracellular protein stress was determined by WB and/or flow cytometry analysis for ubiquitinated proteins, phosphorylated eukaryotic initiation factor 2α (peIF2α) and the spliced isoform of the X-Box binding protein 1 (Xbp1s). Repetitive ADI-PEG20 ± canavanine application i.p. were tested in vivo in an U266 myeloma xenograft model in NOD/SCID/IL2Rcg-/- (NSG) mice. Arginine and canavanine levels in plasma were determined by HPLC. Tumor growth was measured, mice were assessed for survival, weight and side effects. Tumor tissues were analyzed for caspase-3 cleavage and Ki67 expression by immunohistochemistry. Results 5 of 6 myeloma cell lines were negative for ASS1. Also, ASS1 was either not or only weakly expressed in the majority of primary CD138+ myeloma patient samples. Arginine starvation induced an arrest of cell proliferation and/or metabolic activity of primary myeloma cells and myeloma cell lines after 18-24 h. Addition of citrulline could only rescue ASS1 positive myeloma cells due to the intracellular resynthesis of arginine. Arginine starvation alone led to delayed induction of apoptosis (e.g. 35% cell death of NCI-H929 cells after 72 h of treatment). Addition of 100 mM canavanine strongly increased cell death specifically in the context of arginine deficiency (e.g. cell death in NCI-H929 cells: 87% after 24 h, 100 % after 48h) while it was non-toxic and had no effect on cell viability under physiological arginine conditions. Co-application of canavanine induced ubiquitination of cellular proteins and led to the prolongation of a fatal unfolded protein response (UPR) as measured by markedly elevated Xbp1s levels. Prolonged UPR ultimately led to the induction of apoptosis as reflected by annexin V binding and caspase-3 cleavage. In an U266 myeloma NSG xenograft model, systemic arginine depletion by ADI-PEG20 suppressed tumor growth in vivo and significantly prolonged median survival of mice when compared with the control group (22±3 vs. 15±3 days). Canavanine treatment alone had no influence on viability (13±0 days). However, the combination of ADI-PEG20 and canavanine demonstrated the longest median survival (27±7 days). Histological examination of explanted tumors showed the highest rates of caspase-3 cleavage in the ADI-PEG20/canavanine group. Conclusion Myeloma cells are mostly arginine auxotrophic and can be selectively targeted by arginine starvation. Combination of arginine depletion with the arginine analogue canavanine leads to a highly efficient and specific tumor cell eradication and should be further optimized in multiple myeloma preclinical models. Disclosures Bomalaski: Polaris Pharmaceuticals Inc.: Employment, Equity Ownership, Membership on an entity's Board of Directors or advisory committees.

Mcl-1 Is Overexpressed in Multiple Myeloma and Correlates with Disease Severity.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 1419-1419
Author(s):  
Soraya Wuilleme-Toumi ◽  
Nelly Robillard ◽  
Patricia Gomez-Bougie ◽  
Philippe Moreau ◽  
Steven Le Gouill ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Bone Marrow ◽  
Disease Severity ◽  
Cell Lines ◽  
Plasma Cells ◽  
Myeloma Cell ◽  
Lymphocytic Leukemia ◽  
Myeloma Cells

