scholarly journals CD8 T Cells in Innate Immune Responses: Using STAT4-Dependent but Antigen-Independent Pathways to Gamma Interferon during Viral Infection

mBio ◽  
2014 ◽  
Vol 5 (5) ◽  
Author(s):  
Jenny E. Suarez-Ramirez ◽  
Margarite L. Tarrio ◽  
Kwangsin Kim ◽  
Delia A. Demers ◽  
Christine A. Biron
Keyword(s):  
Innate Immunity ◽  
T Cells ◽  
Immune Responses ◽  
Cd8 T Cells ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Innate Immune Responses ◽  
Ifn Γ

ABSTRACT The cytokine gamma interferon (IFN-γ), with antimicrobial and immunoregulatory functions, can be produced by T cells following stimulation through their T cell receptors (TCRs) for antigen. The innate cytokines type 1 IFNs and interleukin-12 (IL-12) can also stimulate IFN-γ production by natural killer (NK) but not naive T cells. High basal expression of signal transducer and activator of transcription 4 (STAT4), used by type 1 IFN and IL-12 to induce IFN-γ as well as CD25, contributes to the NK cell responses. During acute viral infections, antigen-specific CD8 T cells are stimulated to express elevated STAT4 and respond to the innate factors with IFN-γ production. Little is known about the requirements for cytokine compared to TCR stimulation. Primary infections of mice with lymphocytic choriomeningitis virus (LCMV) demonstrated that although the elicited antigen-specific CD8 T cells acquired STAT4-dependent innate cytokine responsiveness for IFN-γ and CD25 induction ex vivo, TCR stimulation induced these through STAT4-independent pathways. During secondary infections, LCMV-immune CD8 T cells had STAT4-dependent IFN-γ expression at times of innate cytokine induction but subsequently expanded through STAT4-independent pathways. At times of innate cytokine responses during infection with the antigen-distinct murine cytomegalovirus virus (MCMV), NK and LCMV-immune CD8 T cells both had activation of pSTAT4 and IFN-γ. The T cell IFN-γ response was STAT4 and IL-12 dependent, but antigen-dependent expansion was absent. By dissecting requirements for STAT4 and antigen, this work provides novel insights into the endogenous regulation of cytokine and proliferative responses and demonstrates conditioning of innate immunity by experience. IMPORTANCE Understanding the regulation and function of adaptive immunity is key to the development of new and improved vaccines. Its CD8 T cells are activated through antigen-specific receptors to contribute to long-lasting immunity after natural infections or purposeful immunization. The antigen-receptor pathway of stimulation can lead to production of gamma interferon (IFN-γ), a cytokine having both direct antimicrobial and immunoregulatory functions. Natural killer cells can also produce IFN-γ in response to the innate cytokines type 1 IFNs and/or interleukin-12. This work demonstrates that CD8 T cells acquire parallel responsiveness to innate cytokine signaling for IFN-γ expression during their selection and development and maintain this capability to participate in innate immune responses as long-lived memory cells. Thus, CD8 T cells are conditioned to play a role in innate immunity, and their presence under immune conditions has the potential to regulate resistance to either secondary challenges or primary infections with unrelated agents.

scholarly journals Myd88 Initiates Early Innate Immune Responses and Promotes CD4 T Cells during Coronavirus Encephalomyelitis

2015 ◽  
Vol 89 (18) ◽  
pp. 9299-9312 ◽  
Author(s):  
Niranjan Butchi ◽  
Parul Kapil ◽  
Shweta Puntambekar ◽  
Stephen A. Stohlman ◽  
David R. Hinton ◽  
...  
Keyword(s):  
T Cells ◽  
T Cell ◽  
Immune Responses ◽  
Cd8 T Cells ◽  
Innate Immune ◽  
Cd4 T Cell ◽  
Innate Immune Responses ◽  
Ifn Γ ◽  
Myd88 Signaling ◽  
Proinflammatory Factors

