scholarly journals Phagocytosis of Borrelia burgdorferi and Treponema pallidum Potentiates Innate Immune Activation and Induces Gamma Interferon Production

2007 ◽  
Vol 75 (4) ◽  
pp. 2046-2062 ◽  
Author(s):  
Meagan W. Moore ◽  
Adriana R. Cruz ◽  
Carson J. LaVake ◽  
Amanda L. Marzo ◽  
Christian H. Eggers ◽  
...  
Keyword(s):  
Borrelia Burgdorferi ◽  
Nk Cells ◽  
Cell Activation ◽  
Cytokine Production ◽  
Ex Vivo ◽  
Treponema Pallidum ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Host Cells ◽  
Ifn Γ

ABSTRACT We examined the interactions of live and lysed spirochetes with innate immune cells. THP-1 monocytoid cells were activated to comparable extents by live Borrelia burgdorferi and by B. burgdorferi and Treponema pallidum lysates but were poorly activated by live T. pallidum. Because THP-1 cells poorly internalized live spirochetes, we turned to an ex vivo peripheral blood mononuclear cell system that would more closely reflect spirochete-mononuclear phagocyte interactions that occur during actual infection. In this system, B. burgdorferi induced significantly greater monocyte activation and inflammatory cytokine production than did borrelial lysates or T. pallidum, and only B. burgdorferi elicited gamma interferon (IFN-γ) from NK cells. B. burgdorferi was phagocytosed avidly by monocytes, while T. pallidum was not, suggesting that the enhanced response to live B. burgdorferi was due to phagocytosis of the organism. When cytochalasin D was used to block phagocytosis of live B. burgdorferi, cytokine production decreased to levels comparable to those induced by B. burgdorferi lysates, while the IFN-γ response was abrogated altogether. In the presence of human syphilitic serum, T. pallidum was efficiently internalized and initiated responses resembling those observed with live B. burgdorferi, including the production of IFN-γ by NK cells. Depletion of monocytes revealed that they were the primary source of inflammatory cytokines, while dendritic cells (DCs) directed IFN-γ production from innate lymphocytes. Thus, phagocytosis of live spirochetes initiates cell activation programs in monocytes and DCs that differ qualitatively and quantitatively from those induced at the cell surface by lipoprotein-enriched lysates. The greater stimulatory capacity of B. burgdorferi versus T. pallidum appears to be explained by the successful recognition and phagocytosis of B. burgdorferi by host cells and the ability of T. pallidum to avoid detection and uptake by virtue of its denuded outer membrane rather than by differences in surface lipoprotein expression.

scholarly journals Variation in Adenovirus Transgene Expression between BALB/c and C57BL/6 Mice Is Associated with Differences in Interleukin-12 and Gamma Interferon Production and NK Cell Activation

2001 ◽  
Vol 75 (10) ◽  
pp. 4540-4550 ◽  
Author(s):  
YuFeng Peng ◽  
Erik Falck-Pedersen ◽  
Keith B. Elkon
Keyword(s):  
Nk Cells ◽  
Transgene Expression ◽  
Cell Activation ◽  
Cell Function ◽  
Nk Cell ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Mouse Strains ◽  
Innate Immune Responses

ABSTRACT The innate immune response against replication-defective adenoviruses (Ad) is poorly defined. We and others have previously observed striking differences in the rate at which the Ad vector itself or the virus encoding a variety of transgenes is eliminated in different mouse strains. Here, we report that Ad infection of BALB/ mice is associated with sixfold-higher levels of serum alanine aminotransferase and that Ad transgenes induce two- to threefold-higher levels of intrahepatic NK cells and NK activity compared to C57BL/6 mice. The increase in NK activation in BALB/c mice was associated with ∼4-fold higher level of mRNA expression of a newly described NKG2 receptor activator, H-60, as well as increased expression of interleukin-12 and gamma interferon mRNAs in BALB/c mice compared to C57BL/6 mice. NK depletion in BALB/c mice or defective NK function in C3H beige mice extended transgene expression compared to their appropriate controls, and attenuation of NK together with CD8 T-cell function had a synergistic effect. These findings indicate that there are intrinsic differences in the innate immune responses of different mouse strains to Ad and Ad transgenes and that NK cells, in cooperation with CD8 T cells, play a pivotal role in the early extinction of transgene expression in BALB/c mice.

