Orchid Fleck Virus Infecting Orchids in Paraguay: First Report and Use of Degenerate Primers for its Detection

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

Yellow Net of Triumffeta Is Caused by a Geminivirus: A First Report

Plant Disease ◽

10.1094/pdis.1998.82.1.127a ◽

1998 ◽

Vol 82 (1) ◽

pp. 127-127 ◽

Cited By ~ 2

Author(s):

Vipin Hallan ◽

Sangeeta Saxena ◽

B. P. Singh

Keyword(s):

Rainy Season ◽

Blot Hybridization ◽

Southern Blot Hybridization ◽

Viral Disease ◽

Hybridization Experiment ◽

Dorsal Side ◽

Causal Agent ◽

Degenerate Primers ◽

First Report ◽

Initial Symptoms

Triumffeta rhomboidiaceae Jacq. (Tiliaceae family) is an annual rainy season weed that is commonly found throughout India. For the last 3 years, during the rainy season, several plants of T. rhomboidiaceae in and around the gardens of the National Botanical Research Institute have been found with vein yellowing symptoms. The initial symptoms were vein clearing but in later stages the veins became yellow and thickened. In severe cases, the chlorosis extends into interveinal areas, resulting in complete yellowing of the leaves. In a few cases, green leafy or thorny enations could be seen on the dorsal side of the leaf. The disease was investigated to identify the causal agent. Vector transmission studies showed that the causal agent is transmitted by the whitefly, Bemisia tabaci, from infected to healthy seedlings of T. rhomdoidiaceae. Since whitefly transmission of the disease is consistent with a geminivirus as the causal agent, the role of such a virus was investigated. DNA isolated from Triumffeta plants (both from the infected plants in the field as well as from those inoculated experimentally in the greenhouse) showing above mentioned symptoms was amplified with two sets of degenerate primers, PAL1v1978/PAR1c496 (set 1) and PAL1v1978/PCRc1 (set 2), that have been shown to be specific for DNA-A of whitefly transmitted geminiviruses (WTGs), in polymerase chain reaction (1). We could amplify DNA-A fragments of approximately 1.2 kb from set 1 and 0.7 kb from set 2, as expected (1). DNA isolated from healthy seedlings gave no amplification of such fragments. Identification of the amplified DNA fragments (from infected samples) to be of geminiviral in nature was confirmed by Southern blot hybridization carried out under high stringency conditions. DNA-A of Indian tomato leaf curl virus (2) was used as a general probe for WTGs for the above hybridization experiment. Therefore, Triumffeta yellow net disease is caused by a geminivirus. A review of literature revealed that there is no record of a viral disease affecting this weed and, therefore, this is the first report of a viral disease affecting this plant. References: (1) M. R. Rojas et al. Plant Dis. 77:340, 1993. (2) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

First report of a geminivirus causing leaf curl disease on Trigonella corniculata evidenced by PCR using degenerate primers

EPPO Bulletin ◽

10.1111/j.1365-2338.2001.tb00980.x ◽

2001 ◽

Vol 31 (1) ◽

pp. 115-117

Author(s):

S. K. Raj ◽

S. K. Pandey ◽

G. Chandra ◽

B. P. Singh ◽

R. K. Gupta

Keyword(s):

Degenerate Primers ◽

First Report ◽

Leaf Curl Disease ◽

Leaf Curl

Download Full-text

First report about the identification and preliminary analysis of a partial sequence of dihydropyrimidine dehydrogenase (NADP+) in Thermopsis turcica during floral development using degenerate primers

Acta Physiologiae Plantarum ◽

10.1007/s11738-017-2458-x ◽

2017 ◽

Vol 39 (8) ◽

Author(s):

D. Tekdal ◽

S. J. Lucas ◽

S. Cetiner

Keyword(s):

Preliminary Analysis ◽

Floral Development ◽

Dihydropyrimidine Dehydrogenase ◽

Partial Sequence ◽

Degenerate Primers ◽

First Report ◽

Thermopsis Turcica

Download Full-text

First Report of Little cherry virus 1 Infecting Sweet Cherry in Ontario, Canada

Plant Disease ◽

10.1094/pdis-04-21-0798-pdn ◽

2021 ◽

Author(s):

