Triose phosphate isomerase of Stellaria longipes (Caryophyllaceae)

Genome ◽  
1994 ◽  
Vol 37 (1) ◽  
pp. 148-156 ◽  
Author(s):  
Xing-Hai Zhang ◽  
C. C. Chinnappa
Keyword(s):  
Amino Acid ◽  
Blot Hybridization ◽  
Triose Phosphate Isomerase ◽  
Amino Acid Sequences ◽  
Ecological Effect ◽  
Northern Blot Hybridization ◽  
Specific Expression ◽  
Stellaria Longipes ◽  
Triose Phosphate ◽  
Low Degree

A cDNA encoding triose phosphate isomerase (TPI) of Stellaria longipes has been isolated and sequenced. The TPI of S. longipes exhibits high similarity to the TPIs from other species at both the nucleotide and amino acid levels. Southern blot analysis showed that the S. longipes genome contained multiple TPI-like nucleotide sequences and only a low degree of polymorphism was observed among genotypes of different habitats. The levels of TPI mRNA, detected by hybridization to the TPI cDNA, appeared similar between the genotypes. However, different genotypes showed variations in the total TPI activity, reflecting the possible ecological effect on the TPI gene expression. Northern blot hybridization to the cDNA also indicated a higher level of TPI mRNA in leaves than in roots, suggesting tissue-specific expression of TPI gene(s). Phylogenetic analysis of the TPI amino acid sequences from 16 taxa suggested that the TPI from S. longipes was more closely related to cytosolic TPIs from other plants than it was to TPIs from prokaryotes.Key words: triose phosphate isomerase, Stellaria longipes, genotype, ecotypes, molecular phylogeny.

scholarly journals Amino acid sequences around the cysteine residues of rabbit muscle triose phosphate isomerase

1971 ◽  
Vol 122 (2) ◽  
pp. 209-218 ◽  
Author(s):  
Janet C. Miller ◽  
S. G. Waley
Keyword(s):  
Amino Acid ◽  
Cyanogen Bromide ◽  
Triose Phosphate Isomerase ◽  
Amino Acid Sequences ◽  
Cysteine Residues ◽  
Rabbit Muscle ◽  
Amino Acid Residues ◽  
Triose Phosphate ◽  
Methionine Residues ◽  
Polypeptide Chains

1. The nature of the subunits in rabbit muscle triose phosphate isomerase has been investigated. 2. Amino acid analyses show that there are five cysteine residues and two methionine residues/subunit. 3. The amino acid sequences around the cysteine residues have been determined; these account for about 75 residues. 4. Cleavage at the methionine residues with cyanogen bromide gave three fragments. 5. These results show that the subunits correspond to polypeptide chains, containing about 230 amino acid residues. The chains in triose phosphate isomerase seem to be shorter than those of other glycolytic enzymes.

scholarly journals Expression of heparanase mRNA in bovine placenta during gestation

Reproduction ◽  
2001 ◽  
pp. 573-580 ◽  
Author(s):  
K Kizaki ◽  
H Nakano ◽  
H Nakano ◽  
T Takahashi ◽  
K Imai ◽  
...  
Keyword(s):  
Amino Acid ◽  
Blot Hybridization ◽  
Amino Acid Sequences ◽  
Pcr Analysis ◽  
Fetal Membrane ◽  
Northern Blot Hybridization ◽  
Amino Acid Residues ◽  
Placental Development ◽  
Bovine Placenta ◽  
And Function

This study reports the identification and sequence of a partial cDNA for bovine heparanase and the expression of its mRNA in the placenta during gestation. The 364 amino acid residues deduced from the 1092 bp cDNA fragment share 81.9% and 80.5% identity with amino acid sequences of human and rat heparanase, respectively. Northern blot hybridization showed that two mRNAs (2.0 and 3.5 kb) are strongly expressed in placenta, and weakly expressed in the kidney, lung, spleen and non-pregnant uterus. In the placenta, these transcripts were detected in the cotyledon at all stages of gestation examined, and in the intercotyledonary fetal membrane and caruncle on day 60, day 120 and day 260. Quantitative real-time RT-PCR analysis showed very low expression of heparanase mRNA in the conceptus before implantation (day 17), but high expression in the cotyledon-containing fetal membrane (days 27-34) after implantation. Furthermore, heparanase mRNA was detected in the cotyledon, intercotyledonary fetal membrane and caruncle after days 60-64 of gestation. However, no significant expression of heparanase mRNA was observed in intercaruncular endometrium at all stages of gestation examined. These results demonstrate that heparanase mRNA is expressed in the placentome, indicating that heparanase may play a role in implantation, and in placental development and function.