scholarly journals Dendritic Cell and NK Cell Reciprocal Cross Talk Promotes Gamma Interferon-Dependent Immunity to Blood-Stage Plasmodium chabaudi AS Infection in Mice

2008 ◽  
Vol 77 (2) ◽  
pp. 770-782 ◽  
Author(s):  
Rebecca Ing ◽  
Mary M. Stevenson
Keyword(s):  
Nk Cells ◽  
Cross Talk ◽  
Cell Activation ◽  
Reciprocal Cross ◽  
Nk Cell ◽  
Gamma Interferon ◽  
Cell Contact ◽  
Ifn Γ ◽  
Dc Maturation

ABSTRACT Dendritic cells (DCs) are important accessory cells for promoting NK cell gamma interferon (IFN-γ) production in vitro in response to Plasmodium falciparum-infected red blood cells (iRBC). We investigated the requirements for reciprocal activation of DCs and NK cells leading to Th1-type innate and adaptive immunity to P. chabaudi AS infection. During the first week of infection, the uptake of iRBC by splenic CD11c+ DCs in resistant wild-type (WT) C57BL/6 mice was similar to that in interleukin 15−/− (IL-15−/−) and IL-12p40−/− mice, which differ in the severity of P. chabaudi AS infection. DCs from infected IL-15−/− mice expressed costimulatory molecules, produced IL-12, and promoted IFN-γ secretion by WT NK cells in vitro as efficiently as WT DCs. In contrast, DCs from infected IL-12p40−/− mice exhibited alterations in maturation and cytokine production and were unable to induce NK cell IFN-γ production. Coculture of DCs and NK cells demonstrated that DC-mediated NK cell activation required IL-12 and, to a lesser extent, IL-2, as well as cell-cell contact. In turn, NK cells from infected WT mice enhanced DC maturation, IL-12 production, and priming of CD4+ T-cell proliferation and IFN-γ secretion. Infected WT mice depleted of NK cells, which exhibit increased parasitemia, had impaired DC maturation and DC-induced CD4+ Th1 cell priming. These findings indicate that DC-NK cell reciprocal cross talk is critical for control and rapid resolution of P. chabaudi AS infection and provide in vivo evidence for the importance of this interaction in IFN-γ-dependent immunity to malaria.

scholarly journals A Higher Frequency of NKG2A+than of NKG2A−NK Cells Responds to Autologous HIV-Infected CD4 Cells irrespective of Whether or Not They Coexpress KIR3DL1

2015 ◽  
Vol 89 (19) ◽  
pp. 9909-9919 ◽  
Author(s):  
Irene Lisovsky ◽  
Gamze Isitman ◽  
Rujun Song ◽  
Sandrina DaFonseca ◽  
Alexandra Tremblay-McLean ◽  
...  
Keyword(s):  
Nk Cells ◽  
Cell Activation ◽  
Nk Cell ◽  
Gamma Interferon ◽  
Cell Populations ◽  
Cell Receptors ◽  
Nk Cell Receptors ◽  
Cd107a Expression ◽  
Infected Cells ◽  
Ifn Γ