Aaron Simkovich ◽

Susanne Kohalmi ◽

Aiming Wang

Keyword(s):

San Diego ◽

Sweet Cherry ◽

The United States ◽

Eastern Region ◽

Rt Pcr ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Blastn Search ◽

Cherry Trees

The Niagara fruit belt is one of the richest fruit-producing areas in Canada, contributing to 90% of Ontario's tender fruits such as peach, plum and sweet cherry. Little cherry virus 1 (LCV1) of the genus Velarivirus is a causal agent of little cherry disease which has devastated cherry crops in many regions (Eastwell and Bernardy 1998, Jelkmann and Eastwell, 2011). From 2013 to 2018, foliar symptoms indicative of viral infection such as leaf deformation, ringspot, mottling, vein clearing, and reddening were found on sweet cherry trees grown in the Niagara region. To determine if these trees were infected by a virus, small RNAs (sRNAs) were isolated from separately pooled asymptomatic and symptomatic leaves using the mirPremier microRNA isolation kit (Sigma Aldrich Canada, Oakville, ON). The sRNAs were used to create two libraries (four leaves per library) with the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA). The sRNA libraries were separately sequenced with the MiSeq Desktop Sequencer (Illumina, San Diego, CA). In total, 5,380,196 reads were obtained and Trimmomatic (Bolger et al. 2014) was used to remove adaptors. The remaining 4,733,804 clean reads were assembled into contigs using Velvet 0.7.31 (Zerbino and Birney, 2008) and Oases 0.2.09 (Schulz et al. 2012) with minimum length of 75 nt (Supplementary Table 1). A BLASTn search (Altschul et al. 1997) of the contigs identified the presence of Cherry virus A (genus: Capillovirus), two members of the Ilarvirus genus (Prunus necrotic ringspot virus and Prune dwarf virus) in both libraries. LCV1 was only found in contigs derived from the symptomatic library. Of the clean reads, 22,016 were assembled into six contigs (with lengths ranging from 86 to 116 nt, Supplementary Table 1) mapping to LCV1, covering 7.07% of the viral genome. To confirm LCV1 infection, primers were designed from the assembled contigs and used for reverse transcription polymerase chain reaction (RT-PCR). Amplicons were sequenced and the terminal sequences were determined using 5’ and 3’ RACE Systems (Invitrogen, Burlington, ON). Degenerate primers were designed from multiple sequence alignments of published LCV1 genomes for amplification and primer walking to obtain the sequence of LCV1 (Table S2). The complete genome sequence of LCV1 has a length of 16,934 nt and was deposited in GenBank (accession no. MN508820). A BLASTn search showed that this isolate is nearly identical (99.6% sequence identity) to an isolate from California (accession no. MN131067). To determine the incidence of infection, a field survey was performed at the same location during spring months of 2014 to 2018 using RT-PCR with primers specific to the viral coat protein gene (Supplementary Tale 2). Among 46 cherry trees sampled, two (4.3%) trees were infected with LCV1 and showed negative results with CVA, PNRSV and PDV. Both trees displayed mild suturing of primary and secondary veins (Supplementary Figure 1). LCV1 has been identified in Western stone fruit producing regions (British Columbia in Canada, and Washington, California, and Oregon in the United States of America). To the best of our knowledge, this is the first report of LCV1 in any eastern region of Canada. The low incidence of LCV1 suggests that this virus is not widespread in this region. Routine monitoring and detection of LCV1 is required to prevent this devastating cherry disease from spreading in this region.