ABSTRACTMyd88 signaling is critical to the control of numerous central nervous system (CNS) infections by promoting both innate and adaptive immune responses. Nevertheless, the extent to which Myd88 regulates type I interferon (IFN) versus proinflammatory factors and T cell function, as well as the anatomical site of action, varies extensively with the pathogen. CNS infection by neurotropic coronavirus with replication confined to the brain and spinal cord induces protective IFN-α/β via Myd88-independent activation of melanoma differentiation-associated gene 5 (MDA5). However, a contribution of Myd88-dependent signals to CNS pathogenesis has not been assessed. Infected Myd88−/−mice failed to control virus, exhibited enhanced clinical disease coincident with increased demyelination, and succumbed to infection within 3 weeks. The induction of IFN-α/β, as well as of proinflammatory cytokines and chemokines, was impaired early during infection. However, defects in both IFN-α/β and select proinflammatory factors were rapidly overcome prior to T cell recruitment. Myd88 deficiency also specifically blunted myeloid and CD4 T cell recruitment into the CNS without affecting CD8 T cells. Moreover, CD4 T cells but not CD8 T cells were impaired in IFN-γ production. Ineffective virus control indeed correlated most prominently with reduced antiviral IFN-γ in the CNS of Myd88−/−mice. The results demonstrate a crucial role for Myd88 both in early induction of innate immune responses during coronavirus-induced encephalomyelitis and in specifically promoting protective CD4 T cell activation. In the absence of these responses, functional CD8 T cells are insufficient to control viral spread within the CNS, resulting in severe demyelination.IMPORTANCEDuring central nervous system (CNS) infections, signaling through the adaptor protein Myd88 promotes both innate and adaptive immune responses. The extent to which Myd88 regulates antiviral type I IFN, proinflammatory factors, adaptive immunity, and pathology is pathogen dependent. These results reveal that Myd88 protects from lethal neurotropic coronavirus-induced encephalomyelitis by accelerating but not enhancing the induction of IFN-α/β, as well as by promoting peripheral activation and CNS accumulation of virus-specific CD4 T cells secreting IFN-γ. By controlling both early innate immune responses and CD4 T cell-mediated antiviral IFN-γ, Myd88 signaling limits the initial viral dissemination and is vital for T cell-mediated control of viral loads. Uncontrolled viral replication in the absence of Myd88 leads to severe demyelination and pathology despite overall reduced inflammatory responses. These data support a vital role of Myd88 signaling in protective antimicrobial functions in the CNS by promoting proinflammatory mediators and T cell-mediated IFN-γ production.

Phagocytosis May Be a Regulatory Mechanism for Myeloid Dendritic Cells to Terminate Type 1 CD8+ T Cells.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 1654-1654
Author(s):  
Young-June Kim ◽  
Hal E. Broxmeyer
Keyword(s):  
T Cells ◽  
Immune Responses ◽  
Cd8 T Cells ◽  
Phagocytic Activity ◽  
Regulatory Mechanism ◽  
Gm Csf ◽  
T Cell Immune Responses ◽  
Ifn Γ

