The Impact of FLT3-ITD and NPM1 Mutational Status on the Outcome of ATRA Therapy in Patients with Non-APL AML: Results of the UK MRC AML12 Trial

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 554-554 ◽  
Author(s):  
Rosemary Gale ◽  
Robert Hills ◽  
Claire Green ◽  
Yashma Patel ◽  
Amanda Gilkes ◽  
...  
Keyword(s):  
Overall Survival ◽  
Normal Karyotype ◽  
Atra Treatment ◽  
Npm1 Mutation ◽  
Mutational Status ◽  
Hazard Ratios ◽  
The Uk ◽  
The Impact ◽  
To Receive

Abstract Background: The prognostic value of mutations in NPM1 and FLT3-ITD is well known. Previously, Schlenk et al. (ASH 2007, Abstract 297) have reported that survival was significantly improved in a group of older patients who were NPM1 mutant/FLT3-ITD Wild Type when treated with ATRA; there was no significant improvement in overall survival in patients who were either NPM1 WT or FLT3-ITD mutant. We report here on a subset of the UK MRC AML12 trial who have been characterised for FLT3-ITD and NPM1 and who were randomised between ATRA in induction and no ATRA. Patients and Methods: A total of 393 patients were identified and characterised. The median age was 46 years (range 16–68); NPM1 and FLT3-ITD status were determined using methods previously reported (Gale et al. Blood 2008). Median follow-up for survival is 7.1 years. The overall results of the ATRA randomisation have previously been reported (Burnett et al. ASH 2002 Abstract 529) and show no benefit for ATRA treatment. All patients were treated with Daunorubicin, Ara-C and Thioguanine (DAT) with a randomisation between two doses of Ara-C, and were randomised to receive, or not, ATRA 45mg/m2/d during courses 1 and 2 of chemotherapy. ATRA was given for a median of 56 days. Results: A total of 143 (36%) patients had an NPM1 mutation and 93 (24%) had a FLT3-ITD mutation. No significant interactions were seen between either NPM1 status, or FLT3-ITD status and ATRA treatment with respect to complete remission, overall survival or relapse free survival (see Table). Estimates of the hazard ratios (HR) for the interaction between FLT3-ITD and ATRA, and NPM1 and ATRA for overall survival were 0.75 (95% CI 0.42–1.32 p=0.3) and 0.66 (95% CI 0.38–1.12 p=0.13), where an HR<1 indicates greater benefit for ATRA in the mutant group. Looking at patients stratified by both FLT3-ITD and NPM1 status (84 NPM1+ITD−, 34 NPM1−ITD+, 59 NPM1+ITD+, 216 NPM1−ITD−) showed no significant interaction (p=0.4 for heterogeneity of ATRA effect between the four groups, p=0.5 for difference in treatment effect between FLT3 WT/NPM1 mutant and others). The results were not significantly different if restricted to patients with a normal karyotype only. Conclusions: In this randomised comparison of ATRA therapy in younger patients with AML there were no significant interactions. Any impact of NPM1 or FLT3-ITD status on treatment with ATRA is likely to be relatively small or non-existent. CR OS at 5years RFS at 5 years ATRA No ATRA OR, 95% CI ATRA No ATRA HR, 95% CI ATRA No ATRA HR, 95% CI NPM1 WT 80% 86% 1.59 (0.82–3.09) 36% 35% 1.07 (0.79–1.45) 33% 29% 1.05 (0.76–1.46) NPM1 Mutant 91% 89% 0.81 (0.27–2.43) 57% 44% 0.70 (0.45–1.11) 49% 39% 0.83 (0.63–1.31) Interaction with ATRA p=0.3 0.1 0.4 FLT3 WT 83% 87% 1.46 (0.77–2.74) 45% 42% 0.97 (0.73–1.30) 42% 35% 0.87 (0.64–1.18) FLT3 ITD 89% 88% 0.89 (0.25–3.17) 40% 25% 0.73 (0.44–1.21) 32% 26% 0.89 (0.53–1.50) Interaction with ATRA p=0.5 0.4 0.9

The Impact of MN1 Over-Expression on the Outcome of Younger Patients with AML Treated with Intensive Chemotherapy with or without ATRA Therapy

