Light trophic and signal roles in the control of morphogenesis of the Brassica plants developing storage roots

2009 ◽  
Vol 56 (2) ◽  
pp. 232-241 ◽  
Author(s):  
I. G. Tarakanov ◽  
J. Wang
Keyword(s):  
Storage Roots ◽  
Brassica Plants

Chromoplast Isolation and Its Proteomic Analysis from Cassava Storage Roots

2017 ◽  
Vol 43 (9) ◽  
pp. 1290
Author(s):  
Chang-Zhe DENG ◽  
Hui YAO ◽  
Fei-Fei AN ◽  
Kai-Mian LI ◽  
Song-Bi CHEN
Keyword(s):  
Proteomic Analysis ◽  
Storage Roots

scholarly journals Transcriptomic and Metabolic Profiling of High-Temperature Treated Storage Roots Reveals the Mechanism of Saccharification in Sweetpotato (Ipomoea batatas (L.) Lam.)

2021 ◽  
Vol 22 (13) ◽  
pp. 6641
Author(s):  
Chen Li ◽  
Meng Kou ◽  
Mohamed Hamed Arisha ◽  
Wei Tang ◽  
Meng Ma ◽  
...  
Keyword(s):  
High Temperature ◽  
Metabolic Pathways ◽  
Transcriptome Sequencing ◽  
Ipomoea Batatas ◽  
Sequencing Analysis ◽  
Storage Roots ◽  
Metabolic Analysis ◽  
Cooking Process

The saccharification of sweetpotato storage roots is a common phenomenon in the cooking process, which determines the edible quality of table use sweetpotato. In the present study, two high saccharified sweetpotato cultivars (Y25, Z13) and one low saccharified cultivar (X27) in two growth periods (S1, S2) were selected as materials to reveal the molecular mechanism of sweetpotato saccharification treated at high temperature by transcriptome sequencing and non-targeted metabolome determination. The results showed that the comprehensive taste score, sweetness, maltose content and starch change of X27 after steaming were significantly lower than those of Y25 and Z13. Through transcriptome sequencing analysis, 1918 and 1520 differentially expressed genes were obtained in the two periods of S1 and S2, respectively. Some saccharification-related transcription factors including MYB families, WRKY families, bHLH families and inhibitors were screened. Metabolic analysis showed that 162 differentially abundant metabolites related to carbohydrate metabolism were significantly enriched in starch and sucrose capitalization pathways. The correlation analysis between transcriptome and metabolome confirmed that the starch and sucrose metabolic pathways were significantly co-annotated, indicating that it is a vitally important metabolic pathway in the process of sweetpotato saccharification. The data obtained in this study can provide valuable resources for follow-up research on sweetpotato saccharification and will provide new insights and theoretical basis for table use sweetpotato breeding in the future.

scholarly journals A low-cost aeroponic phenotyping system for storage root development: unravelling the below-ground secrets of cassava (Manihot esculenta)

Plant Methods ◽  
2019 ◽  
Vol 15 (1) ◽  
Author(s):  
Michael Gomez Selvaraj ◽  
Maria Elker Montoya-P ◽  
John Atanbori ◽  
Andrew P. French ◽  
Tony Pridmore
Keyword(s):  
Root Growth ◽  
Root Development ◽  
Low Cost ◽  
Root Traits ◽  
Suitable Model ◽  
Root Initiation ◽  
Storage Root ◽  
Economic Traits ◽  
Storage Roots ◽  
Storage Root Development

Abstract Background Root and tuber crops are becoming more important for their high source of carbohydrates, next to cereals. Despite their commercial impact, there are significant knowledge gaps about the environmental and inherent regulation of storage root (SR) differentiation, due in part to the innate problems of studying storage roots and the lack of a suitable model system for monitoring storage root growth. The research presented here aimed to develop a reliable, low-cost effective system that enables the study of the factors influencing cassava storage root initiation and development. Results We explored simple, low-cost systems for the study of storage root biology. An aeroponics system described here is ideal for real-time monitoring of storage root development (SRD), and this was further validated using hormone studies. Our aeroponics-based auxin studies revealed that storage root initiation and development are adaptive responses, which are significantly enhanced by the exogenous auxin supply. Field and histological experiments were also conducted to confirm the auxin effect found in the aeroponics system. We also developed a simple digital imaging platform to quantify storage root growth and development traits. Correlation analysis confirmed that image-based estimation can be a surrogate for manual root phenotyping for several key traits. Conclusions The aeroponic system developed from this study is an effective tool for examining the root architecture of cassava during early SRD. The aeroponic system also provided novel insights into storage root formation by activating the auxin-dependent proliferation of secondary xylem parenchyma cells to induce the initial root thickening and bulking. The developed system can be of direct benefit to molecular biologists, breeders, and physiologists, allowing them to screen germplasm for root traits that correlate with improved economic traits.

scholarly journals Overexpression of the Golden SNP-Carrying Orange Gene Enhances Carotenoid Accumulation and Heat Stress Tolerance in Sweetpotato Plants

Antioxidants ◽  
2021 ◽  
Vol 10 (1) ◽  
pp. 51
Author(s):  
So-Eun Kim ◽  
Chan-Ju Lee ◽  
Sul-U Park ◽  
Ye-Hoon Lim ◽  
Woo Sung Park ◽  
...  
Keyword(s):  
Heat Stress ◽  
Stress Tolerance ◽  
Ipomoea Batatas ◽  
Radical Scavenging Activity ◽  
Radical Scavenging ◽  
Cauliflower Mosaic Virus ◽  
Carotenoid Content ◽  
35S Promoter ◽  
Storage Roots ◽  
Heat Stress Tolerance