Abstract Abstract 1654 Poster Board I-680 CD8+ cytotoxic T cells are often ‘exhausted’ by programmed death-1 (PD-1) signaling, and subsequently the functions of these cells are terminated especially in a tumor environment or upon chronic HIV or HCV infection. Subsets of myeloid cells referred to as myeloid derived suppressor cells (MDSC) or regulatory dendritic cells (DCs) have been implicated in inducing exhaustion or termination of effector CD8+ T cells. To this end, we developed various myeloid-derived dendritic cell (DC) types in vitro from human CD14+ monocytes using M-CSF or GM-CSF in the presence of IL-4 with/without other cytokines, and characterized these DCs with respect to their capacity to induce PD-1 expression on and exhaustion of CD8+ T cells. We then assessed their impact on longevity of CD8+ T cells following coculture. Myeloid DCs developed in vitro with M-CSF and IL-4 for 5 days (referred to as M-DC) did not express ligand for PD-1 (PD-L1) nor did they induce PD-1 on CD8+ T cells. Thus, using M-DCs as starting cells, we sought determinant factors that could modulate M-DCs to express PD-L1 and thereby induce exhaustion of CD8+ T cells. In order to better monitor exhaustion processes, we incubated human peripheral CD8+ T cells for 5 days in the presence of IL-15, an important cytokine for maintaining viability, before coculture. M-DCs showed little impact on exhaustion or longevity of the CD8+ T cells. IL-10 converted M-DC into a distinct myeloid DC subset (referred to as M-DC/IL-10) with an ability to express PD-L1 as well as to induce PD-1 on cocultured CD8+ T cells. M-DC/IL-10 cells markedly suppressed proliferation of cocultured CD8+ T cells. M-DC/IL-10 cells were morphologically unique with many granules and filamentous structures around the cell periphery. These IL-10 effects on M-DC were completely abrogated in the presence of TNF-á. M-DC/IL-10 cells could be further differentiated into another myeloid DC subset in the presence of IFN-γ (referred to as M-DC/IL-10/IFN-γ) with an ability to express even higher levels of PD-L1 compared to M-DC/IL-10 cells. The most remarkable effect of M-DC/IL-10/IFN-γ cells on cocultured CD8+ T cells was a dramatic loss of CD8+ T cells. Light and confocal microscopic observations indicated that loss of CD8+ T cells was due to phagocytosis by M-DC/IL-10/IFN-γ cells. As IFN-γ, a type 1 cytokine which is induced in CD8+ T cells by IL-12 is essential for phagocytosis, we tested whether IL-12 treatment of CD8+ T cells could further enhance phagocytosis induced by M-DC/IL-10/IFN-γ cells. Indeed, IL-12 treatment greatly increased numbers of phagocytosed CD8+ T cells. In contrast, IL-4 treated CD8+ T cells became resistant to phagocytosis, suggesting IFN-γ producing (type1) CD8+ T cells may be primary target cells for the M-DC/IL-10 cells mediated phagocytosis. CD4+ T cells were not as susceptible as CD8+ T cells to phagocytosis. We failed to detect such phagocytic activity induced by prototype DCs generated with GM-CSF and IL-4. Phagocytic activity was not inhibited by various arginase-1 inhibitors suggesting that nitric oxide signaling may not mediate phagocytic activity. Neutralizing antibody to PD-L1 slightly but significantly lowered phagocytic activity suggesting that PD-L1/PD-1 interaction may be partially involved in this process. Myeloid DCs are thought to be immunogenic, actively inducing T cell immune responses. Our results demonstrate that myeloid DCs may play suppressive roles as well through induction of phagocytic activity, especially against IFN-γ producing CD8+ T cells. This may serve as a regulatory mechanism for type 1 CD8+ T cell immune responses in an IL-10 enriched microenvironment. Disclosures No relevant conflicts of interest to declare.

scholarly journals Perillaldehyde Inhibition of cGAS Reduces dsDNA-Induced Interferon Response

2021 ◽  
Vol 12 ◽  
Author(s):  
Lei Chu ◽  
Chenhui Li ◽  
Yongxing Li ◽  
Qiuya Yu ◽  
Huansha Yu ◽  
...  
Keyword(s):  
Innate Immunity ◽  
Herpes Simplex ◽  
Immune Responses ◽  
Therapeutic Benefit ◽  
Perilla Frutescens ◽  
Innate Immune ◽  
Interferon Response ◽  
Innate Immune Responses ◽  
Simplex Virus