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 2978-2978
Author(s):  
Carol Guy ◽  
Amanda Gilkes ◽  
Rosemary Gale ◽  
David C. Linch ◽  
Robert Hills ◽  
...  
Keyword(s):  
Overall Survival ◽  
De Novo ◽  
Performance Status ◽  
Normal Karyotype ◽  
White Blood Count ◽  
Prognostic Impact ◽  
Atra Treatment ◽  
Over Expression ◽  
The Impact ◽  
To Receive

Abstract Over-expression of the MN1 gene has been reported in AML, and appears to be associated with the inv(16) subgroup. In a study of 142 patients with normal karyotype (NK) it was found to be an adverse prognostic factor for CR and overall survival in older patients (Heuser et al Blood2006, 108:3898). In addition over-expression correlates with unmutated NPM1 and resistance to ATRA in combination with chemotherapy in non-APL with NK (Heuser et al Blood2007, 110:1639). The UK MRC 12 trial treated patients with standard induction of ADE/MAE/DAT followed by 2 or 3 consolidation courses (MACE/MidAc/ICE). Of the 3459 patients recruited to the trial 1097 were also randomised to receive ATRA 45mg/m2/d (d 1–60); all these patients received DAT chemotherapy. Diagnostic samples were available from 196 patients in the ATRA randomisation for a retrospective analysis of the prognostic impact of MN1 over-expression. Methods: cDNA was generated using random priming and MuLV reverse transcriptase (Applied Biosystems). MN1 exon 1 forward, ATTGACCTGGACTCGCTGATG (Carella et al. Leukemia, 2007, 21:1679) and MN1 exon2 reverse, TGCTGAGGCCTTGTTTGCA primers were used to measure RNA abundance, giving a product of 174bp. The expression of ABL was used as an endogenous control: primers NA4_abl_exon4 CGGCTCTCGGAGGAGACGTAGA and A2N_abl-exon2 CCCAACCTTTTCGTTGCACTGT (Emig et al, Leukemia1999, 13:1825) resulting in a product of 386 bp. Both primer sets are intron spanning and do not function on genomic DNA. PCR reactions were carried out to ensure linear amplification using dilutions of an inv(16) patient sample across the expected range which enabled the relative concentrations of MN1 and ABL, and the expression relative to the standard sample, to be calculated. Results: The median age of patients was 46 years (range 17–68); median follow up was 7.1 years. 107/196 patients were randomised to receive ATRA. MN1 status, whether viewed as high/low, or as a continuous variable was not significantly associated with age, white blood count (WBC) or sex; patients with normal karyotype were found to have lower MN1 levels (p<0.0001), patients with inv(16) or adverse cytogenetics tended to have higher MN1 levels (p=0.001, p=0.0007). Patients with NPM1 mutations, or FLT3-ITD mutations tended to have lower MN1 levels (p<0.0001, p=0.02 respectively). There was no significant impact of MN1 levels on remission rates, overall survival (OS) or relapse in either univariate analyses or those adjusted for age, WBC, sex, cytogenetics, performance status, de Novo/Secondary disease, FLT3-ITD and NPM1 status (effect sizes per log increase in MN1: CR adjusted OR 0.80 (0.42–1.52) p=0.5; OS adjusted HR 0.92 (0.69–1.23) p=0.6; Relapse adjusted HR 1.20 (0.83–1.72) p=0.3). Results were similar if analyses were restricted to normal karyotype patients. Overall there was no significant effect of ATRA, as reported previously (Burnett et al ASH 2002 abstract 529). There was no significant interaction between MN1 level and ATRA treatment for CR (unadjusted p=0.7; adjusted p=0.8) or overall survival (unadjusted p=0.9; adjusted p=0.8). However, in adjusted analyses there was a suggestion that the effect of ATRA on relapse was greater in patients with low MN1 levels (adjusted p=0.08). Similarly, looking at the normal karyotype group only there was no evidence of interaction on CR (adjusted p=0.4) or OS (adjusted p=0.9), with a similar greater effect of ATRA on relapse in low MN1 level patients (adjusted p=0.02). Conclusions: The data show a possible interaction between MN1 and ATRA treatment on relapse when adjusted for other baseline variables, but no evidence of prognostic value, nor that any effect of ATRA is moderated by MN1 when considering remission or survival.

