scholarly journals Identification and Characterization of NocR as a Positive Transcriptional Regulator of the β-Lactam Nocardicin A in Nocardia uniformis

2008 ◽  
Vol 191 (3) ◽  
pp. 1066-1077 ◽  
Author(s):  
Jeanne M. Davidsen ◽  
Craig A. Townsend
Keyword(s):  
Dna Binding ◽  
Intergenic Region ◽  
Binding Protein ◽  
Transcriptional Regulator ◽  
Transcriptional Analysis ◽  
Binding Motif ◽  
Moderate Activity ◽  
Wild Type ◽  
Insertional Inactivation ◽  
Nocardicin A

ABSTRACT Nocardicin A is a monocyclic β-lactam isolated from the actinomycete Nocardia uniformis, which shows moderate activity against a broad spectrum of gram-negative bacteria. Within the biosynthetic gene cluster of nocardicin A, nocR encodes a 583-amino-acid protein with high similarity to a class of transcriptional regulators known as streptomyces antibiotic regulatory proteins. Insertional inactivation of this gene resulted in a mutant showing morphology and growth characteristics similar to the wild type, but one that did not produce detectable levels of nocardicin A or the early precursor p-hydroxybenzoyl formate. Similar disruptions of nocD, nocE, and nocO yielded mutants that maintained production of nocardicin A at levels similar to the wild-type strain. In trans complementation of the nocR::apr mutant partially restored the wild-type phenotype. Transcriptional analysis of the nocR::apr mutant using reverse transcription-PCR found an absence of mRNA transcripts for the early-stage nocardicin A biosynthetic genes. In addition, transcription of the genes responsible for the biosynthesis of the nonproteinogenic p-hydroxyphenylglycine (pHPG) precursor was attenuated on the nocR disruption mutant. NocR was heterologously expressed and purified from Escherichia coli as an N-terminal maltose binding protein-tagged fusion protein. DNA binding assays demonstrated that NocR is a DNA binding protein, targeting the 126-bp intergenic region between nocF and nocA. Within this intergenic region is the likely binding motif, a direct hexameric repeat, TGATAA, with a 5-bp spacer. These experiments establish NocR as a positive transcriptional regulator of the nocardicin A biosynthetic pathway, coordinating the initial steps of nocardicin A biosynthesis to the production of its pHPG precursor.

The DNA Binding Protein Rfg1 Is a Repressor of Filamentation inCandida albicans

Genetics ◽  
2001 ◽  
Vol 157 (4) ◽  
pp. 1503-1512 ◽  
Author(s):  
Roy A Khalaf ◽  
Richard S Zitomer
Keyword(s):  
Dna Binding ◽  
Binding Protein ◽  
Hyphal Growth ◽  
Dna Binding Protein ◽  
Homozygous Deletion ◽  
Wild Type ◽  
Pathogenic Yeast ◽  
Repression Complex ◽  
Type Gene ◽  
Repression Domain

AbstractWe have identified a repressor of hyphal growth in the pathogenic yeast Candida albicans. The gene was originally cloned in an attempt to characterize the homologue of the Saccharomyces cerevisiae Rox1, a repressor of hypoxic genes. Rox1 is an HMG-domain, DNA binding protein with a repression domain that recruits the Tup1/Ssn6 general repression complex to achieve repression. The C. albicans clone also encoded an HMG protein that was capable of repression of a hypoxic gene in a S. cerevisiae rox1 deletion strain. Gel retardation experiments using the purified HMG domain of this protein demonstrated that it was capable of binding specifically to a S. cerevisiae hypoxic operator DNA sequence. These data seemed to indicate that this gene encoded a hypoxic repressor. However, surprisingly, when a homozygous deletion was generated in C. albicans, the cells became constitutive for hyphal growth. This phenotype was rescued by the reintroduction of the wild-type gene on a plasmid, proving that the hyphal growth phenotype was due to the deletion and not a secondary mutation. Furthermore, oxygen repression of the hypoxic HEM13 gene was not affected by the deletion nor was this putative ROX1 gene regulated positively by oxygen as is the case for the S. cerevisiae gene. All these data indicate that this gene, now designated RFG1 for Repressor of Filamentous Growth, is a repressor of genes required for hyphal growth and not a hypoxic repressor.