ABSTRACTEpidemiological and functional studies implicate NK cells in HIV control. However, there is little information available on which NK cell populations, as defined by the inhibitory NK cell receptors (iNKRs) they express, respond to autologous HIV-infected CD4+(iCD4) T cells. NK cells acquire antiviral functions through education, which requires signals received from iNKRs, such as NKG2A and KIR3DL1 (here, 3DL1), engaging their ligands. NKG2A interacts with HLA-E, and 3DL1 interacts with HLA-A/B antigens expressing the Bw4 epitope. HIV-infected cells downregulate HLA-A/B, which should interrupt negative signaling through 3DL1, leading to NK cell activation, provided there is sufficient engagement of activating NKRs. We examined the functionality of NK cells expressing or not NKG2A and 3DL1 stimulated by HLA-null and autologous iCD4 cells. Flow cytometry was used to gate on each NKG2A+/NKG2A−3DL1+/3DL1−(NKG2A+/−3DL1+/−) population and to measure the frequency of all possible combinations of CD107a expression and gamma interferon (IFN-γ) and CCL4 secretion. The highest frequency of functional NK cells responding to HLA-null cell stimulation was the NKG2A+3DL1+NK cell population. The highest frequencies of functional NK cells responding to autologous iCD4 cells were those expressing NKG2A; coexpression of 3DL1 did not further modulate responsiveness. This was the case for the functional subsets characterized by the sum of all functions tested (total responsiveness), as well as by the trifunctional CD107a+IFN-γ+CCL4+, CD107a+IFN-γ+, total CD107a+, and total IFN-γ+functional subsets. These results indicate that the NKG2A receptor has a role in NK cell-mediated anti-HIV responses.IMPORTANCEHIV-infected CD4 (iCD4) cells activate NK cells, which then control HIV replication. However, little is known regarding which NK cell populations iCD4 cells stimulate to develop antiviral activity. Here, we examine the frequency of NK cell populations, defined by the presence/absence of the NK cell receptors (NKRs) NKG2A and 3DL1, that respond to iCD4 cells. NKG2A and 3DL1 are involved in priming NK cells for antiviral functions upon encountering virus-infected cells. A higher frequency of NKG2A+than NKG2A−NK cells responded to iCD4 cells by developing antiviral functions such as CD107a expression, which correlates with NK cell killing, and secretion of gamma interferon and CCL4. Coexpression of 3DL1 on the NKG2A+and NKG2A−NK cells did not modulate responses to iCD4 cells. Understanding the mechanisms underlying the interaction of NK cells with iCD4 cells that lead to HIV control may contribute to developing strategies that harness NK cells for preventing or controlling HIV infection.

scholarly journals Altered Ex-Vivo Cytokine Responses in Children With Asymptomatic Plasmodium falciparum Infection in Burkina Faso: An Additional Argument to Treat Asymptomatic Malaria?

2021 ◽  
Vol 12 ◽  
Author(s):  
Annelies Post ◽  
Berenger Kaboré ◽  
Mike Berendsen ◽  
Salou Diallo ◽  
Ousmane Traore ◽  
...  
Keyword(s):  
Whole Blood ◽  
Cytokine Production ◽  
Ex Vivo ◽  
Clinical Malaria ◽  
Innate Immune ◽  
Asymptomatic Malaria ◽  
Cytokine Responses ◽  
Tnf Α ◽  
Ifn Γ ◽  
Malaria Microscopy