Incidence and characterization of venous thromboembolic events (VTE) in patients with pancreatic cancer: Effect of timing of VTE on survival.

2012 ◽  
Vol 30 (15_suppl) ◽  
pp. 4037-4037
Author(s):  
Maithili A Shethia ◽  
Aparna Hegde ◽  
Xiao Zhou ◽  
Michael J. Overman ◽  
Saroj Vadhan-Raj
Keyword(s):  
Pancreatic Cancer ◽  
Overall Survival ◽  
Survival Analysis ◽  
Kaplan Meier ◽  
Hazard Ratios ◽  
Venous Thromboembolic Events ◽  
Venous Thromboembolic ◽  
One Year ◽  
The Impact

4037 Background: Patients (pts) with pancreatic cancer are at high risk for VTE, and the occurrence of VTE can affect pts’ prognosis. The purpose of this study was to evaluate the incidence of VTE and the impact of timing of VTE (early vs. late) on survival. Methods: Medical record of 260 pts with pancreatic cancer, newly referred to UT MDACC during one year period from 1/1/2006 to 12/31/2006, were reviewed for the incidence of VTE during a 2-year follow-up period from the date of diagnosis. All VTE episodes were confirmed by radiologic studies. Survival analysis was conducted using Kaplan-Meier analysis and Cox proportional hazard models. Results: Of the 260 pts, 47 pts (18%) had 51 episodes of VTE during the 2-year follow-up. The median age of the pts with VTE was 61 years (range: 28-86) and 53% were males. Of the 47 pts with VTE, 27 (57%) had PE, 19 (40%) had DVT and 1 had concurrent PE/DVT. Three pts had recurrent VTE during the study period. Median follow-up time for OS was 192 days (range: 1-1652 days). Kaplan-Meier Survival analysis showed that those who developed VTE earlier (within 30 or 90 days) had shorter median overall survival (OS) compared with those who had VTE beyond these time points. The hazard ratios, 95% CI, and median OS at 1 year are summarized in the table below. Conclusions: The incidence of VTE is high in pts with pancreatic cancer. The timing of VTE had a significant impact on OS; pts who had an early development of VTE had a shorter overall survival. [Table: see text]

Results of the ECOG E1900 Trial in Younger Adults with AML Using an Event Free Survival Endpoint Are Concordant with Results Based on Overall Survival: Potential for a Surrogate Endpoint to Facilitate Rapid Approval of Therapies in AML

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 2599-2599 ◽  
Author(s):  
Marlise R. Luskin ◽  
Ju-Whei Lee ◽  
Hugo F. Fernandez ◽  
Hillard M. Lazarus ◽  
Jacob M. Rowe ◽  
...  
Keyword(s):  
Overall Survival ◽  
Clinical Trials ◽  
Treatment Failure ◽  
Induction Treatment ◽  
High Dose ◽  
Event Free Survival ◽  
Npm1 Mutation ◽  
Free Survival ◽  
The Impact