scholarly journals Identification of Stress-Responsive Genes in Streptococcus mutans by Differential Display Reverse Transcription-PCR

2001 ◽  
Vol 69 (4) ◽  
pp. 2493-2501 ◽  
Author(s):  
Jean-San Chia ◽  
Ya-Yu Lee ◽  
Peng-Tu Huang ◽  
Jen-Yang Chen
Keyword(s):  
Amino Acid ◽  
Environmental Stress ◽  
Streptococcus Mutans ◽  
Differential Display ◽  
Acid Treatment ◽  
Blot Hybridization ◽  
Stress Protein ◽  
Transcriptional Level ◽  
Northern Blot Hybridization ◽  
High Osmolarity

ABSTRACT Streptococcus mutans, which causes dental caries in the human oral cavity and occasionally causes infective endocarditis in the heart, withstands adverse environmental stress through diverse alterations in protein synthesis. Differential gene expression in response to environmental stress was analyzed by RNA fingerprinting using arbitrarily primed PCR with a panel of 11mer primers designed for differential display in Enterobacteriaceae. Dot and Northern blot hybridization confirmed that the transcription of several genes was up- or down-regulated following exposure to acid shock from pH 7.5 to 5.5. RNA of a gene designated AP-185 (acid-stress protein) was induced specifically by acid treatment, while RNA of GSP-781 (general-stress protein) was up-regulated significantly when bacteria were exposed to high osmolarity and temperature, as well as low pH. The deduced amino acid sequence of AP-185 shares homology (78% identity) with branched-chain amino acid aminotransferase. Cloning and sequence analysis of GSP-781 revealed a potential secreted protein of a molecular mass of about 43 kDa and with a pI predicted to be 5.5. Transcriptional levels of another gene, designated AR-186 (acid-repressed protein), which encodes putative aconitase, were repressed by acid treatment but were enhanced by plasma or serum components. Analogous results were identified in icd andcitZ genes, and repression of these genes, along with AR-186, was also observed when they were exposed to high osmolarity and temperature. These results indicate that differential regulation of specific genes at the transcriptional level is triggered by different stress and that genes responsible for glutamate biosynthesis in the citrate pathway are coordinately regulated during the stress response of S. mutans.

Bovine Pancreatic Preproelastases I and II: Comparison of Nucleotide and Amino Acid Sequences and Tissue Specific Expression

1997 ◽  
Vol 118 (1) ◽  
pp. 181-187 ◽  
Author(s):  
Martine Gestin ◽  
Isabelle Le Huërou-Luron ◽  
Catherine Wicker-Planquart ◽  
Gwenola Le Dréan ◽  
Jean-Claude Chaix ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Tissue Specific ◽  
Tissue Specific Expression

scholarly journals Molecular characterization and expression of the stratification-related cytokeratins 4 and 15.

1988 ◽  
Vol 106 (4) ◽  
pp. 1249-1261 ◽  
Author(s):  
R E Leube ◽  
B L Bader ◽  
F X Bosch ◽  
R Zimbelmann ◽  
T Achtstaetter ◽  
...  
Keyword(s):  
Basal Cell ◽  
Blot Hybridization ◽  
Northern Blot Hybridization ◽  
Type I ◽  
Specific Expression ◽  
Genes Encoding ◽  
Cell Layers ◽  
Hybridization In Situ ◽  
Stratified Epithelia

A number of human cytokeratins are expressed during the development of stratified epithelia from one-layered polar epithelia and continue to be expressed in several adult epithelial tissues. For studies of the regulation of the synthesis of stratification-related cytokeratins in internal tissues, we have prepared cDNA and genomic clones encoding cytokeratin 4, as a representative of the basic (type II) cytokeratin subfamily and cytokeratin 15, as representative of the acidic (type I) subfamily, and determined their nucleotide sequences. The specific expression of mRNAs encoding these two polypeptides in certain stratified tissues and cultured cell lines is demonstrated by Northern blot hybridization. Hybridization in situ with antisense riboprobes and/or synthetic oligonucleotides shows the presence of cytokeratin 15 mRNA in all layers of esophagus, whereas cytokeratin 4 mRNA tends to be suprabasally enriched, although to degrees varying in different regions. We conclude that the expression of the genes encoding these stratification-related cytokeratins starts already in the basal cell layer and does not depend on vertical differentiation and detachment from the basal lamina. Our results also show that simple epithelial and stratification-related cytokeratins can be coexpressed in basal cell layers of certain stratified epithelia such as esophagus. Implications of these findings for epithelial differentiation and the formation of squamous cell carcinomas are discussed.