Abstract Multiple Myeloma (MM) is a fatal malignancy of B-cell origin characterized by the accumulation of plasma cells within the bone marrow. The expression of the pro-survival members of the Bcl-2 family has been shown to be a key process in the survival of myeloma cells. More particularly, Mcl-1 expression turned out to be critical for their survival. Indeed, knockdown of Mcl-1 by antisenses induces apoptosis in myeloma cells. Finally, Mcl-1 was found to be the only anti-apoptotic Bcl-2 family member which level of expression was modified by cytokine treatment of myeloma cells. For these reasons, we have evaluated the expression of Mcl-1 in vivo in normal, reactive and malignant plasma cells (PC) i.e., myeloma cells from 55 patients with MM and 20 human myeloma cell lines using flow cytometry. We show that Mcl-1 is overexpressed in MM in comparison with normal bone marrow PC. Forty-seven percent of patients with MM at diagnosis (p=.017) and 80% at relapse (p=.014 for comparison with diagnosis) overexpress Mcl-1. Of note, only myeloma cell lines but not reactive plasmocytoses have abnormal Mcl-1 expression, although both plasmocyte expansion entities share similar high proliferation rates (>20%). Of interest, Bcl-2 as opposed to Mcl-1, does not discriminate malignant from normal PC. This shows that the overexpression of Mcl-1 is clearly related to malignancy rather than to proliferation. It will be important to know whether the overexpression of Mcl-1 is related to an abnormal response to cytokines like Interleukin-6 or to mutations of the promoter of the Mcl-1 gene as already described in B chronic lymphocytic leukemia. Finally, level of Mcl-1 expression is related to disease severity, the highest values being correlated with the shortest event-free survival (p=.01). In conclusion, Mcl-1 which has been shown to be essential for the survival of human myeloma cells in vitro is overexpressed in vivo in MM and correlates with disease severity. Mcl-1 represents a major therapeutical target in MM.

Expression of Major Histocompatibility Complex Class I-Related Chain (MIC) on Fresh and Cloned Myeloma Cells.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 2465-2465
Author(s):  
Masashi Okamoto ◽  
Tohru Inaba ◽  
Sonoko Nakano ◽  
Kyoko Namura ◽  
Noriko Yamada ◽  
...  
Keyword(s):  
Cell Lines ◽  
Nk Cell ◽  
Myeloma Cell ◽  
Rt Pcr ◽  
Myeloma Cells ◽  
Ifn Alpha ◽  
Histocompatibility Complex ◽  
Nk Cell Cytotoxicity ◽  
Nk Cytotoxicity

Abstract Introduction: Major histocompatibility complex class-I related chain (MIC) is a ligand for NKG2D, one of the activating NK receptor. It is expressed on various cancerous cells, and mediates NK cytolysis. Myeloma cells may be susceptible to immune therapy because interferon (IFN)-alpha or thalidomide are effective for a part of myeloma patients. It is also reported that one myeloma cell line is susceptible to NK cytolysis, but another lines are not, and this difference is not depend on its KIR incompatibility. We therefore examined the expression of MIC on myeloma cells, and its role on NK cell cytotoxicity. Method: MIC expression was examined on two myeloma cell lines, U266 and RPMI8226, and fresh myeloma cells by flow cytometry (FCM) and reverse transcript polymerase chain reaction (RT-PCR). Modulation of MIC expression on these cell lines and fresh myeloma cells by the addition of various concentration of the drugs such as IFN-alpha, thalidomide, all-trans retinoic acid (ATRA), dexamethasone, and incadronate was examined by FCM and RT-PCR. The relationship between MIC expression and NK cytolysis was examine by 51Cr release assay. Result: MIC was highly expressed on these two cell lines. MIC mRNA was also detected by RT-PCR in both cell lines. IFN-alpha, thalidomide, ATRA, incadronate and dexamethasone are known to be effective for MM in vivo or in vitro, we therefore examined the effect of these drugs on the expression of MIC on two myeloma cell lines. The cell lines were treated with or without these drugs at various concentrations, and then subjected to FCM. MIC expression was not changed after treatment of thalidomide, incadronate and dexamethasone. But unexpectedly, it was down-regulated by IFN-alpha and ATRA dose-dependently on both cell lines. To examine whether MIC expression on myeloma cell lines is involved in their susceptibility to NK cells, NK cell cytotoxicity against these cell lines was analyzed by 51Cr releasing assay. A substantial cytolysis was detected in U266 cells, while RPMI8226 did not show any relevant cytolysis, though the cell line express high level of MIC. Furthermore NK cytotoxicity was not inhibited by the addition of anti-MIC antibody. Then we examined the effect of IFN-alpha on the NK cytotoxicity, because IFN-alpha down-regulated the expression of MIC on myeloma cell lines. However, NK cytotoxicity was also induced by IFN-alpha in both cell lines. To examine whether MIC is expressed on fresh myeloma cells and is involved in the effect of the various drugs against myeloma cells, fresh samples from 12 MM patients were examined on the expression of MIC using two-color flow cytometric analysis. MIC was expressed on myeloma cells in one of 12 patients examined. The treatment with IFN-alpha, thalidomide and ATRA did not up-regulated the expression of MIC in all samples. Conclusion: MIC is expressed on myeloma cell lines, but rarely expressed on fresh myelma cells. The reason of the discrepancy of MIC expression between fresh and cloned myeloma cells may be that myeloma cells are killed by host NK cells in vivo, provided the cells express MIC. In case myeloma cells express MIC in vivo, it may be that the molecule is not recognized by NKG2D on the NK cell.