Carotenoids function as photosynthetic accessory pigments, antioxidants, and vitamin A precursors. We recently showed that transgenic sweetpotato calli overexpressing the mutant sweetpotato (Ipomoea batatas [L.] Lam) Orange gene (IbOr-R96H), which carries a single nucleotide polymorphism responsible for Arg to His substitution at amino acid position 96, exhibited dramatically higher carotenoid content and abiotic stress tolerance than calli overexpressing the wild-type IbOr gene (IbOr-WT). In this study, we generated transgenic sweetpotato plants overexpressing IbOr-R96H under the control of the cauliflower mosaic virus (CaMV) 35S promoter via Agrobacterium-mediated transformation. The total carotenoid contents of IbOr-R96H storage roots (light-orange flesh) and IbOr-WT storage roots (light-yellow flesh) were 5.4–19.6 and 3.2-fold higher, respectively, than those of non-transgenic (NT) storage roots (white flesh). The β-carotene content of IbOr-R96H storage roots was up to 186.2-fold higher than that of NT storage roots. In addition, IbOr-R96H plants showed greater tolerance to heat stress (47 °C) than NT and IbOr-WT plants, possibly because of higher DPPH radical scavenging activity and ABA contents. These results indicate that IbOr-R96H is a promising strategy for developing new sweetpotato cultivars with improved carotenoid contents and heat stress tolerance.

Isolation and characterisation of invertase inhibitor from sweet potato storage roots

2008 ◽  
Vol 88 (15) ◽  
pp. 2615-2621 ◽  
Author(s):  
Guan-Jhong Huang ◽  
Ming-Jyh Sheu ◽  
Yuan-Shiun Chang ◽  
Te-Ling Lu ◽  
Heng-Yuan Chang ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Potato Storage ◽  
Storage Roots ◽  
Invertase Inhibitor

scholarly journals Modeling the impact of sweetpotato weevils on storage root yield

2018 ◽  
Vol 3 (1) ◽  
pp. 319-325
Author(s):  
Daniel A. Akansake ◽  
Putri E. Abidin ◽  
E. E. Carey
Keyword(s):  
Ipomoea Batatas ◽  
Soft Rot ◽  
Northern Ghana ◽  
Root Yield ◽  
Storage Roots ◽  
Yield Data ◽  
Level Of Significance ◽  
Attainable Yield ◽  
The Impact ◽  
Model Approach

Abstract This study estimated the amount of loss in storage roots caused by various levels of damage caused by sweetpotato weevils (Cylas spp). Seven varieties of sweetpotato (Ipomoea batatas L. (Lam)) were evaluated in three production sites in northern Ghana for two years (2014 and 2015). Yield data for each experimental plot were collected. A regression analysis was carried out using the generalized linear model approach. In the study, nonmarketable roots were classified as all undersized roots (<100g) and spoilt roots due to weevil, millipede, and soft rot. The results indicated weevil damage as the only significant predictor of nonmarketable yield at 5% level of significance. From the study, the average values for total root yield, marketable root yield, and nonmarketable root yield were 9.39, 6.71, and 2.67 ton/ha respectively. The minimum weevil damage (score 2) resulted in a yield loss of 2 ton/ha which represents 8.3% while severe damage at score 9 could cause a loss of 7.43 ton/ha of storage roots representing 31% of the attainable yield of sweetpotato. Weevil susceptibility needs to be treated as a serious trait when evaluating sweetpotato genotypes to be released as varieties.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Surface Chemical Differences Between Sweetpotato Lines with Varying Levels of Resistance to the Sweetpotato Weevil

1990 ◽  
Vol 115 (4) ◽  
pp. 696-699 ◽  
Author(s):  
Ki-Cheol Son ◽  
Ray F. Severson ◽  
Richard F. Arrendale ◽  
Stanley J. Kays
Keyword(s):  
Ipomoea Batatas ◽  
Methylene Chloride ◽  
Chemical Characterization ◽  
Fused Silica ◽  
Storage Roots ◽  
Sweetpotato Weevil ◽  
Or Groups ◽  
Fused Silica Capillary ◽  
Silica Capillary Column

Methodology was developed for the extraction of surface components of sweetpotato [Ipomoea batatas (L.) Lam.] storage roots. Surface components of storage roots were quantitatively extracted with methylene chloride using 8-minute ultrasonication. After removal of the solvent, the extract was treated with 3 Tri Sil-Z:1 trimethylsilylimidazol (v/v) to convert components with hydroxyl moieties to silyl ethers and then separated on a SE-54 fused silica capillary column. Distinctly different gas chromatography profiles were found between lines displaying moderate levels of resistance (`Resisto', `Regal', `Jewel') to the sweetpotato weevil [Cylas formicarius elgantulus (summers)] and weevil-susceptible lines (`Centennial', SC 1149-19, W-115), indicating a possible role of surface components in insect response. Chromatographic fractionation techniques were developed for separation of major components or groups of components. The results will allow subsequent bioassaying for the presence of an ovipositional stimulant(s) and other weevil behavior-modulating compounds and their chemical characterization.

Sign in / Sign up

Export Citation Format

Share Document