IntroductionPatients with clinical malaria have an increased risk for bacterial bloodstream infections. We hypothesized that asymptomatic malaria parasitemia increases susceptibility for bacterial infections through an effect on the innate immune system. We measured circulating cytokine levels and ex-vivo cytokine production capacity in asymptomatic malaria and compared with controls.MethodsData were collected from asymptomatic participants <5 years old with and without positive malaria microscopy, as well as from hospitalized patients <5 years old with clinical malaria, bacteremia, or malaria/bacteremia co-infections in a malaria endemic region of Burkina Faso. Circulating cytokines (TNF-α, IFN-γ, IL-6, IL-10) were measured using multiplex assays. Whole blood from asymptomatic participants with and without positive malaria microscopy were ex-vivo stimulated with S. aureus, E. coli LPS and Salmonella Typhimurium; cytokine concentrations (TNF-α, IFN-γ, IL-1β, IL-6, IL-10) were measured on supernatants using ELISA.ResultsIncluded were children with clinical malaria (n=118), bacteremia (n=22), malaria and bacteremia co-infection (n=9), asymptomatic malaria (n=125), and asymptomatic controls (n=237). Children with either clinical or asymptomatic malaria had higher plasma cytokine concentrations than controls. Cytokine concentrations correlated positively with malaria parasite density with the strongest correlation for IL-10 in both asymptomatic (r=0.63) and clinical malaria (r=0.53). Patients with bacteremia had lower circulating IL-10, TNF-α and IFN-γ and higher IL-6 concentrations, compared to clinical malaria. Ex-vivo whole blood cytokine production to LPS and S. aureus was significantly lower in asymptomatic malaria compared to controls. Whole blood IFN-γ and IL-10 production in response to Salmonella was also lower in asymptomatic malaria.InterpretationIn children with asymptomatic malaria, cytokine responses upon ex-vivo bacterial stimulation are downregulated. Further studies are needed to explore if the suggested impaired innate immune response to bacterial pathogens also translates into impaired control of pathogens such as Salmonella spp.

scholarly journals Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

2001 ◽  
Vol 69 (3) ◽  
pp. 1643-1649 ◽  
Author(s):  
Robert A. Gramzinski ◽  
Denise L. Doolan ◽  
Martha Sedegah ◽  
Heather L. Davis ◽  
Arthur M. Krieg ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
T Cells ◽  
Nk Cells ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Cpg Odn ◽  
Cpg Dinucleotides ◽  
Cpg Odns ◽  
Ifn Γ

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Bi-Specific Killer Cell Engagers (BiKEs) Signaling Through CD16 and Targeting CD33 (CD16 × CD33), Triggers Natural Killer (NK) Cell Cytotoxic and Cytokine Production Against Refractory Acute Myeloid Leukemia (AML)

Blood ◽  
2012 ◽  
Vol 120 (21) ◽  
pp. 256-256
Author(s):  
Andres Wiernik ◽  
Bree Foley ◽  
Bin Zhang ◽  
Michael R. Verneris ◽  
Erica Warlick ◽  
...  
Keyword(s):  
Nk Cells ◽  
Target Cell ◽  
Cell Activation ◽  
Cytokine Production ◽  
Nk Cell ◽  
Negative Control ◽  
Advisory Committees ◽  
Tnf Α ◽  
Ifn Γ ◽  
Survival Assay

