scholarly journals Local Assemblies of Paired-End Reduced Representation Libraries Sequenced with the Illumina Genome Analyzer in Maize

2012 ◽  
Vol 2012 ◽  
pp. 1-8 ◽  
Author(s):  
Stéphane Deschamps ◽  
Kishore Nannapaneni ◽  
Yun Zhang ◽  
Kevin Hayes
Keyword(s):  
Pcr Amplification ◽  
Illumina Genome Analyzer ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Reduced Representation ◽  
Sequencing Technologies ◽  
Variant Detection ◽  
Construction Strategy ◽  
Reference Sequences ◽  
Marker Assay

The use of next-generation DNA sequencing technologies has greatly facilitated reference-guided variant detection in complex plant genomes. However, complications may arise when regions adjacent to a read of interest are used for marker assay development, or when reference sequences are incomplete, as short reads alone may not be long enough to ascertain their uniqueness. Here, the possibility of generating longer sequences in discrete regions of the large and complex genome of maize is demonstrated, using a modified version of a paired-end RAD library construction strategy. Reads are generated from DNA fragments first digested with a methylation-sensitive restriction endonuclease, sheared, enriched with biotin and a selective PCR amplification step, and then sequenced at both ends. Sequences are locally assembled into contigs by subgrouping pairs based on the identity of the read anchored by the restriction site. This strategy applied to two maize inbred lines (B14 and B73) generated 183,609 and 129,018 contigs, respectively, out of which at least 76% were >200 bps in length. A subset of putative single nucleotide polymorphisms from contigs aligning to the B73 reference genome with at least one mismatch was resequenced, and 90% of those in B14 were confirmed, indicating that this method is a potent approach for variant detection and marker development in species with complex genomes or lacking extensive reference sequences.

scholarly journals Identification of single nucleotide polymorphisms in GDF9 gene associated with litter size in Garut sheep

2019 ◽  
Vol 24 (1) ◽  
pp. 51 ◽  
Author(s):  
Resti Yuliana Rahmawati ◽  
Sumadi Sumadi ◽  
Tety Hartatik
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Litter Size ◽  
Direct Sequencing ◽  
Pcr Amplification ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Growth Differentiation Factor 9 ◽  
Hardy Weinberg Equilibrium ◽  
Reference Sequences ◽  
Gdf9 Gene

The growth differentiation factor 9 (GDF9) gene has been regarded as having major impacts on ovulation rate and litter size in sheep. The aim of this study was to identify the single nucleotide polymorphisms (SNPs) of the GDF9 gene and their association with litter size in Garut sheep. For this purpose, a total of 60 ewes of Garut sheep were included in this study. Based on the sheep GDF9 reference sequences (Genbank Acc. No. AF078545.2), one pair of primers (5’-CTGCTGTTTAACCTGGATCGTG-3 5’-GGAGAGCCATACCGATGTCC-3 as forward and reverse, respectively) was used for PCR amplification. The results revealed that four SNPs (g.54C>T, g.60G>A, g.304G>A, and g.333G>A) were found in Garut sheep by direct sequencing. For SNP g.54C>T, the sheep exhibited the highest frequency of allele C and genotype CC. On the other hand, SNPs g.60G>A, g.304G>A, and g.333G>A showed a higher frequency of allele G than allele A, and the GG genotype was predominant in the population. SNP g.333G>A had a significant effect on litter size (p < 0.05), and ewes with the GG genotype had a higher litter size than those with the GA genotype. Genotype distributions for all identified SNPs were in agreement with Hardy-Weinberg equilibrium. We highlight that SNP g.333G>A may be useful as a genetic marker for litter size in Garut sheep.

scholarly journals Novel Hairpin-Shaped Primer Assay To Study the Association of the −44 Single-Nucleotide Polymorphism of the DEFB1 Gene with Early-Onset Periodontal Disease

2004 ◽  
Vol 11 (4) ◽  
pp. 766-769 ◽  
Author(s):  
Michele Boniotto ◽  
Manzour Hernando Hazbón ◽  
William James Jordan ◽  
Greig Patrick Lennon ◽  
Joyce Eskdale ◽  
...  
Keyword(s):  
Periodontal Disease ◽  
Real Time ◽  
Early Onset ◽  
Pcr Amplification ◽  
Cost Effective ◽  
Similar Distribution ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Specific Pcr ◽  
Specific Allele