Abstract Background: Novel therapies are required to improve the outcome of patients with AML. New agents are asked to demonstrate an overall survival (OS) benefit before qualifying for FDA approval. The long duration of clinical trials required in order to achieve this endpoint hampers quick evaluation of candidate therapies, including novel agents. Identification of reliable surrogate endpoints for OS in AML is needed. Here we compare the results of therapy for patients with untreated AML ages 16-60 years on the Eastern Cooperative Oncology Group 1900 trial (E1900) of induction chemotherapy followed by consolidation and autologous transplant in order to evaluate the validity of an event free survival (EFS) endpoint as a surrogate for OS. Methods:OS was measured from randomization for induction therapy to death from any cause (censored at last contact). EFS was measured from randomization to induction treatment failure, relapse after compete response (CR), or death in remission (censored at last contact). Hazard ratios (HR) were computed using Cox proportional hazards models. The association between EFS and OS was evaluated using the Kendall tau-a rank correlation for censored data. Results:There were657 patients enrolled of which 426 patients relapsed or had induction treatment failure before death or date of last contact. Median EFS and OS were 8.0 months (95% CI, 6.3 to 9.7 months) and 23.6 months (95% CI, 16.9 to 23.6 months), respectively. With a median follow-up of 80.1 months, there is a statistically significant correlation between EFS and OS (Kendall tau-a = 0.467, 95% confidence interval (CI) = (0.425, 0.510), p<0.001). This correlation was similarly significant at a median follow-up of 25.2 months (Kendall tau-a = 0.361, 95% CI (0.323, 0.400), p <0.001) when the E1900 trial was originally reported (Fernandez et al. NEJM 2009). Key findings reported based on the original OS endpoint are similar when analyzed with an EFS endpoint (Table 1). High-dose daunorubicin (90 mg/m2) (DNR 90) confers both an EFS and OS benefit in patients aged < 50 years and patients with intermediate cytogenetic risk, and does not confer an EFS or OS benefit in older patients and patients with unfavorable cytogenetic risk, on univariate analysis. Divergent results are only seen in the small subset of favorable cytogenetic risk patients, where DNR 90 conferred an OS benefit (p=0.027) without an EFS benefit (p=0.32). Both EFS and OS endpoints consistently reflect the impact of mutation status on survival. The presence of a FLT3-ITD or DNMT3A mutation has a negative impact on both EFS and OS while an IDH2 mutation has a favorable impact on EFS and OS. The presence of a NPM1 mutation confers a favorable impact on EFS and OS in patients who received DNR 90 and did not impact EFS or OS in patients receiving standard-dose daunorubicin (45 mg/m2) (DNR 45). The presence of an IDH1 mutation does not impact EFS or OS. Conclusions:The results of E1900 demonstrating superiority of DNR 90 in AML induction in patients up to age 60 are concordant when using an EFS or OS endpoint. This is true for the group as a whole as well as for subgroups for which targeted agents are in development (FLT3/IDH2 inhibitors). Further investigation of whether EFS is a reliable surrogate for OS is warranted in AML. If confirmed, its use as a primary endpoint could be adopted by regulatory agencies in order to allow more rapid completion of clinical trials in AML and bring new therapies to AML patients in a timely fashion. Table 1. Results of E1900 based on an EFS endpoint versus an OS endpoint. Subgroup N OS HR (DNR 90/DNR 45) & 95% CI Wald P EFS HR (DNR 90/DNR 45) & 95% CI Wald P DNR 45 DNR 90 Age < 50 yrs ³ 50 yrs 188 142 172 155 0.66 (0.50, 0.85) 0.81 (0.62, 1.06) 0.002 0.118 0.64 (0.50, 0.82) 0.86 (0.67, 1.10) 0.0004 0.23 Cytogenetic Favorable Intermediate Unfavorable 38 141 59 51 127 63 0.51 (0.28, 0.93) 0.68 (0.50, 0.92) 0.79 (0.54, 1.16) 0.027 0.012 0.225 0.76 (0.44, 1.31) 0.63 (0.47, 0.83) 0.72 (0.49, 1.05) 0.32 0.001 0.09 Subgroup N OS HR (MUT/WT) & 95% CI Wald P EFS HR (MUT/WT) & 95% CI Wald P FLT3-ITD WT MUT 456 147 1.62 (1.31, 2.01) <.0001 1.48 (1.21, 1.82) 0.0002 DNMT3A WT MUT 371 119 1.30 (1.03, 1.65) 0.03 1.23 (0.98, 1.54) 0.07 IDH1 WT MUT 465 36 0.88 (0.59, 1.33) 0.55 0.91 (0.62, 1.34) 0.64 IDH2 WT MUT 451 50 0.63 (0.43, 0.93) 0.02 0.68 (0.48, 0.97) 0.03 NPM1 DNR 45 DNR 90 245 257 0.84 (0.61, 1.16) 0.60 (0.41, 0.89) 0.30 0.01 0.90 (0.66, 1.22) 0.59 (0.41, 0.84) 0.49 0.004 Disclosures No relevant conflicts of interest to declare.