scholarly journals Insight into the Dual Functions of Bacterial Enhancer-Binding Protein Rrp2 of Borrelia burgdorferi

2016 ◽  
Vol 198 (10) ◽  
pp. 1543-1552 ◽  
Author(s):  
Yanping Yin ◽  
Youyun Yang ◽  
Xuwu Xiang ◽  
Qian Wang ◽  
Zhang-Nv Yang ◽  
...  
Keyword(s):  
Dna Binding ◽  
Borrelia Burgdorferi ◽  
Binding Protein ◽  
Phosphorylation Site ◽  
Binding Motif ◽  
Cell Replication ◽  
Additional Function ◽  
Content Type ◽  
Terminal Domain ◽  
Enhancer Binding Protein

ABSTRACTIt is well established that the RpoN-RpoS sigma factor (σ54-σS) cascade plays an essential role in differential gene expression during the enzootic cycle ofBorrelia burgdorferi, the causative agent of Lyme disease. The RpoN-RpoS pathway is activated by the response regulator/σ54-dependent activator (also called bacterial enhancer-binding protein [bEBP]) Rrp2. One unique feature of Rrp2 is that this activator is essential for cell replication, whereas RpoN-RpoS is dispensable for bacterial growth. How Rrp2 controls cell replication, a function that is independent of RpoN-RpoS, remains to be elucidated. In this study, by generating a series of conditionalrrp2mutant strains, we demonstrated that the N-terminal receiver domain of Rrp2 is required for spirochetal growth. Furthermore, a D52A point mutation at the phosphorylation site within the N terminus of Rrp2 abolished cell replication. Mutation of the ATPase motif within the central domain of Rrp2 did not affect spirochetal replication, indicating that phosphorylation-dependent ATPase activity of Rrp2 for σ54activation is not required for cell growth. However, deletion of the C-terminal domain or a 16-amino-acid truncation of the helix-turn-helix (HTH) DNA-binding motif within the C-terminal domain of Rrp2 abolished spirochetal replication. It was shown that constitutive expression ofrpoSis deleterious to borrelial growth. We showed that the essential nature of Rrp2 is not due to an effect onrpoS. These data suggest that phosphorylation-dependent oligomerization and DNA binding of Rrp2 likely function as a repressor, independently of the activation of σ54, controlling an essential step of cell replication inB. burgdorferi.IMPORTANCEBacterial enhancer-binding proteins (bEBPs) are a unique group of transcriptional activators specifically required for σ54-dependent gene transcription. This work demonstrates that theB. burgdorferibEBP, Rrp2, has an additional function that is independent of σ54, that of its essentiality for spirochetal growth, and such a function is dependent on its N-terminal signal domain and C-terminal DNA-binding domain. These findings expand our knowledge on bEBP and provide a foundation to further study the underlying mechanism of this new function of bEBP.

scholarly journals A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1

1994 ◽  
Vol 14 (3) ◽  
pp. 1852-1860
Author(s):  
K Nakagomi ◽  
Y Kohwi ◽  
L A Dickinson ◽  
T Kohwi-Shigematsu
Keyword(s):  
Amino Acid ◽  
Dna Binding ◽  
Direct Contact ◽  
Binding Protein ◽  
Binding Activity ◽  
Binding Domain ◽  
Binding Motif ◽  
Dna Binding Domain ◽  
Sequence Context ◽  
Dna Binding Activity