Abstract Abstract 256 AML accounts for a large number of annual deaths due to leukemia worldwide. NK cells are effectors of the innate immune system that mediate the graft versus leukemia (GVL) effect in patients with AML and other hematologic malignancies. The safety and success of using haploidentical NK cell infusions to treat patients with AML has been previously demonstrated, but this therapeutic approach has limitations of potency and lacks specificity for leukemic targets. NK cell antibody-dependent cell-mediated cytotoxicity (ADCC) usually occurs trough the binding of the activating receptor FcγRIIIA (also known as CD16) to the Fc portion of antibodies. CD16 is expressed on most CD56dim NK cells and induces NK cell activation, leading to interferon (IFN-γ) and tumor necrosis factor (TNF-α) secretion. CD16 shedding occurs upon NK cell activation, an effect that we have shown is mediated by a specific metalloproteinase called a disintegrin and metalloproteinase-17 (ADAM-17). We hypothesized that a BiKE antibody molecule, developed specifically to signal through CD16 and targeting the myeloid differentiation antigen CD33 (i.e., CD16 × CD33 BiKE) would enhance NK cell function against AML. In addition, we predicted that selective inhibition of ADAM-17 activity would prevent CD16 shedding and enhance the activity of the CD16 × CD33 BiKE. Bone marrow (BM) samples from 10 patients with primary refractory AML were obtained from our leukemia tissue bank and used as targets. CD33 was expressed on 8 of the 10 BM samples. Purified NK cells from healthy donors were isolated and incubated overnight in the absence of cytokines. NK cells and AML BM samples were treated with 1 ug/mL of bscFv CD16 × CD33 BiKE, scFv anti-CD16 (negative control) or DTCD33 × CD33 (anti-CD33 plus anti-CD33 spliced to truncated diphtheria toxin - negative control). NK cells under the above conditions were all treated with or without 5 uM of an ADAM17 inhibitor (Incyte). After 4 hours in culture, intracellular CD107a degranulation assay and intracellular TNF-α and IFN-γ assays were performed. A MTS survival assay was also performed on the target cells. In 8 of 10 AML samples, NK cells significantly degranulated and secreted cytokines (TNF-α and IFN-γ) only when treated with the CD16 × CD33 BiKE reagent. The MTS survival assay confirmed significant AML target cell death in the presence of the CD16 × CD33 BiKE. Combined treatment with the CD16 × CD33 BiKE and the ADAM17 inhibitor led to a significant increase in cytokine TNF-α and IFN-γ secretion by NK cells when compared to treatment with CD16 × CD33 BiKE alone. Phenotypic analysis of the NK cells after treatment with the ADAM17 inhibitor revealed a significant decrease in CD16 shedding as predicted. Of note, no NK cell activity was triggered by the 2 AML BM samples that lacked CD33 expression arguing in favor of the specificity of this molecule for CD33 positive AML. We then analyzed the ability of NK cells to kill multiple targets in the presence of the CD16 × CD33 BiKE over time. NK cells and HL60 cells (CD33 positive targets) were treated with 1 ug/mL of bscFv CD16 × CD33 BiKE and incubated overnight in the presence or absence of the ADAM17 inhibitor. On the following day, a second target exposure with chromium (Cr-) labeled HL60 cells was added to the culture in order to visualize the effect of NK cells on second targets. After 4 hours, intracellular CD107a, TNF-α, IFN-γ and standard Cr- release assays were performed. In the presence of the CD16 × CD33 BiKE, NK cells showed significantly more degranulation killing and secreted more cytokines in response to secondary targets. Cytokine secretion was also enhanced by the addition of the ADAM17 inhibitor to the BiKE. Collectively, these findings support the ability of a CD16 × CD33 BiKE to trigger NK cell activation through direct signaling of CD16, inducing secretion of cytokines, lytic granules and causing target cell death in resistant AML BM samples and HL60 targets. BiKE enhanced AML killing occurs over a wide range of CD33 target cell density as long as some expression is present. In addition, targeting ADAM17 prevents activation induced CD16 shedding and enhances NK cell cytokine production when combine with therapeutic antibodies. NK cell directed therapy by these compounds could specifically enhance the anti-leukemic potency and efficacy of NK cell adoptive therapy against myeloid disorders. Disclosures: Miller: Celgene: Membership on an entity's Board of Directors or advisory committees; Coronado Bioscience: Membership on an entity's Board of Directors or advisory committees.

scholarly journals Natural killer cell activation after infection with lactate dehydrogenase-elevating virus

2002 ◽  
Vol 83 (11) ◽  
pp. 2709-2716 ◽  
Author(s):  
Dominique Markine-Goriaynoff ◽  
Xavier Hulhoven ◽  
César L. Cambiaso ◽  
Philippe Monteyne ◽  
Thérèse Briet ◽  
...  
Keyword(s):  
Immune System ◽  
Lactate Dehydrogenase ◽  
Nk Cells ◽  
Natural Killer ◽  
Innate Immune System ◽  
Cell Activation ◽  
Nk Cell ◽  
Killer Cell ◽  
Innate Immune ◽  
Ifn Γ