scholarly journals 348 SENESCENCE OF DAYLILY (HEMEROCALLIS) IS ASSOCIATED WITH EXPRESSION OF A MADS-BOX GENE

HortScience ◽  
1994 ◽  
Vol 29 (5) ◽  
pp. 480e-480
Author(s):  
Nathan E. Lange ◽  
Michael S. Reid ◽  
Victoriano Valpuesta ◽  
Consuelo Guerrero ◽  
Miguel A. Botella
Keyword(s):  
Transcription Factor ◽  
Transcription Factors ◽  
Amino Acid ◽  
Blot Hybridization ◽  
Flower Senescence ◽  
Northern Blot Hybridization ◽  
Mads Box ◽  
Homologous Genes ◽  
Mads Box Gene ◽  
Commercially Important

As in many commercially important flowers, especially the monocotyledonous geophytes, senescence of the ephemeral daylily flower (Hemerocallis) does not involve ethylene. By differentially screening a cDNA library constructed from mRNA extracted from daylily petals in the earliest stages of senescence, clones were isolated whose transcription is up-regulated coordinately with the onset of senescence. One of these clones, sen12, was found to be a transcription factor. The deduced amino acid sequence of sen12 contains a MADS-box and an associated K-box similar to transcription factors suggested to control floral morphogenesis in a variety of different species. Northern blot hybridization showed sen12 to be highly upregulated before and during visible flower senescence. The expression of homologous genes during senescence of other flowers will be reported.

Proteomic analysis reveals developmentally expressed rice homologues of grass group II pollen allergens

2003 ◽  
Vol 30 (8) ◽  
pp. 843 ◽  
Author(s):  
Tursun Kerim ◽  
Nijat Imin ◽  
Jeremy J. Weinman ◽  
Barry G. Rolfe
Keyword(s):  
Amino Acid ◽  
Polyclonal Antibodies ◽  
Protein Sequences ◽  
Cross Reactivity ◽  
Amino Acid Sequences ◽  
Pollen Allergens ◽  
Specific Expression ◽  
Group I ◽  
Group Ii ◽  
Sequence Profiles

Three isoallergens of Ory s 2, homologues of grass group II pollen allergens, were identified from rice and characterised by proteome and immunochemical analyses. The N-terminal amino acid sequence profiles of three proteins on a 2-dimensional electrophoresis (2-DE) gel of rice pollen proteins matched 100% to the protein sequences encoded by three rice expressed sequence tags (ESTs). The deduced protein sequences from these ESTs share sequence identities of 41–43% with the protein sequences of the group II pollen allergens of different grasses, and sequence identity of 39% with the C-terminal portion of rice group I pollen allergens. Signal peptide sequences, which are similar to the leader peptides of other major pollen allergens, are also present in the deduced amino acid sequences. Polyclonal antibodies, produced in rabbits using Ory s 2 proteins purified by 2-DE, were used to investigate the developmental-stage- and tissue-specific expression of Ory s 2 by immunochemical analysis. Results of immunochemical experiments show that Ory s 2 proteins are expressed only at the late stage of pollen development and they do not have cross-reactivity with group II pollen allergens from some other common grasses.

An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Catalytic Domain ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Blue Copper ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases ◽  
Lignin Deposition

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

scholarly journals Cloning and expression of the gene for periplasmic poly(vinyl alcohol) dehydrogenase from Sphingomonas sp. strain 113P3, a novel-type quinohaemoprotein alcohol dehydrogenase

Microbiology ◽  
2006 ◽  
Vol 152 (7) ◽  
pp. 1941-1949 ◽  
Author(s):  
Rie Hirota-Mamoto ◽  
Ryoko Nagai ◽  
Shinjiro Tachibana ◽  
Masaaki Yasuda ◽  
Akio Tani ◽  
...  
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Alcohol Dehydrogenase ◽  
Vinyl Alcohol ◽  
Ralstonia Eutropha ◽  
Blot Hybridization ◽  
Amino Acid Sequences ◽  
Cloning And Expression ◽  
Poly Vinyl Alcohol ◽  
Dot Blot