ABSTRACT A powerful, cost-effective new method for studying single-nucleotide polymorphisms (SNPs) is described. This method is based on the use of hairpin-shaped primers (HP), which give a sensitive and specific PCR amplification of each specific allele, without the use of costly fluorophore-labeled probes and any post-PCR manipulation. The amplification is monitored in real-time using SYBR Green I dye and takes only 2 h to yield results. The HP assay has a simple design and utilizes a conventional real-time PCR apparatus. The −44 C→G transversion in the DEFB1 gene (which encodes human β-defensin 1) has been previously associated with Candida carriage in oral epithelia. In this study, we analyzed the association between early-onset periodontal disease (EOP) and the −44 SNP. We used an HP assay to study the distribution of the −44 SNP in 264 human DNAs obtained from two cohorts of EOP patients and healthy controls from different ethnic backgrounds. The results indicate that the −44 SNP has a similar distribution between EOP and healthy patients, suggesting that it is not associated with the disease.

scholarly journals Reduced Representation Libraries from DNA Pools Analysed with Next Generation Semiconductor Based-Sequencing to Identify SNPs in Extreme and Divergent Pigs for Back Fat Thickness

2015 ◽  
Vol 2015 ◽  
pp. 1-8 ◽  
Author(s):  
Samuele Bovo ◽  
Francesca Bertolini ◽  
Giuseppina Schiavo ◽  
Gianluca Mazzoni ◽  
Stefania Dall’Olio ◽  
...  
Keyword(s):  
Frequency Estimation ◽  
Breeding Value ◽  
Nucleotide Polymorphisms ◽  
Sequencing Data ◽  
Large White ◽  
Single Nucleotide ◽  
Reduced Representation ◽  
Novel Variants ◽  
Dna Pools ◽  
Fat Thickness

The aim of this study was to identify single nucleotide polymorphisms (SNPs) that could be associated with back fat thickness (BFT) in pigs. To achieve this goal, we evaluated the potential and limits of an experimental design that combined several methodologies. DNA samples from two groups of Italian Large White pigs with divergent estimating breeding value (EBV) for BFT were separately pooled and sequenced, after preparation of reduced representation libraries (RRLs), on the Ion Torrent technology. Taking advantage from SNAPE for SNPs calling in sequenced DNA pools, 39,165 SNPs were identified; 1/4 of them were novel variants not reported in dbSNP. Combining sequencing data with Illumina PorcineSNP60 BeadChip genotyping results on the same animals, 661 genomic positions overlapped with a good approximation of minor allele frequency estimation. A total of 54 SNPs showing enriched alleles in one or in the other RRLs might be potential markers associated with BFT. Some of these SNPs were close to genes involved in obesity related phenotypes.

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

2010 ◽  
Vol 22 (1) ◽  
pp. 280
Author(s):  
C. Rosenkrans Jr ◽  
M. Roe ◽  
M. Brown ◽  
Z. Johnson ◽  
H. Brown ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Pcr Amplification ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Julian Date ◽  
Forage System ◽  
Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

SRG extractor: a skinny reference genome approach for reduced-representation sequencing

2019 ◽  
Vol 35 (17) ◽  
pp. 3160-3162
Author(s):  
Davoud Torkamaneh ◽  
Jérôme Laroche ◽  
Istvan Rajcan ◽  
François Belzile
Keyword(s):  
Reference Genome ◽  
Computing Time ◽  
Supplementary Information ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Scanning Method ◽  
Reduced Representation ◽  
A Genome ◽  
Wide Range ◽  
Reduced Representation Sequencing

Abstract Motivation Reduced-representation sequencing is a genome-wide scanning method for simultaneous discovery and genotyping of thousands to millions of single nucleotide polymorphisms that is used across a wide range of species. However, in this method a reproducible but very small fraction of the genome is captured for sequencing, while the resulting reads are typically aligned against the entire reference genome. Results Here we present a skinny reference genome approach in which a simplified reference genome is used to decrease computing time for data processing and to increase single nucleotide polymorphism counts and accuracy. A skinny reference genome can be integrated into any reduced-representation sequencing analytical pipeline. Availability and implementation https://bitbucket.org/jerlar73/SRG-Extractor. Supplementary information Supplementary data are available at Bioinformatics online.