The nuclear matrix attachment DNA (MAR) binding protein SATB1 is a sequence context-specific binding protein that binds in the minor groove, making virtually no contact with the DNA bases. The SATB1 binding sites consist of a special AT-rich sequence context in which one strand is well-mixed A's, T's, and C's, excluding G's (ATC sequences), which is typically found in clusters within different MARs. To determine the extent of conservation of the SATB1 gene among different species, we cloned a mouse homolog of the human STAB1 cDNA from a cDNA expression library of the mouse thymus, the tissue in which this protein is predominantly expressed. This mouse cDNA encodes a 764-amino-acid protein with a 98% homology in amino acid sequence to the human SATB1 originally cloned from testis. To characterize the DNA binding domain of this novel class of protein, we used the mouse SATB1 cDNA and delineated a 150-amino-acid polypeptide as the binding domain. This region confers full DNA binding activity, recognizes the specific sequence context, and makes direct contact with DNA at the same nucleotides as the whole protein. This DNA binding domain contains a novel DNA binding motif: when no more than 21 amino acids at either the N- or C-terminal end of the binding domain are deleted, the majority of the DNA binding activity is lost. The concomitant presence of both terminal sequences is mandatory for binding. These two terminal regions consist of hydrophilic amino acids and share homologous sequences that are different from those of any known DNA binding motifs. We propose that the DNA binding region of SATB1 extends its two terminal regions toward DNA to make direct contact with DNA.

scholarly journals Dissection of a carboxy-terminal region of the yeast regulatory protein RAP1 with effects on both transcriptional activation and silencing

1992 ◽  
Vol 12 (3) ◽  
pp. 1209-1217
Author(s):  
C F Hardy ◽  
D Balderes ◽  
D Shore
Keyword(s):  
Dna Binding ◽  
Binding Site ◽  
Transcriptional Activation ◽  
Binding Sites ◽  
Binding Protein ◽  
Binding Domain ◽  
Dominant Negative Effect ◽  
Dna Binding Domain ◽  
Wild Type ◽  
Carboxy Terminal

RAP1 is an essential sequence-specific DNA-binding protein in Saccharomyces cerevisiae whose binding sites are found in a large number of promoters, where they function as upstream activation sites, and at the silencer elements of the HMR and HML mating-type loci, where they are important for repression. We have examined the involvement of specific regions of the RAP1 protein in both repression and activation of transcription by studying the properties of a series of hybrid proteins containing RAP1 sequences fused to the DNA-binding domain of the yeast protein GAL4 (amino acids 1 to 147). GAL4 DNA-binding domain/RAP1 hybrids containing only the carboxy-terminal third of the RAP1 protein (which lacks the RAP1 DNA-binding domain) function as transcriptional activators of a reporter gene containing upstream GAL4 binding sites. Expression of some hybrids from the strong ADH1 promoter on multicopy plasmids has a dominant negative effect on silencers, leading to either partial or complete derepression of normally silenced genes. The GAL4/RAP1 hybrids have different effects on wild-type and several mutated but functional silencers. Silencers lacking either an autonomously replicating sequence consensus element or the RAP1 binding site are strongly derepressed, whereas the wild-type silencer or a silencer containing a deletion of the binding site for another silencer-binding protein, ABF1, are only weakly affected by hybrid expression. By examining a series of GAL4 DNA-binding domain/RAP1 hybrids, we have mapped the transcriptional activation and derepression functions to specific parts of the RAP1 carboxy terminus.(ABSTRACT TRUNCATED AT 250 WORDS)

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Sequence and functional analysis of the positively acting regulatory gene amdR from Aspergillus nidulans.