Early after infection, lactate dehydrogenase-elevating virus (LDV) alters the immune system by polyclonally activating B lymphocytes, which leads to IgG2a-restricted hypergammaglobulinaemia, and by suppressing the secretion of Th2 cytokines. Considering that these alterations may involve cells of the innate immune system and cytokines such as interferon-gamma (IFN-γ), we analysed the effect of LDV on natural killer (NK) cells. Within a few days of infection, a strong and transient NK cell activation, characterized by enhanced IFN-γ message expression and cytolysis, was observed. LDV triggered a large increase in serum IFN-γ levels. Because NK cells and IFN-γ may participate in the defence against virus infection, we analysed their possible role in the control of LDV titres with a new agglutination assay. Our results indicate that neither the activation of NK cells nor the IFN-γ secretion affect the early and rapid virus replication that follows LDV inoculation.

scholarly journals Populations of Human T Lymphocytes That Traverse the Vascular Endothelium Stimulated by Borrelia burgdorferi Are Enriched with Cells That Secrete Gamma Interferon

2004 ◽  
Vol 72 (3) ◽  
pp. 1530-1536 ◽  
Author(s):  
Edna I. Gergel ◽  
Martha B. Furie
Keyword(s):  
T Cells ◽  
T Lymphocytes ◽  
Lyme Disease ◽  
Borrelia Burgdorferi ◽  
Vascular Endothelium ◽  
Human Peripheral Blood ◽  
Gamma Interferon ◽  
Interleukin 4 ◽  
Ifn Γ

ABSTRACT Some diseases are characterized by prevalence in the affected tissues of type 1 T lymphocytes, which secrete gamma interferon (IFN-γ) and other proinflammatory cytokines. For example, type 1 T cells predominate in the lesions of patients with Lyme disease, which is caused by the bacterium Borrelia burgdorferi. We used an in vitro model of the blood vessel wall to test the premise that the vascular endothelium actively recruits circulating type 1 T cells to such lesions. When T lymphocytes isolated from human peripheral blood were examined, the populations that traversed monolayers of resting human umbilical vein endothelial cells (HUVEC) or HUVEC stimulated by interleukin-1β or B. burgdorferi were markedly enriched for T cells that produced IFN-γ compared to the initially added population of T cells. No enrichment was seen for cells that produced interleukin-4, a marker for type 2 T lymphocytes. Very late antigen-4 and CD11/CD18 integrins mediated passage of the T cells across both resting and stimulated HUVEC, and the endothelium-derived chemokine CCL2 (monocyte chemoattractant protein 1) was responsible for the enhanced migration of T cells across stimulated HUVEC. These results suggest that the vascular endothelium may contribute to the selective accumulation of type 1 T cells in certain pathological lesions, including those of Lyme disease.

scholarly journals Resistance to Acute Babesiosis Is Associated with Interleukin-12- and Gamma Interferon-Mediated Responses and Requires Macrophages and Natural Killer Cells

2003 ◽  
Vol 71 (4) ◽  
pp. 2002-2008 ◽  
Author(s):  
Irma Aguilar-Delfin ◽  
Peter J. Wettstein ◽  
David H. Persing
Keyword(s):  
Nk Cells ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
No Production ◽  
Cytokine Responses ◽  
Early Production ◽  
Ifn Γ ◽  
Crucial Part

ABSTRACT We examined the role of the cytokines gamma interferon (IFN-γ) and interleukin-12 (IL-12) in the model of acute babesiosis with the WA1 Babesia. Mice genetically deficient in IFN-γ-mediated responses (IFNGR2KO mice) and IL-12-mediated responses (Stat4KO mice) were infected with the WA1 Babesia, and observations were made on the course of infection and cytokine responses. Levels of IFN-γ and IL-12 in serum increased 24 h after parasite inoculation. The augmented susceptibility observed in IFNGR2KO and Stat-4KO mice suggests that the early IL-12- and IFN-γ-mediated responses are involved in protection against acute babesiosis. Resistance appears to correlate with an increase in nitric oxide (NO) production. In order to assess the contribution of different cell subsets to resistance against the parasite, we also studied mice lacking B cells, CD4+ T cells, NK cells, and macrophages. Mice genetically deficient in B lymphocytes or CD4+ T lymphocytes were able to mount protective responses comparable to those of immunosufficient mice. In contrast, in vivo depletion of macrophages or NK cells resulted in elevated susceptibility to the infection. Our observations suggest that a crucial part of the response that protects from the pathogenic Babesia WA1 is mediated by macrophages and NK cells, probably through early production of IL-12 and IFN-γ, and induction of macrophage-derived effector molecules like NO.