A gene for periplasmic poly(vinyl alcohol) (PVA) dehydrogenase (PVADH) was cloned, based on the N-terminal amino acid sequence of the purified PVADH from Sphingomonas sp. 113P3 and the sequence of the gene for PVADH (pvaA, GenBank accession no. AB190288). The recombinant PVADH tagged with hexahistidine was expressed in Escherichia coli and purified to homogeneity. The recombinant enzyme had the same characteristics as the purified enzyme from Sphingomonas sp. strain 113P. In addition to PVA, the recombinant PVADH could oxidize glycols such as polypropylene glycols and 1,3-butane/cyclohexanediol and 2,4-pentanediol, but neither primary nor secondary alcohols. The amino acid sequence of the recombinant PVADH showed similarity with those of PVADH from Pseudomonas sp. strain VM15C, putative PVADHs from Azoarcus sp. EbN1, and Xanthomonas species (54–25 % identity), and the quinohaemoprotein alcohol dehydrogenases (QH-ADHs) from Comamonas testosteroni, Ralstonia eutropha and Pseudomonas putida (25–29 % identity). PVADHs from strains 113P3 and VM15C have a conserved superbarrel domain (SD), probable PQQ-binding amino acids in the SD and a haem-binding domain (HBD) (they should be designated QH-PVADHs), but the positions of the amino acid sequences for the HBD and SD are the reverse of those of QH-ADHs. A protein structure of QH-PVADHs is proposed. Results of dot-blot hybridization and RT-PCR indicated that the three genes encoding oxidized PVA hydrolase, PVADH and cytochrome c are expressed constitutively and form an operon.

Rat kidney glutamyl aminopeptidase (aminopeptidase A): molecular identity and cellular localization

1994 ◽  
Vol 267 (4) ◽  
pp. F546-F557 ◽  
Author(s):  
L. Song ◽  
M. Ye ◽  
M. Troyanovskaya ◽  
E. Wilk ◽  
S. Wilk ◽  
...  
Keyword(s):  
Amino Acid ◽  
Angiotensin Ii ◽  
Cellular Localization ◽  
Mesangial Cells ◽  
Rat Kidney ◽  
Blot Hybridization ◽  
Northern Blot Hybridization ◽  
Glomerular Mesangial Cells ◽  
Partial Cdna ◽  
Aminopeptidase A

Glutamyl aminopeptidase [aminopeptidase A (EAP), EC 3.4.11.7] is an ectoenzyme that selectively hydrolyzes acidic amino acid residues from the amino terminus of oligopeptides. EAP activity is highest within the kidney and small intestine. The murine pre-B cell BP-1/6C3 and the human kidney glycoprotein gp160 differentiation antigens have been reported to have biochemical properties indistinguishable from EAP. It is not known, however, if rat kidney EAP is a homologue of these antigens or molecularly distinct. Using the reverse transcription-polymerase chain reaction method with oligonucleotide primers based on the BP-1/6C3 nucleotide sequence, we isolated a 450-bp partial cDNA from rat kidney poly(A)+ RNA. The partial cDNA encoded a predicted protein that was 92% and 86% identical to the murine BP-1/6C3 and human gp160 antigens, respectively; the amino acid sequence within the zinc-binding domain was completely conserved. Purification of EAP from rat kidney and microsequence analysis of a tryptic digest peptide fragment (18-mer) indicated that the fragment was highly similar to a region within the BP-1/6C3 and gp160 proteins. Northern blot hybridization and immunoblot analyses were also consistent with labeling of products the same size as reported for the BP-1/6C3 and gp160 antigens. There was a good correlation between the cellular distribution of EAP mRNA and EAP immunoreactivity, with proximal tubules and glomerular mesangial cells having the highest densities. These results indicate that rat kidney EAP is a species homologue of the murine BP-1/6C3 and human gp160 antigens. Furthermore, on the basis of its cellular localization, rat kidney EAP is likely to be involved in degradation of oligopeptides within the glomerulus and the glomerular filtrate. Since cells that express EAP also express receptors for angiotensin II, an intrarenal vasoactive hormone that is a substrate for EAP, these results further suggest that EAP may play a role in modulating the activity of intrarenal angiotensin II.

Sign in / Sign up

Export Citation Format

Share Document