1990 ◽  
Vol 10 (6) ◽  
pp. 3194-3203 ◽  
Author(s):  
A Andrianopoulos ◽  
M J Hynes
Keyword(s):  
Dna Binding ◽  
Aspergillus Nidulans ◽  
Nuclear Localization ◽  
Regulatory Gene ◽  
Transcription Activation ◽  
Binding Motif ◽  
Wild Type ◽  
Amino Terminal ◽  
Carboxyl Terminal

The positively acting regulatory gene amdR of Aspergillus nidulans coordinately regulates the expression of five structural genes involved in the catabolism of certain amides (amdS), omega amino acids (gatA and gabA), and lactams (lamA and lamB) in the presence of omega amino acid inducers. Analysis of the amdR gene showed that it contains three small introns, heterogeneous 5' and 3' transcription sites, and multiple AUG codons prior to the major AUG initiator. The predicted amdR protein sequence has a cysteine-rich "zinc finger" DNA-binding motif at the amino-terminal end, four putative acidic transcription activation motifs in the carboxyl-terminal half, and two sequences homologous to the simian virus 40 large T antigen nuclear localization motif. These nuclear localization sequences overlap the cysteine-rich DNA-binding motif. A series of 5', 3', and internal deletions were examined in vivo for transcription activator function and showed that the amdR product contains at least two activation regions in the carboxyl-terminal half. Each of these activator amdR product contains at least two activation regions in the carboxyl-terminal half. Each of these activator regions may function independently, but both are required for wild-type levels of transcription activation. A number of the amdR deletion products were found to compete with the wild-type amdR product in vivo. Development of a rapid method for the localization of amdR mutations is presented, and using this technique, we localized and sequenced the mutation in the semiconstitutive amdR6c allele. The amdR6c missense mutation occurs in the middle of the gene, and it is suggested that it results in an altered protein which activates gene expression efficiently in the absence of an inducer.

scholarly journals Dissection of a carboxy-terminal region of the yeast regulatory protein RAP1 with effects on both transcriptional activation and silencing.

1992 ◽  
Vol 12 (3) ◽  
pp. 1209-1217 ◽  
Author(s):  
C F Hardy ◽  
D Balderes ◽  
D Shore
Keyword(s):  
Dna Binding ◽  
Binding Site ◽  
Transcriptional Activation ◽  
Binding Sites ◽  
Binding Protein ◽  
Binding Domain ◽  
Dominant Negative Effect ◽  
Dna Binding Domain ◽  
Wild Type ◽  
Carboxy Terminal

RAP1 is an essential sequence-specific DNA-binding protein in Saccharomyces cerevisiae whose binding sites are found in a large number of promoters, where they function as upstream activation sites, and at the silencer elements of the HMR and HML mating-type loci, where they are important for repression. We have examined the involvement of specific regions of the RAP1 protein in both repression and activation of transcription by studying the properties of a series of hybrid proteins containing RAP1 sequences fused to the DNA-binding domain of the yeast protein GAL4 (amino acids 1 to 147). GAL4 DNA-binding domain/RAP1 hybrids containing only the carboxy-terminal third of the RAP1 protein (which lacks the RAP1 DNA-binding domain) function as transcriptional activators of a reporter gene containing upstream GAL4 binding sites. Expression of some hybrids from the strong ADH1 promoter on multicopy plasmids has a dominant negative effect on silencers, leading to either partial or complete derepression of normally silenced genes. The GAL4/RAP1 hybrids have different effects on wild-type and several mutated but functional silencers. Silencers lacking either an autonomously replicating sequence consensus element or the RAP1 binding site are strongly derepressed, whereas the wild-type silencer or a silencer containing a deletion of the binding site for another silencer-binding protein, ABF1, are only weakly affected by hybrid expression. By examining a series of GAL4 DNA-binding domain/RAP1 hybrids, we have mapped the transcriptional activation and derepression functions to specific parts of the RAP1 carboxy terminus.(ABSTRACT TRUNCATED AT 250 WORDS)

scholarly journals NABP1, a novel RORγ-regulated gene encoding a single-stranded nucleic-acid-binding protein