PKC δ Inhibition Restores PTEN Activity in Myeloma Cells and Prolongs Survival of GFP+ Myeloma SCID/NOD Mice In Vivo.

Blood ◽  
2005 ◽  
Vol 106 (11) ◽  
pp. 113-113 ◽  
Author(s):  
Nizar J. Bahlis ◽  
Maya Starovic ◽  
Koen Raedschelders ◽  
Kathy Gratton ◽  
Oliver Bathe ◽  
...  
Keyword(s):  
Cell Lines ◽  
Kinase Activity ◽  
Nod Mice ◽  
Myeloma Cell ◽  
Whole Body ◽  
Expression Plasmid ◽  
Myeloma Cells ◽  
Terminal Domain ◽  
Phosphatidylinositol Phosphates

Abstract PTEN, a cellular phosphatase involved in the regulation of phosphatidylinositol phosphates (PIPs), is often inactivated in myeloma cells either through gene mutation or via phosphorylation of serine and threonine residues in the PTEN C-terminal domain that also results in loss of its activity and stability. The loss of PTEN function results in a failure to de-phosphorylate PIPs with a corresponding increase in Akt kinase activity. We have recently reported that PKCδ inhibition with Rottlerin (3 μM) induces cell death in sensitive and resistant myeloma cell lines (MM1S, MM1R, 8226S and U266) (Blood2002,100,11,393a). In addition Rottlerin blocked constitutive as well as IGF-1 induced phosphorylation of Akt abrogating its kinase activity and suppresses the phosphorylation of FKHR, GSK 3α/β and Bad, downstream substrates of Akt, triggerring activation of the intrinsic apoptotic pathway with loss of the mitochondrial membrane potential (Δψ) and cleavage of caspases 9, 3 and PARP. PKCδ inhibition also suppressed, upstream of Akt, ser 241-PDK1 phosphorylation by PIPs. These findings led us to investigate the PTEN status in human myeloma cell lines (MM1S, 8226S and U266). While normal PTEN expression was detected in these cell lines, PTEN was universally phosphorylated on ser 380 in its C-terminal domain, resulting in loss of its activity. Rottlerin completely suppressed the phosphorylation of this serine residue, restoring PTEN function and dephosphorylating PIPs. In order to verify that Rottlerin exhibited its effects by inhibiting PKCδ, we first stably overexpressed PKCδ in the 8226S cells. PKCδ overexpression partially protected these cells against rotttlerin cytotoxicity and abrogated rottlerin induced AKT inhibition and PTEN activation. Furthermore transfection of 8226S cells with a mammalian PKCδ siRNA expression plasmid (sense strand of shRNA: 5′_AAGAACGCTTCAACATCGACATTCAAGATGCGATGTTGAAGCGTTCTTTTTTTG_3′expression plasmid) reduced PKCδ expression by nearly 90% and more importantly it reduced PTEN, Akt and GSK 3α/β phosphorylation. Finally, we examined the effect of Rottlerin on the viability of GFP+ myeloma SCID/NOD mice in vivo. 4 to 6 weeks old SCID/NOD mice were irradiated (300 rads) and 24 h later received tail vein injections of 5 x 106 RPMI-8226/S-GFP+ cells. Treatment with Rottlerin (3mg/kg ip) every other day was effective in slowing tumor growth as monitored by whole-body real-time fluorescence imaging and prolonged median survival of GFP+ myeloma SCID/NOD mice compared to a non-treated control cohort. In summary, our work provides evidence that PKCδ inhibition restores PTEN function in wild type PTEN expressing myeloma cells and is a valid biological target for the treatment of multiple myeloma.