Cytogenetic Evolution in Patients with IPSS Low and Intermediate-1 Risk. Study from the Spanish Group of Myelodysplastic Syndrome

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 4649-4649
Author(s):  
Brayan Marcel Merchán ◽  
Margarita Ortega ◽  
María José Llamas-Poyato ◽  
Montserrat Cortés ◽  
Montserrat Arnan ◽  
...  
Keyword(s):  
Overall Survival ◽  
Population Distribution ◽  
Risk Group ◽  
Univariate Analysis ◽  
Normal Karyotype ◽  
Molecular Diagnostic ◽  
Kaplan Meier ◽  
Cytogenetic Analyses ◽  
The Impact

Abstract Cytogenetic abnormalities (CA) are the most important prognostic factor in MDS patients, nevertheless the incidence of CA at diagnosis is not higher than 50% and even less in lower risk patients. The acquisition of CA (ACA) has recently been reported as a frequent and poor prognostic event in patients with normal karyotype at diagnosis (Jabbour et al 2013). The aim of our study was to analyze in a large cohort of patients the incidence, characteristics, and prognosis of the ACA in patients with low and intermediate-1 IPSS risk at diagnosis. We retrospectively reviewed 254 adult patients from the Spanish Registry of MDS with IPSS low or intermediate-1 risk diagnosed between 1995 and 2013. In total 121 patients had at least two consecutive cytogenetic analyses during the follow up. The main end points were overall survival (OS) and AML evolution (TFS). Cytogenetic analyses were conducted on unstimulated bone marrow cells after culture (24–72 hours). The ISCN 2005 criteria were used for identification of abnormal clones. ACA was defined by structural change or gain in at least 2 metaphases and loss in 3 metaphases as proposed in previous reports. Differences among variables were evaluated by non-parametric tests. OS and TFS were analyzed by Kaplan-Meier curve. The median follow-up was 25 months (0-155). The median age at diagnosis was 71 years (26-87) and 28% of the patients were female. The IPSS risk group was low in 43% and intermediate-1 in 57% of the population. Distribution as the IPSS-R was very low 20%, low 42%, Intermediate-1 30%, poor 6%, and there were no cases with very poor risk. At diagnosis, 34.7% of patients had abnormal karyotype. ACA was detected in 16 patients (13,2%) after a median of 30 months (range, 5-165). The most common ACA identified were trisomy 8 as sole abnormality followed by chromosome 7 abnormalities in in 25% and 12.5% of patients, respectively. Of the 42 patients with CA at diagnosis, 12% developed new ACA while among 79 patients with normal karyotype at diagnosis, 14% developed ACA (p=0,7). The presence of ACA changed the IPSS-R risk group in 14 out 16 patients. Compared with patients without ACA, the presence of ACA was significantly associated with a lower hemoglobin level (Table 1). In univariate analysis, ACA was not apparently associated with a higher incidence of AML evolution as there were 2 out of 16 patients (12,5%) with ACA that developed AML while between the 105 patients without ACA, 11 developed AML (11,5%) (P=NS). At last follow-up, 34 (28%) patients died and the median OS for the entire cohort was 67 months (IC 95% 34-99). In Kaplan-Meier curve, the presence of ACA was associated with lower overall survival (median 67 months (95% CI: 34-99) than patients without ACA (median 140 months (95% CI 36,9.243) (P =0.01). In summary, the present analysis shows that, the ACA occurs in around 13% of cases, which is a lower frequency than previously reported in other series, and it may have impact in overall survival. Future studies should address the impact molecular alterations and somatic point mutations; molecular diagnostic may allow identified patients with higher risk to transformation. Table 1. Hematologic parameters at the time for the cytogenetic control. ACA (n= 16) NO ACA (n=105) P Hb g/dL 9,1 (5.8-11.9) 10,3 (5.6-17.7) 0.04 WBC × 109/L 3,15 (0.7-24.1) 4,1 (0.9-32) 0.85 Pla × 109/L 71 (16-127) 93,5 (4-574) 0.38 Blast × 109/L 6 (1-15) 2.4 (0-19) 0.09 Disclosures Valcárcel: Celgene: Honoraria, Speakers Bureau.

scholarly journals Low Serum Vitamin D Levels Are Associated With Inferior Survival in Follicular Lymphoma: A Prospective Evaluation in SWOG and LYSA Studies

2015 ◽  
Vol 33 (13) ◽  
pp. 1482-1490 ◽  
Author(s):  
Jennifer L. Kelly ◽  
Gilles Salles ◽  
Bryan Goldman ◽  
Richard I. Fisher ◽  
Pauline Brice ◽  
...  
Keyword(s):  
Vitamin D ◽  
Overall Survival ◽  
Follicular Lymphoma ◽  
Serum Vitamin ◽  
Baseline Serum ◽  
Serum Vitamin D ◽  
Hazard Ratios ◽  
Vitamin D Levels ◽  
The Impact