Cyclic GMP-AMP synthase (cGAS), serving as a primary sensor of intracellular DNA, is essential to initiate anti-microbial innate immunity. Inappropriate activation of cGAS by self-DNA promotes severe autoinflammatory diseases such as Aicardi–Goutières syndrome (AGS); thus, inhibition of cGAS may provide therapeutic benefit in anti-autoimmunity. Here we report that perillaldehyde (PAH), a natural monoterpenoid compound derived from Perilla frutescens, suppresses cytosolic-DNA-induced innate immune responses by inhibiting cGAS activity. Mice treated with PAH are more susceptible to herpes simplex virus type 1 (HSV-1) infection. Moreover, administration with PAH markedly ameliorates self-DNA-induced autoinflammatory responses in a mouse model of AGS. Collectively, our study reveals that PAH can effectively inhibit cGAS-STING signaling and could be developed toward the treatment of cGAS-mediated autoimmune diseases.

scholarly journals Hydrolysis of Interleukin-12 by Porphyromonas gingivalis Major Cysteine Proteinases May Affect Local Gamma Interferon Accumulation and the Th1 or Th2 T-Cell Phenotype in Periodontitis

2001 ◽  
Vol 69 (9) ◽  
pp. 5650-5660 ◽  
Author(s):  
Peter L. W. Yun ◽  
Arthur A. Decarlo ◽  
Charles Collyer ◽  
Neil Hunter
Keyword(s):  
T Cells ◽  
Porphyromonas Gingivalis ◽  
Disease Process ◽  
Gamma Interferon ◽  
Interleukin 12 ◽  
Cell Phenotype ◽  
Cysteine Proteinases ◽  
Cytokine Balance ◽  
Ifn Γ

ABSTRACT Porphyromonas gingivalis cysteine proteinases (gingipains) have been associated with virulence in destructive periodontitis, a disease process variously considered to represent an unregulated stimulation of either T helper type 1 (Th1)- or Th2-type cells. Critical in maintaining Th1 activity is the response of T lymphocytes to environmental interleukin 12 (IL-12) in the form of up-regulation of gamma interferon (IFN-γ) production. Here we demonstrate that in the presence or absence of serum, gingipains were able to hydrolyze IL-12 and reduce the IL-12-induced IFN-γ production from CD4+ T cells. However, the induction of IL-12 receptors on T cells by gingipains did not correlate with the enhancement of IFN-γ production. The gingipains cleaved IL-12 within the COOH-terminal region of the p40 and p35 subunit chains, which leads to IL-12 inactivity, whereas IL-2 in these assays was not affected. Inactivation of IL-12 by the gingipains could disrupt the cytokine balance or favor Th2 activities in the progression of periodontitis.

scholarly journals Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

2001 ◽  
Vol 69 (3) ◽  
pp. 1643-1649 ◽  
Author(s):  
Robert A. Gramzinski ◽  
Denise L. Doolan ◽  
Martha Sedegah ◽  
Heather L. Davis ◽  
Arthur M. Krieg ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
T Cells ◽  
Nk Cells ◽  
Gamma Interferon ◽  
Innate Immune ◽  
Interleukin 12 ◽  
Cpg Odn ◽  
Cpg Dinucleotides ◽  
Cpg Odns ◽  
Ifn Γ

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Innate immune responses and type 1 diabetes: A role for a long non-coding RNA?

2014 ◽  
Vol 9 (S 01) ◽  
Author(s):  
MP Ashton ◽  
I Tan ◽  
L Mackin ◽  
C Elso ◽  
E Chu ◽  
...  
Keyword(s):  
Type 1 Diabetes ◽  
Immune Responses ◽  
Innate Immune ◽  
Innate Immune Responses ◽  
Non Coding Rna ◽  
Long Non Coding Rna

scholarly journals Evidence for Differential Roles for NKG2D Receptor Signaling in Innate Host Defense against Coronavirus-Induced Neurological and Liver Disease