A Novel Mouse Model of Multiple Myeloma Representative of Human Disease and Its Use in Preclinical Therapeutic Assessment

Blood ◽  
2011 ◽  
Vol 118 (21) ◽  
pp. 2907-2907
Author(s):  
Rosemary A Fryer ◽  
Timothy J Graham ◽  
Emma M Smith ◽  
Brian A Walker ◽  
Gareth J Morgan ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Bone Marrow ◽  
Flow Cytometry ◽  
Cell Lines ◽  
Myeloma Cell ◽  
Human Condition ◽  
Myeloma Cells ◽  
Treatment Groups ◽  
Hyperintense Signal

Abstract Abstract 2907 In order to aid the pre-clinical development of novel therapeutics for multiple myeloma, an in vivo model which recapitulates the human condition in particular tumor growth patterns and response to treatment is required. An important feature of such a model is the interaction of the myeloma cells with the bone marrow microenvironment as this is known to modulate tumor activity and protect against drug-induced apoptosis. We have developed a model with myeloma restricted to the bone marrow, which proceeds rapidly from initial inoculation to disease progression, and possesses a range of chemo-sensitive markers with which to monitor anti-tumor response. Female NOD/SCID γcnull mice were injected inta-osseously with luciferase-tagged myeloma cell lines. Disease progression was monitored weekly by bioluminescent imaging (BLI) and measurement of paraprotein levels (ELISA). These methods were compared to histological assessment of tumor infiltration and MRI which provided a quantitative measurement of progression. On T2-weighted images tumor was identified as a hyperintense signal enclosed within cortical bone. Tumor burden was quantified from regions of interest drawn on the periphery of the hyperintense signal. Luciferase-tagged cells engrafted by 3 weeks at the injection site and progressed to the femurs, spine and pelvis from week 4. BLI showed a significant increase in radiance from 5.6×105 to 43.0×105p/s/cm2/sr between weeks 5 and 7 (p<0.05). Quantification of tumor volume by MRI showed a significant increase from 6.4mm3 to 27.6mm3 between weeks 4 and 8 (p<0.05) and μCT demonstrated lytic disease. Serum levels of Igλ increased from 860ng/ml to 4325ng/ml during this period (p<0.05), which mirrored the changes seen with BLI and MRI. Flow cytometry and histology confirmed the confinement of CD138 positive myeloma cells within the bone. These results indicate successful engraftment of human myeloma cell lines with induction of myeloma in a pattern similar to the human condition. We have adapted this model to study primary patient material. 10 mice were implanted with samples from 3 cases of plasma cell leukemia with complex cytogenetics. 5 of these developed myeloma confined to the bone marrow, 2 with additional plasmacytoma localized at the injection site, over a period of 1–5months. We have characterized the original patient cells with gene expression, SNP based gene mapping and have characterized the nature of the engrafted cells using similar technology. We have also shown the model is suitable for preclinical assessment of anti-myeloma agents using bortezomib and a novel aminopeptidase inhibitor, tosedostat (CHR-2797). Non-treated mice displayed a significant increase in radiance from 16.13×105 to 69.00×105p/s/cm2/sr (p<0.01). In comparison, in the bortezomib and tosedostat treated groups no significant increase in radiance was seen (bortezomib: 5.22×105 to 1.12×105 p/s/cm2/sr; tosedostat: 9.92×105 to 13.78×105p/s/cm2/sr). Paraprotein levels mimicked these changes in BLI. At the end of treatment Igλ levels in control, bortezomib and tosedostat treated mice were 2473.7, 132.5 and 923.0ng/ml, respectively. Igλ levels in both treatment groups were significantly different from control (p<0.001). Average tumor volumes derived from MRI were significantly different in bortezomib (14.7mm3) and tosedostat treated (23.4mm3) groups compared to non-treatment (33.0mm3). The volumes for the bortezomib treated group showed no significant difference from control mice. In addition, there was a decrease in CD138 expression by flow cytometry in bone aspirates from treatment groups compared to control which was mirrored in histological samples. In conclusion using both myeloma cell lines and primary patient cells, we have developed a model which recapitulates human myeloma with secretion of paraprotein, disease confined to the bone marrow, lytic bone lesions and spinal compression. In addition, this model is suitable for assessing the efficacy of novel therapeutics in vivo, using a number of non-invasive tumor markers such as BLI and MRI. Disclosures: Morgan: J&J: Honoraria, Speakers Bureau. Davies:J&J: Honoraria, Speakers Bureau.