Download Full-text

First Report of Tomato Mottle Geminivirus Infecting Tomatoes in Yucatan, Mexico

Plant Disease ◽

10.1094/pdis.1998.82.5.592b ◽

1998 ◽

Vol 82 (5) ◽

pp. 592-592 ◽

Cited By ~ 17

Author(s):

E. R. Garrido-Ramirez ◽

R. L. Gilbertson

Keyword(s):

Mixed Infection ◽

Blot Hybridization ◽

Tomato Leaf ◽

Western Hemisphere ◽

Leaf Sample ◽

Degenerate Primers ◽

Tomato Production ◽

Tomato Plants ◽

First Report ◽

Stunted Growth

Whitefly-transmitted geminiviruses are a major constraint on tomato production in Mexico (3). In the Yucatan State, these viruses can cause serious losses in late season plantings. As part of an effort to characterize these viruses, leaf samples from four tomato plants showing symptoms of geminivirus infection, such as stunted growth and leaf mottling and deformation, were collected from a single field in the Yucatan State in February, 1996. Geminivirus nucleic acids were detected in leaf samples from all four plants by squash blot hybridization analysis with a general DNA probe for Western Hemisphere whitefly-transmitted geminiviruses (2). Nicotiana benthamiana plants inoculated with sap prepared with leaf tissue from one plant developed stunted growth and leaf mottling and deformation. When graft-transmitted from N. benthamiana to tomato, the geminivirus(es) induced leaf mottling and deformation, which were similar to symptoms in the field-collected tomato plants. The presence of geminivirus DNA in the sap- and graft-inoculated plants was confirmed with the polymerase chain reaction (PCR) and degenerate primers for the DNA-A (PAL1v1978 and PAR1c496) or DNA-B (PBL1v2040 and PCRc1) components of whitefly-transmitted geminiviruses (4). Using PCR and these degenerate primers, approximately 1.1-kb DNA-A and approximately 0.6-kb DNA-B fragments were amplified from DNA extracts prepared from leaves of each of the four Yucatan tomato plants. No DNA fragments were amplified from these extracts with primers for pepper huasteco geminivirus (pAL1c2329 and pAL1v1471, or pBR1c840 and pBL1v1830). To determine the identity of the geminivirus(es) infecting these tomato plants, the PCR-amplified DNA-A and DNA-B fragments from one of the samples were cloned and sequenced. Comparisons made with these sequences revealed two distinct types of DNA-A and DNA-B clones, indicating a mixed infection of at least two bipartite geminiviruses. DNA-A and DNA-B sequences of one set of clones were >97% identical to sequences of tomato mottle geminivirus (ToMoV) from Florida (1). The presence of ToMoV in all four tomato leaf samples was demonstrated by the PCR-mediated amplification of a 0.9-kb DNA-A fragment with ToMoV-specific primers (pAL1v2295 and pAR1c580). The identity of this 0.9-kb DNA fragment was further confirmed based upon its hybridization with a full-length clone of ToMoV DNA-A under high stringency conditions (2). A data base search made with the sequence of the other type of DNA-A clone revealed sequence identities of <70% with various bipartite geminiviruses (e.g., identities of 70% with tomato mottle, 69% with Sida golden mosaic, 67% with bean dwarf mosaic, and 66% with taino tomato mottle and with potato yellow mosaic), which confirmed that a second geminivirus was present in a mixed infection with ToMoV in this tomato leaf sample. To confirm the bipartite nature of this geminivirus, a DNA-B fragment that contained the common region (CR) sequence was amplified from the same sample with PCR and primers PBL1v2040 and PBR1c970 (a degenerate primer that anneals within the BV1 open reading frame; F. M. Zerbini and R. L. Gil-bertson, unpublished data), cloned, and sequenced. The CR sequence of this DNA-B fragment was 96% identical to that of the DNA-A fragment, which establishes the presence of another bipartite geminivirus in this sample. This is the first report of ToMoV in Mexico. These results also suggest that at least two bipartite geminiviruses may infect tomatoes in the Yucatan Peninsula. References: (1) A. M. Abouzid et al. J. Gen. Virol. 73:3225, 1992. (2) R. L. Gilbertson et al. Plant Dis. 75:336, 1991. (3) J. E. Polston and P. K. Anderson. Plant Dis. 81:1358, 1997. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

First Report of Bean yellow mosaic virus in Alaska from Clover (Trifolium spp.)