scholarly journals Dengue Virus-Infected Dendritic Cells, but Not Monocytes, Activate Natural Killer Cells through a Contact-Dependent Mechanism Involving Adhesion Molecules

mBio ◽  
2017 ◽  
Vol 8 (4) ◽  
Author(s):  
Vivian Vasconcelos Costa ◽  
Weijian Ye ◽  
Qingfeng Chen ◽  
Mauro Martins Teixeira ◽  
Peter Preiser ◽  
...  
Keyword(s):  
Dendritic Cells ◽  
Virus Infection ◽  
Dengue Virus ◽  
Nk Cells ◽  
Adhesion Molecules ◽  
Cell Activation ◽  
Nk Cell ◽  
Denv Infection ◽  
Ifn Γ

ABSTRACT Natural killer (NK) cells play a protective role against dengue virus (DENV) infection, but the cellular and molecular mechanisms are not fully understood. Using an optimized humanized mouse model, we show that human NK cells, through the secretion of gamma interferon (IFN-γ), are critical in the early defense against DENV infection. Depletion of NK cells or neutralization of IFN-γ leads to increased viremia and more severe thrombocytopenia and liver damage in humanized mice. In vitro studies using autologous human NK cells show that DENV-infected monocyte-derived dendritic cells (MDDCs), but not monocytes, activate NK cells in a contact-dependent manner, resulting in upregulation of CD69 and CD25 and secretion of IFN-γ. Blocking adhesion molecules (LFA-1, DNAM-1, CD2, and 2β4) on NK cells abolishes NK cell activation, IFN-γ secretion, and the control of DENV replication. NK cells activated by infected MDDCs also inhibit DENV infection in monocytes. These findings show the essential role of human NK cells in protection against acute DENV infection in vivo, identify adhesion molecules and dendritic cells required for NK cell activation, and delineate the sequence of events for NK cell activation and protection against DENV infection. IMPORTANCE Dengue is a mosquito-transmitted viral disease with a range of symptoms, from mild fever to life-threatening dengue hemorrhagic fever. The diverse disease manifestation is thought to result from a complex interplay between viral and host factors. Using mice engrafted with a human immune system, we show that human NK cells inhibit virus infection through secretion of the cytokine gamma interferon and reduce disease pathogenesis, including depletion of platelets and liver damage. During a natural infection, DENV initially infects dendritic cells in the skin. We find that NK cells interact with infected dendritic cells through physical contact mediated by adhesion molecules and become activated before they can control virus infection. These results show a critical role of human NK cells in controlling DENV infection in vivo and reveal the sequence of molecular and cellular events that activate NK cells to control dengue virus infection. IMPORTANCE Dengue is a mosquito-transmitted viral disease with a range of symptoms, from mild fever to life-threatening dengue hemorrhagic fever. The diverse disease manifestation is thought to result from a complex interplay between viral and host factors. Using mice engrafted with a human immune system, we show that human NK cells inhibit virus infection through secretion of the cytokine gamma interferon and reduce disease pathogenesis, including depletion of platelets and liver damage. During a natural infection, DENV initially infects dendritic cells in the skin. We find that NK cells interact with infected dendritic cells through physical contact mediated by adhesion molecules and become activated before they can control virus infection. These results show a critical role of human NK cells in controlling DENV infection in vivo and reveal the sequence of molecular and cellular events that activate NK cells to control dengue virus infection.

Sign in / Sign up

Export Citation Format

Share Document