Melphalan and XPO1 Inhibitor Combination Therapy for the Treatment of Multiple Myeloma

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 2084-2084 ◽  
Author(s):  
Joel G Turner ◽  
Jana L Dawson ◽  
Steven Grant ◽  
Kenneth H. Shain ◽  
Yun Dai ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Lines ◽  
De Novo ◽  
Ex Vivo ◽  
Myeloma Cell ◽  
Drug Resistant ◽  
Cell Viability Assay ◽  
Myeloma Cells ◽  
Multiple Myeloma Cell

Abstract Introduction High-dose melphalan chemotherapy with autologous stem cell transplant remains the standard of care for the treatment of multiple myeloma. However, patients eventually develop drug resistance and die from progressive disease despite the introduction of therapies using proteosome inhibitors (PIs) and immunomodulatory drugs (IMIDs). The incurable nature of multiple myeloma clearly demonstrates the need for novel agents and treatments. Here, our aim was to investigate whether the use of XPO1 (exportin 1, CRM1) inhibitors (XPO1i) could sensitize de novo and acquired drug-resistant multiple myeloma cells both in vitro and ex vivo to the alkylating agent melphalan. Materials and Methods Human multiple myeloma cell lines NCI-H929, RPMI-8226, U266 and PBMC controls were treated in vitro with the XPO1i KOS-2464 and the orally available Selective Inhibitor of Nuclear Export (SINE) selinexor (KPT-330) or) +/- melphalan. Multiple myeloma cells were grown at high-density conditions (>3-5x106 cells/mL). High-density multiple myeloma cells have been shown to possess de novo drug resistance. Sensitivity of the XPO1i/melphalan-treated NCI-H929 cells was measured by cell viability assay (CellTiter-Blue). Apoptosis in XPO1i/melphalan-treated NCI-H929, RPMI-8226, and U266 cells was assayed using flow cytometry (activated caspase 3). Proximity ligation assays were performed to assess XPO1-p53 binding in the presence of an XPO1i. Western blots of XPO1i-treated myeloma cells were performed for nuclear and total p53. Drug-resistant U266 (PSR) and 8226 (8226/B25) myeloma cell lines were developed by incremental exposure to bortezomib. PSR cells are able to grow in 15 nM bortezomib and the 8226/B25 in 25 nM. These resistant myeloma cells were treated in vitro with XPO1i +/- melphalan. Sensitivity to therapy was measured by apoptosis and cell viability assay. Multiple myeloma cells isolated from patients with newly diagnosed, relapsed, or refractory disease were treated with XPO1i +/- melphalan and CD138+/light chain+ myeloma cells and assayed for apoptosis. Results Multiple myeloma cell (NCI-H929) viability was decreased synergistically by XPO1i when used in combination with melphalan, as shown by the calculated combinatorial index (CI) values. We examined sequencing of the drugs and found that concurrent treatment with melphalan (10 µM) and selinexor (300 nM) for 48 hours produced the best results (CI value 0.370, n=6). Sequential treatment (selinexor for 24 hours followed by melphalan for an additional 24 hours) or the reverse sequence had slightly less synergy, with CI values of 0.491 (n=9) and 0.565 (n=3), respectively. Normal PBMC control cells were unaffected by XPO1i/melphalan treatment as shown by viability and apoptotic assays. Proximity ligation assay demonstrated that XPO1i blocks XPO1/p53 binding. Western blot showed that the XPO1i treatment of myeloma cells increased nuclear and total p53. Drug-resistant 8226/B25 myeloma cells but not PSR cells were found to be resistant to melphalan when compared to parental cell lines. Both resistant myeloma cell lines were sensitized by XPO1i to melphalan as shown by apoptosis assay (3- to 10-fold). CD138+/light chain+ myeloma cells derived from newly diagnosed, relapsed, and refractory myeloma patients were also sensitized by XPO1 inhibitors to melphalan as demonstrated by apoptotic assays (e.g. activated caspase 3). Conclusions XPO1i synergistically improved the response of de novo and acquired drug-resistant myeloma cells to melphalan in vitro and ex vivo. It is possible that this synergy may be due to an increase of nuclear p53 by XPO1i and the reported activation of p53 by melphalan. Future studies include in vitro experiments using drug-resistant human U266 myeloma cells in NOD-SCID-gamma mice and clinical trials using melphalan in combination with the SINE selinexor. Combination therapies using selinexor and melphalan may significantly improve the treatment of myeloma. Disclosures Kauffman: Karyopharm Therapeutics: Employment. Shacham:Karyopharm Therapeutics: Employment.