Plant Disease ◽

10.1094/pdis-94-3-0372a ◽

2010 ◽

Vol 94 (3) ◽

pp. 372-372 ◽

Cited By ~ 1

Author(s):

N. L. Robertson ◽

K. L. Brown

Keyword(s):

Coat Protein ◽

Host Range ◽

Mosaic Virus ◽

Bean Yellow Mosaic Virus ◽

Yellow Mosaic Virus ◽

Degenerate Primers ◽

First Report ◽

Chlorotic Spot ◽

Putative Coat Protein ◽

Das Elisa

In mid-June 2008, distinct mosaic leaves were observed on a cluster of clover (Trifolium spp.) with light pink and white flowers growing at the edge of a lawn in Palmer, AK. Virus minipurification from leaves of affected clover and protein extractions on a polyacrylamide electrophoresis implicated a ~35-kDa putative coat protein (CP). Subsequent western blots and ELISA with a universal potyvirus antiserum (Agdia Inc., Elkhart, IN) confirmed potyvirus identity. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from the same plant were used for reverse transcription (RT)-PCR. Three sets of degenerate primers that targeted potyvirus-specific genes, HC-Pro (helper component protease) and CI (cylindrical inclusion protein) and the genomic 3′-terminus that included a partial NIb (nuclear inclusion), CP (coat protein), and UTR (untranslated region), produced the expected PCR segments (~0.7, ~0.7, and ~1.6 kbp, respectively) on 1% agarose gels (1). Direct sequencing of the HC-Pro (GenBank No. GQ181115), CI (GQ181116), and CP (GU126690) segments revealed 98, 97, and 99% nucleotide identities (no gaps), respectively, to Bean yellow mosaic virus (BYMV)-chlorotic spot (CS) strain, GenBank No. AB373203. The next closest BYMV percent identity comparisons decreased to 79% for HC-Pro (GenBank No. DQ641248; BYMV-W), 79% for CI (U47033; BYMV-S) partial genes, and 96% for CP (AB041971; BYMV-P242). Mechanical inoculations of purified virus preparations produced local lesions on Chenopodium amaranticolor Coste & A. Reyn. (2 of 5) and C. quinoa Willd. (6 of 7), and mosaic on Nicotiana benthamiana Domin (5 of 5). BYMV was specifically confirmed on tester plants using a double-antibody sandwich (DAS)-ELISA BYMV (strain 204 and B25) kit (AC Diagnostics, Inc., Fayetteville, AR) as directed. The absence of another potyvirus commonly found in clover, Clover yellow vein virus (ClYVV), was verified in parallel DAS-ELISA ClYVV assays (AC Diagnostics, Inc). The BYMV isolate was maintained in N. benthamiana, and virion or sap extracts inoculated to the following host range (number of infected/total inoculated plants [verified by BYMV ELISA]): Cucumis sativus L. ‘Straight Eight’ (0/5), Gomphrena globosa L. (1/4), Nicotiana clevelandii A. Gray (4/7), Phaseolus vulgaris L. ‘Bountiful’ (1/3), Pisum sativum L. (Germplasm Resources Information Network Accession Nos. -PI 508092 (8/12), -W6 17525 (13/13), -W6 17529 (0/13), -W6 17530 (13/14), -W6 17537 (0/12), -W6 17538 (0/12), and -W6 17539 (0/21), Tetragonia tetragoniodes (2/2), Trifolium pretense L. ‘Altaswede’ (6/10), T. repens L. ‘Pilgrim’ (0/8), and Vicia faba L. (1/3). All infected plants had symptoms ranging from systemic mosaic (T. pretense, P. sativum) to leaf distortions (N. clevelandii, Tetragonia tetragoniodes). Interestingly, the host range and genomic sequences of the BYMV Alaskan strain resemble the BYMV-CS (chlorotic spot) strain that was originally isolated from a diseased red clover (T. pretense) plant in Japan more than 40 years ago (2). Although BYMV occurs worldwide and has a wide host range in dictoyledonous and monocotyledonous plants (3), to our knowledge, this is the first report of a natural occurrence of BYMV in Alaska. The incidence and distribution of BYMV in clover and other plant species are not known in Alaska. References: (1) C. Ha et al. Arch. Virol. 153:36, 2008. (2) H. Kume et al. Mem. Fac. Agric. Hokkaido Univ. 7:449, 1970. (3) S. J. Wylie et al. Plant Dis. 92:1596, 2008.

Download Full-text