Purpose Recent literature reports a potential association between high vitamin D and improved lymphoma prognosis. We evaluated the impact of pretreatment vitamin D on follicular lymphoma (FL) outcome. Patients and Methods SWOG participants were previously untreated patients with FL enrolled onto SWOG clinical trials (S9800, S9911, or S0016) involving CHOP chemotherapy plus an anti-CD20 antibody (rituximab or iodine-131 tositumomab) between 1998 and 2008. Participants included in our second independent cohort were also previously untreated patients with FL enrolled onto the Lymphoma Study Association (LYSA) PRIMA trial of rituximab plus chemotherapy (randomly assigned to rituximab maintenance v observation) between 2004 and 2007. Using the gold-standard liquid chromatography–tandem mass spectrometry method, 25-hydroxyvitamin D was measured in stored baseline serum samples. The primary end point was progression-free survival (PFS). Results After a median follow-up of 5.4 years, the adjusted PFS and overall survival hazard ratios for the SWOG cohort were 1.97 (95% CI, 1.10 to 3.53) and 4.16 (95% CI, 1.66 to 10.44), respectively, for those who were vitamin D deficient (< 20 ng/mL; 15% of cohort). After a median follow-up of 6.6 years, the adjusted PFS and overall survival hazard ratios for the LYSA cohort were 1.50 (95% CI, 0.93 to 2.42) and 1.92 (95% CI, 0.72 to 5.13), respectively, for those who were vitamin D deficient (< 10 ng/mL; 25% of cohort). Conclusion Although statistical significance was not reached in the LYSA cohort, the consistent estimates of association between low vitamin D levels and FL outcomes in two independent cohorts suggests that serum vitamin D might be the first potentially modifiable factor to be associated with FL survival. Further investigation is needed to determine the effects of vitamin D supplementation in this clinical setting.

scholarly journals Real-World Differences in Characteristics and Survival of Relapsed AML Patients with and without Transplant

Blood ◽  
2018 ◽  
Vol 132 (Supplement 1) ◽  
pp. 2297-2297
Author(s):  
Abdalla Aly ◽  
Saurabh Ray ◽  
Anuj Shah ◽  
Marc Botteman
Keyword(s):  
Overall Survival ◽  
Real World ◽  
Research Funding ◽  
Cell Transplant ◽  
Employment Equity ◽  
Risk Of Death ◽  
Hazard Ratios ◽  
Equity Ownership ◽  
To Receive