scholarly journals Dickkopf-1 (DKK1) is a widely expressed and potent tumor-associated antigen in multiple myeloma

Blood ◽  
2007 ◽  
Vol 110 (5) ◽  
pp. 1587-1594 ◽  
Author(s):  
Jianfei Qian ◽  
Jin Xie ◽  
Sungyoul Hong ◽  
Jing Yang ◽  
Liang Zhang ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
T Cells ◽  
Cell Lines ◽  
Cytotoxic T Cells ◽  
Human Leukocyte ◽  
Myeloma Cell ◽  
Low Frequencies ◽  
Myeloma Cells ◽  
Dickkopf 1

Abstract The identification of novel tumor-associated antigens, especially those shared among patients, is urgently needed to improve the efficacy of immunotherapy for multiple myeloma (MM). In this study, we examined whether Dickkopf-1 (DKK1), a protein that is not expressed in most normal tissues but is expressed by tumor cells from almost all patients with myeloma, could be a good candidate. We identified and synthesized DKK1 peptides for human leukocyte antigen (HLA)–A*0201 and confirmed their immunogenicity by in vivo immunization in HLA-A*0201 transgenic mice. We detected, using peptidetetramers, low frequencies of DKK1 peptide-specific CD8-positive (CD8+) T cells in patients with myeloma and generated peptide-specific T-cell lines and clones from HLA-A*0201-positive (HLA-A*0201+) blood donors and patients with myeloma. These T cells efficiently lysed peptide-pulsed but not unpulsed T2 or autologous dendritic cells, DKK1-positive (DKK1+)/HLA-A*0201+ myeloma cell lines U266 and IM-9, and, more importantly, HLA-A*0201+ primary myeloma cells from patients. No killing was observed on DKK1+/HLA-A*0201-negative (HLA-A*0201−) myeloma cell lines and primary myeloma cells or HLA-A*0201+ normal lymphocytes, including B cells. These results indicate that these T cells were potent cytotoxic T cells and recognized DKK1 peptides naturally presented by myeloma cells in the context of HLA-A*0201 molecules. Hence, our study identifies DKK1 as a potentially important antigen for immunotherapy in MM.