2007 ◽  
Vol 82 (6) ◽  
pp. 3021-3030 ◽  
Author(s):  
Kevin B. Walsh ◽  
Melissa B. Lodoen ◽  
Robert A. Edwards ◽  
Lewis L. Lanier ◽  
Thomas E. Lane
Keyword(s):  
Liver Disease ◽  
Immune Responses ◽  
Host Defense ◽  
Nk Cell ◽  
Hepatitis Virus ◽  
Innate Immune ◽  
Liver Pathology ◽  
Innate Immune Responses ◽  
Ifn Γ ◽  
The Brain

ABSTRACT Infection of SCID mice with a recombinant murine coronavirus (mouse hepatitis virus [MHV]) expressing the T-cell chemoattractant CXC chemokine ligand 10 (CXCL10) resulted in increased survival and reduced viral burden within the brain and liver compared to those of mice infected with an isogenic control virus (MHV), supporting an important role for CXCL10 in innate immune responses following viral infection. Enhanced protection in MHV-CXCL10-infected mice correlated with increased gamma interferon (IFN-γ) production by infiltrating natural killer (NK) cells within the brain and reduced liver pathology. To explore the underlying mechanisms associated with protection from disease in MHV-CXCL10-infected mice, the functional contributions of the NK cell-activating receptor NKG2D in host defense were examined. The administration of an NKG2D-blocking antibody to MHV-CXCL10-infected mice did not reduce survival, dampen IFN-γ production in the brain, or affect liver pathology. However, NKG2D neutralization increased viral titers within the liver, suggesting a protective role for NKG2D signaling in this organ. These data indicate that (i) CXCL10 enhances innate immune responses, resulting in protection from MHV-induced neurological and liver disease; (ii) elevated NK cell IFN-γ expression in the brain of MHV-CXCL10-infected mice occurs independently of NKG2D; and (iii) NKG2D signaling promotes antiviral activity within the livers of MHV-infected mice that is not dependent on IFN-γ and tumor necrosis factor alpha secretion.

scholarly journals Populations of Human T Lymphocytes That Traverse the Vascular Endothelium Stimulated by Borrelia burgdorferi Are Enriched with Cells That Secrete Gamma Interferon

2004 ◽  
Vol 72 (3) ◽  
pp. 1530-1536 ◽  
Author(s):  
Edna I. Gergel ◽  
Martha B. Furie
Keyword(s):  
T Cells ◽  
T Lymphocytes ◽  
Lyme Disease ◽  
Borrelia Burgdorferi ◽  
Vascular Endothelium ◽  
Human Peripheral Blood ◽  
Gamma Interferon ◽  
Interleukin 4 ◽  
Ifn Γ

ABSTRACT Some diseases are characterized by prevalence in the affected tissues of type 1 T lymphocytes, which secrete gamma interferon (IFN-γ) and other proinflammatory cytokines. For example, type 1 T cells predominate in the lesions of patients with Lyme disease, which is caused by the bacterium Borrelia burgdorferi. We used an in vitro model of the blood vessel wall to test the premise that the vascular endothelium actively recruits circulating type 1 T cells to such lesions. When T lymphocytes isolated from human peripheral blood were examined, the populations that traversed monolayers of resting human umbilical vein endothelial cells (HUVEC) or HUVEC stimulated by interleukin-1β or B. burgdorferi were markedly enriched for T cells that produced IFN-γ compared to the initially added population of T cells. No enrichment was seen for cells that produced interleukin-4, a marker for type 2 T lymphocytes. Very late antigen-4 and CD11/CD18 integrins mediated passage of the T cells across both resting and stimulated HUVEC, and the endothelium-derived chemokine CCL2 (monocyte chemoattractant protein 1) was responsible for the enhanced migration of T cells across stimulated HUVEC. These results suggest that the vascular endothelium may contribute to the selective accumulation of type 1 T cells in certain pathological lesions, including those of Lyme disease.

Sign in / Sign up

Export Citation Format

Share Document