scholarly journals PNA Clamping in Nucleic Acid Amplification Protocols to Detect Single Nucleotide Mutations Related to Cancer

Molecules ◽  
2020 ◽  
Vol 25 (4) ◽  
pp. 786 ◽  
Author(s):  
Munira F. Fouz ◽  
Daniel H. Appella
Keyword(s):  
Nucleic Acid ◽  
Peptide Nucleic Acids ◽  
Genetic Diseases ◽  
Pcr Amplification ◽  
Cancer Diagnostics ◽  
Nucleic Acid Amplification ◽  
Nucleotide Polymorphisms ◽  
Wild Type ◽  
Single Nucleotide ◽  
Proper Diagnosis

This review describes the application of peptide nucleic acids (PNAs) as clamps that prevent nucleic acid amplification of wild-type DNA so that DNA with mutations may be observed. These methods are useful to detect single-nucleotide polymorphisms (SNPs) in cases where there is a small amount of mutated DNA relative to the amount of normal (unmutated/wild-type) DNA. Detecting SNPs arising from mutated DNA can be useful to diagnose various genetic diseases, and is especially important in cancer diagnostics for early detection, proper diagnosis, and monitoring of disease progression. Most examples use PNA clamps to inhibit PCR amplification of wild-type DNA to identify the presence of mutated DNA associated with various types of cancer.

scholarly journals ATXN7 Gene Variants and Expression Predict Post-Operative Clinical Outcomes in Hepatitis B Virus-Related Hepatocellular Carcinoma

2016 ◽  
Vol 39 (6) ◽  
pp. 2427-2438 ◽  
Author(s):  
Chuangye Han ◽  
Long Yu ◽  
Xiaoguang Liu ◽  
Tingdong Yu ◽  
Wei Qin ◽  
...  
Keyword(s):  
Hepatocellular Carcinoma ◽  
Clinical Outcomes ◽  
Pcr Amplification ◽  
Predictive Biomarkers ◽  
Therapeutic Effects ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
B Virus ◽  
Serum Alpha Fetoprotein ◽  
High Level

Background/Aims: Hepatocellular carcinoma (HCC) is a lethal disease with nearly equal morbidity and mortality. Thus, the discovery and application of more useful predictive biomarkers for improving therapeutic effects and prediction of clinical outcomes is of crucial significance. Methods: A total of 475 HBV-related HCC patients were enrolled. Ataxin 7 (ATXN7) single nucleotide polymorphisms (SNPs) were genotyped by Sanger DNA sequencing after PCR amplification. The associations between ATXN7 SNPs and mRNA expression with the prognosis of HBV-related HCC were analyzed. Results: In all, rs3774729 was significantly associated with overall survival (OS) of HBV-related HCC (P = 0.013, HR = 0.66, 95% CI: 0.48-0.94). And patients with the AA genotype and a high level of serum alpha fetoprotein (AFP) had significantly worse OS when compared to patients with AG/GG genotypes and a low level of AFP (adjusted P = 0.007, adjusted HR = 1.83, 95% CI = 1.18-2.82). Furthermore, low expression of ATXN7 was significantly associated with poor recurrence-free survival (RFS) and OS (P = 0.007, HR = 2.38, 95% CI = 1.27-4.45 and P = 0.025, HR = 1.75, 95% CI = 1.18-2.62). Conclusion: ATXN7 may be a potential predictor of post-operative prognosis of HBV-related HCC.

scholarly journals Whole-Genome Characteristics and Polymorphic Analysis of Vietnamese Rice Landraces as a Comprehensive Information Resource for Marker-Assisted Selection