scholarly journals Chaetocin: a promising new antimyeloma agent with in vitro and in vivo activity mediated via imposition of oxidative stress

Blood ◽  
2006 ◽  
Vol 109 (6) ◽  
pp. 2579-2588 ◽  
Author(s):  
Crescent R. Isham ◽  
Jennifer D. Tibodeau ◽  
Wendy Jin ◽  
Ruifang Xu ◽  
Michael M. Timm ◽  
...  
Keyword(s):  
Oxidative Stress ◽  
B Cells ◽  
Cell Lines ◽  
Ex Vivo ◽  
Myeloma Cell ◽  
Lymphocytic Leukemia ◽  
Myeloma Cells ◽  
High Degree

Abstract Chaetocin, a thiodioxopiperazine natural product previously unreported to have anticancer effects, was found to have potent antimyeloma activity in IL-6–dependent and –independent myeloma cell lines in freshly collected sorted and unsorted patient CD138+ myeloma cells and in vivo. Chaetocin largely spares matched normal CD138− patient bone marrow leukocytes, normal B cells, and neoplastic B-CLL (chronic lymphocytic leukemia) cells, indicating a high degree of selectivity even in closely lineage-related B cells. Furthermore, chaetocin displays superior ex vivo antimyeloma activity and selectivity than doxorubicin and dexamethasone, and dexamethasone- or doxorubicin-resistant myeloma cell lines are largely non–cross-resistant to chaetocin. Mechanistically, chaetocin is dramatically accumulated in cancer cells via a process inhibited by glutathione and requiring intact/unreduced disulfides for uptake. Once inside the cell, its anticancer activity appears mediated primarily through the imposition of oxidative stress and consequent apoptosis induction. Moreover, the selective antimyeloma effects of chaetocin appear not to reflect differential intracellular accumulation of chaetocin but, instead, heightened sensitivity of myeloma cells to the cytotoxic effects of imposed oxidative stress. Considered collectively, chaetocin appears to represent a promising agent for further study as a potential antimyeloma therapeutic.

scholarly journals Establishment of two interleukin 6 (B cell stimulatory factor 2/interferon beta 2)-dependent human bone marrow-derived myeloma cell lines.

1989 ◽  
Vol 169 (1) ◽  
pp. 339-344 ◽  
Author(s):  
S Shimizu ◽  
R Yoshioka ◽  
Y Hirose ◽  
S Sugai ◽  
J Tachibana ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Bone Marrow ◽  
Cell Lines ◽  
Myeloma Cell ◽  
Nuclear Antigen ◽  
Myeloma Cells ◽  
Multiple Myeloma Cell ◽  
Human Multiple Myeloma ◽  
Dependent Growth

Two IL-6-dependent human multiple myeloma cell lines, ILKM2 and ILKM3, were established from the bone marrow of patients with IgG-K multiple myeloma. Both cell lines had the typical morphology and immunocytochemical features of myeloma cells. The surface phenotype of both cell lines was PCA-1+, OKT10+, CD10(J-5)-, CD19(B4)-, CD20(B1)-, CD21(B2)-, and OKIa-1-. A monoclonal cytoplasmic Ig, IgG-K or K L chain, was positive in ILKM2 or ILKM3, respectively. EBV nuclear antigen was negative in both cell lines. They proliferated in the presence of macrophages or macrophage-derived factors (MDF). Among the recombinant cytokines examined, IL-6 most strongly augmented the growth of both cell lines. The anti-IL-6 antibody completely inhibited the IL-6-dependent growth and almost completely inhibited the MDF- or purified MDF-dependent growth of both cell lines, ILKM2 and ILKM3 are now being maintained in the culture medium containing 2 ng/ml rIL-6. These results suggest that IL-6 produced by macrophages may play an important role in the growth of myeloma cells in vivo and that macrophages or IL-6 can be used for establishing human myeloma cell lines.