2006 ◽  
Vol 397 (1) ◽  
pp. 89-99 ◽  
Author(s):  
Hong Soon Kang ◽  
Ju Youn Beak ◽  
Yong-Sik Kim ◽  
Robert M. Petrovich ◽  
Jennifer B. Collins ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
Nucleic Acids ◽  
Binding Protein ◽  
Size Exclusion ◽  
Binding Motif ◽  
Nucleic Acid Binding ◽  
Wild Type ◽  
Gene Encoding ◽  
Nucleic Acid Binding Protein ◽  
Acid Binding Protein

RORγ2 (retinoid-related orphan receptor γ2) plays a critical role in the regulation of thymopoiesis. Microarray analysis was performed in order to uncover differences in gene expression between thymocytes of wild-type and RORγ−/− mice. This analysis identified a novel gene encoding a 22 kDa protein, referred to as NABP1 (nucleic-acid-binding protein 1). This subsequently led to the identification of an additional protein, closely related to NABP1, designated NABP2. Both proteins contain an OB (oligonucleotide/oligosaccharide binding) motif at their N-terminus. This motif is highly conserved between the two proteins. NABP1 is highly expressed in the thymus of wild-type mice and is greatly suppressed in RORγ−/− mice. During thymopoiesis, NABP1 mRNA expression is restricted to CD4+CD8+ thymocytes, an expression pattern similar to that observed for RORγ2. These observations appear to suggest that NABP1 expression is regulated either directly or indirectly by RORγ2. Confocal microscopic analysis showed that the NABP1 protein localizes to the nucleus. Analysis of nuclear proteins by size-exclusion chromatography indicated that NABP1 is part of a high molecular-mass protein complex. Since the OB-fold is frequently involved in the recognition of nucleic acids, the interaction of NABP1 with various nucleic acids was examined. Our results demonstrate that NABP1 binds single-stranded nucleic acids, but not double-stranded DNA, suggesting that it functions as a single-stranded nucleic acid binding protein.

scholarly journals A novel DNA-binding motif in the nuclear matrix attachment DNA-binding protein SATB1.

1994 ◽  
Vol 14 (3) ◽  
pp. 1852-1860 ◽  
Author(s):  
K Nakagomi ◽  
Y Kohwi ◽  
L A Dickinson ◽  
T Kohwi-Shigematsu
Keyword(s):  
Amino Acid ◽  
Dna Binding ◽  
Direct Contact ◽  
Binding Protein ◽  
Binding Activity ◽  
Binding Domain ◽  
Binding Motif ◽  
Dna Binding Domain ◽  
Sequence Context ◽  
Dna Binding Activity

The nuclear matrix attachment DNA (MAR) binding protein SATB1 is a sequence context-specific binding protein that binds in the minor groove, making virtually no contact with the DNA bases. The SATB1 binding sites consist of a special AT-rich sequence context in which one strand is well-mixed A's, T's, and C's, excluding G's (ATC sequences), which is typically found in clusters within different MARs. To determine the extent of conservation of the SATB1 gene among different species, we cloned a mouse homolog of the human STAB1 cDNA from a cDNA expression library of the mouse thymus, the tissue in which this protein is predominantly expressed. This mouse cDNA encodes a 764-amino-acid protein with a 98% homology in amino acid sequence to the human SATB1 originally cloned from testis. To characterize the DNA binding domain of this novel class of protein, we used the mouse SATB1 cDNA and delineated a 150-amino-acid polypeptide as the binding domain. This region confers full DNA binding activity, recognizes the specific sequence context, and makes direct contact with DNA at the same nucleotides as the whole protein. This DNA binding domain contains a novel DNA binding motif: when no more than 21 amino acids at either the N- or C-terminal end of the binding domain are deleted, the majority of the DNA binding activity is lost. The concomitant presence of both terminal sequences is mandatory for binding. These two terminal regions consist of hydrophilic amino acids and share homologous sequences that are different from those of any known DNA binding motifs. We propose that the DNA binding region of SATB1 extends its two terminal regions toward DNA to make direct contact with DNA.

Sign in / Sign up

Export Citation Format

Share Document