2017 ◽  
Vol 2017 ◽  
pp. 1-11 ◽  
Author(s):  
Hien Trinh ◽  
Khoa Truong Nguyen ◽  
Lam Van Nguyen ◽  
Huy Quang Pham ◽  
Can Thu Huong ◽  
...  
Keyword(s):  
Marker Assisted Selection ◽  
Blast Resistance ◽  
Nucleotide Polymorphisms ◽  
Significant Information ◽  
Single Nucleotide ◽  
Sequencing Technologies ◽  
Multiple Transcripts ◽  
Rice Landraces ◽  
Whole Plant ◽  
Comprehensive Information

Next generation sequencing technologies have provided numerous opportunities for application in the study of whole plant genomes. In this study, we present the sequencing and bioinformatic analyses of five typical rice landraces including threeindicaand twojaponicawith potential blast resistance. A total of 688.4 million 100 bp paired-end reads have yielded approximately 30-fold coverage to compare with the Nipponbare reference genome. Among them, a small number of reads were mapped to both chromosomes and organellar genomes. Over two million and eight hundred thousand single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) inindicaandjaponicalines have been determined, which potentially have significant impacts on multiple transcripts of genes. SNP deserts, contiguous SNP-low regions, were found on chromosomes 1, 4, and 5 of all genomes of rice examined. Based on the distribution of SNPs per 100 kilobase pairs, the phylogenetic relationships among the landraces have been constructed. This is the first step towards revealing several salient features of rice genomes in Vietnam and providing significant information resources to further marker-assisted selection (MAS) in rice breeding programs.

scholarly journals A profile-based method for identifying functional divergence of orthologous genes in bacterial genomes

2015 ◽  
Author(s):  
Nicole E. Wheeler ◽  
Lars Barquist ◽  
Robert A. Kingsley ◽  
Paul P. Gardner
Keyword(s):  
Protein Function ◽  
Large Scale ◽  
Functional Divergence ◽  
Supplementary Information ◽  
Nucleotide Polymorphisms ◽  
Amino Acid Sequence Level ◽  
Single Nucleotide ◽  
Genetic Changes ◽  
Sequencing Technologies ◽  
Bacterial Genomics

AbstractMotivationNext generation sequencing technologies have provided us with a wealth of information on genetic variation, but predicting the functional significance of this variation is a difficult task. While many comparative genomics studies have focused on gene flux and large scale changes, relatively little attention has been paid to quantifying the effects of single nucleotide polymorphisms and indels on protein function, particularly in bacterial genomics.ResultsWe present a hidden Markov model based approach we call delta-bitscore (DBS) for identifying orthologous proteins that have diverged at the amino acid sequence level in a way that is likely to impact biological function. We benchmark this approach with several widely used datasets and apply it to a proof-of-concept study of orthologous proteomes in an investigation of host adaptation in Salmonella enterica. We highlight the value of the method in identifying functional divergence of genes, and suggest that this tool may be a better approach than the commonly used dN/dS metric for identifying functionally significant genetic changes occurring in recently diverged organisms.AvailabilityA program implementing DBS for pairwise genome comparisons is freely available at: https://github.com/UCanCompBio/[email protected], [email protected] informationSupplementary data are available at BioRxiv online.

scholarly journals Tandem repeats structure of gel-forming mucin domains could be revealed by SMRT sequencing data

2020 ◽  
Author(s):  
Tiange Lang
Keyword(s):  
Single Molecule ◽  
Tandem Repeats ◽  
Nucleotide Polymorphisms ◽  
Sequencing Data ◽  
Coding Region ◽  
Smrt Sequencing ◽  
Single Nucleotide ◽  
Sequencing Technologies ◽  
Long Reads ◽  
Great Complexity

Abstract Background. Gel-forming mucin domains of mucin genes show great complexity with tandem repeats (TRs), thus make it difficult to study the sequences. Methods. With the coming of single molecule real-time (SMRT) sequencing technologies, we manage to present sequence structure of mucin domains via SMRT long reads for MUC2, MUC5AC, MUC5B and MUC6. Results. Our study shows that for different individuals, single nucleotide polymorphisms (SNPs) could be found in mucin domains of MUC2, MUC5AC, MUC5B and MUC6, while different number of tandem repeats could be found in mucin domains of MUC2 and MUC6. Conclusions. This information will provided new insights on getting the sequence for Tandem Repeat parts which locate in coding region.

Sign in / Sign up

Export Citation Format

Share Document