Targeting NF-κB and Induction of Apoptosis by Dehydroxymethylepoxyquinomicin (DHMEQ) in Multiple Myeloma Cells.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 3393-3393
Author(s):  
Yoshitaka Miyakawa ◽  
Kanoko Kohmura ◽  
Kaori Saito ◽  
Hiroshi Yoshida ◽  
Asako Ikejima ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Multiple Myeloma ◽  
Cell Lines ◽  
Caspase 3 ◽  
Regulatory Protein ◽  
Active Form ◽  
Myeloma Cell ◽  
Myeloma Cells ◽  
Induced Apoptosis

Abstract We previously designed and synthesized a new NF-κB inhibitor, dehydroxymethylepoxyquinomicin (DHMEQ) (J Biol Chem, 2002). DHMEQ is a derivative of the weak antibiotics epoxyquinomicin C, which was isolated from the culture broth of Amycolaptosis sp. NF-κB is a critical regulatory protein that activates the transcription of a number of genes, including growth factors, angiogenesis modifiers, cell adhesion molecules and anti-apoptotic factors. As NF-κB has been shown as a good target for the new therapies such as bortezomib, we studied the effects of the new specific NFκB inhibitor, DHMEQ, to myeloma cells. In the present study, we demonstrated that DHMEQ inhibited the proliferation of human myeloma cell lines, RPMI8226 and U266 in dose- and time-dependent manners. Apoptosis was detected using fluorescein-conjugated Annexin-V by FACS. Around 45.3%of RPMI8226 and 45.2% of U266 were in apoptosis 12 hours after treatment with 10 μg/ml DHMEQ. Formation of apoptotic bodies were observed 24 hour-treatment with DHMEQ in both cell lines by Giemsa staining. In contrast, no obvious cell cycle arrest was observed with DHMEQ, indicating DHMEQ directly induces apoptosis without cell cycle arrests in these myeloma cell lines. The activation of caspase-3 in RPMI8226 and U266 cells were detected with the specific antibody against the active form of caspase-3 by FACS. When the myeloma cells were pretreated with 20 μM pan-caspase inhibitor, z-VAD-FMK, DHMEQ-induced apoptosis was inhibited by 62.1% in RPMI8226 and 71.9% in U266 cells, indicating DHMEQ-induced apoptosis was caspase-dependent. The binding activities of nuclear NF-κB protein to the oligonucleotides including NF-κB binding sites was suppressed by 81.9% in RPMI8226 and 69.0% in U266 1 hour after treatment with DHMEQ. NF-κB protein seemed more accumulated in cytoplasm of myeloma cells after treatment with DHMEQ under the confocal microscope, indicating DHMEQ prevents the translocation of NF-κB protein into the nucleus. Bcl-XL is the anti-apoptotic factor and its transcription is regulated by NF-κB. However, the expression level of Bcl-XL protein was not altered 24 hours after treatment with DHMEQ in RPMI8226 and U266. We also studied the effects of DHMEQ to the patient materials. We found that DHMEQ induced apoptosis in CD138-positive plasma cells from the myeloma patients (n=3), demonstrating that DHMEQ is also effective for primary cells. We previsously developed the model of human multiple myeloma by simply injecting U266 cells into the tail vein of the immunodeficient NOG mice. This myeloma model demostrated the massive osteolytic lesions and hind leg paralysis around 7 weeks after transplantation. We did not observe any invasion of U266 cells into other organs except bone marrow. As NF-κB regulates the proliferation of myeloma cells and osteoclasts, we expect DHMEQ will inhibit the tumor growth and prevent pathological fractures by inducing apoptosis in both myeloma cells and osteoclasts in vivo. We are currently evaluating the in vivo efficacies of DHMEQ using this experimental animal model of multiple myeloma. In conclusion, we demonstrated that DHMEQ targets NF-κB and induces apoptosis in myeloma cells through caspase-dependent pathways.

Sign in / Sign up

Export Citation Format

Share Document