Abstract Background: Some AML patients, particularly those relapsing rapidly, may not get a chance to receive a potentially curative stem cell transplant (SCT) due to early death, among other reasons. This study compares the differences in characteristics and survival of relapsed AML patients with and without SCT, as observed in a real-world setting. Methods: Relapsed AML patients aged 66-75 years were identified from the linked Surveillance, Epidemiology, and End Results (SEER)-Medicare database by medical claims associated with ICD-9 code 205.02 (2009-2014). Patients were followed from relapse to the earliest of death, SCT, or end of follow-up. Baseline characteristics were compared between relapsed AML patients with and without SCT. The SCT rates were estimated after adjusting for the competing risk of death. The Fine and Gray method was used to identify predictors of receiving SCT and were reported in terms of sub-distribution hazard ratios (SHR) and 95% confidence intervals (CI). Kaplan-Meier estimates (reported in terms of median and 6-, 12-, and 24-months survival rates, tested with a log Rank test statistic) and a Cox proportional hazards model adjusting for age, sex, race, Census region, marital status, urban location, Charlson comorbidity index (CCI), and diagnosis year (reported in terms of hazard ratios (HR) and 95% CI) was used to assess the difference in survival between patients with and without SCT. Results: Of the 474 relapsed AML patients (median age, 70 years, median follow up, 4.4 months, male, 55%) included in the study, 8% received SCT, 80% died without having SCT and 12% were administratively censored. Patients were less likely to receive SCT if they were 71-75 years old (SHR 0.28, 95% CI (0.19 to 0.41; P <.001) and had higher comorbidity with CCI >3 (SHR 0.16, 95% CI (0.06 to 0.44; P <.001). The median overall survival was 16.1 months for patients with SCT vs. 4.1 months for those without SCT (log rank P <.001; adjusted HR 0.52, 95% CI (047 - 0.57; P <.001)). The 6-, 12-, and 24-month overall survival for all relapsed AML patients was 42%, 26%, and 12%, respectively. For patients with SCT, the 6-, 12-, and 24-month overall survival was 84%, 59%, and 43%, respectively. For patients without SCT, the 6-, 12-, and 24-month overall survival was 39%, 23%, and 12%, respectively. Conclusions: Relapsed AML patients who received SCT experienced significantly longer survival compared to those who did not receive SCT in this elderly study population. However, only 8% of all relapsed AML patients received SCT. Therapies that bridge more patients to SCT are expected to improve overall survival in this high unmet need population. Disclosures Aly: AstraZeneca: Research Funding; Celgene: Research Funding; BMS: Research Funding; Pharmerit International: Employment, Research Funding; Daiichi Sankyo Incorporated: Research Funding. Ray:Daiichi Sankyo Incorporated: Employment, Equity Ownership. Shah:Celgene: Research Funding; Pharmerit International: Employment, Research Funding; Daiichi Sankyo Incorporated: Research Funding; BMS: Research Funding. Botteman:Daiichi Sankyo Incorporated: Research Funding; BMS: Research Funding; Celgene: Research Funding; Pharmerit International: Employment, Equity Ownership, Research Funding; Bioverativ: Consultancy, Other: Provided consulting to Bioverativ, Research Funding.

Safety Profile of Bortezomib Impacts Survival in Light Chain Amyloidosis

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 5664-5664
Author(s):  
Zoé Van de Wyngaert ◽  
Greg Vanoutryve ◽  
Guillemette Fouquet ◽  
Stéphanie Guidez ◽  
Charles Herbaux ◽  
...  
Keyword(s):  
Overall Survival ◽  
Dose Reduction ◽  
Safety Profile ◽  
Cardiac Involvement ◽  
Hematological Toxicity ◽  
Al Amyloidosis ◽  
Kidney Involvement ◽  
The Impact ◽  
To Receive

Abstract Background. Bortezomib has improved overall survival (OS) in light chain (AL) amyloidosis; however, data on its activity in severe cardiac AL are sparse. Furthermore, the impact of the safety profile of Bortezomib on overall survival in severe cardiac AL amyloidosis remains unknown given the fragile population. We sought to outline the activity and safety profile of Bortezomib in severe cardiac AL amyloidosis. Methods. Twenty-seven patients diagnosed with AL amyloidosis and treated with Bortezomib were included, mean age was 63 years (36-85), with a sex ratio of 18/9. Eighteen patients had cardiac involvement, among which all had Mayo-Clinic stage III staging but 3, and 9 had kidney involvement only. Seventy percent of patients received Bortezomib as a 1st-line therapy, once (19%) or twice weekly (81%), given IV at the starting dose of 1.3g/m2 in combination to Dexamethasone. Thirteen (48%) patients also received an alkylating agent. Results. Overall hematological response rate was 75% in patients who received at least 1 cycle of Bortezomib, and 83% and 62.5% in patients with and without cardiac involvement, respectively. Complete response was obtained in 45%, and 42% and 50% in the 2 groups, respectively. 44% patients with cardiac involvement had an organ response. An hematological toxicity occurred in 26% of patients, similarly in the 2 groups, consisting mainly of thrombocytopenia with no need for treatment modification. Non-hematological toxicity (grade ≥2) rate was 62% in patients with cardiac involvement and 38% in patients with kidney involvement (p=ns), consisting mostly of fatigue, peripheral neuropathy, infection and gastro-intestinal adverse effects, and leading to 25% of dose reduction, and 33% of Bortezomib interruption before cycle 4, similarly in both groups. The median follow-up was 41 months from start of Bortezomib. Seven patients died during the first cycle of treatment, all of them but one had severe stage III cardiac involvement with LVEF <40%. Importantly, the patients with cardiac involvement who were treated past the first cycle had an estimated 3-year OS similar to those with kidney involvement only (50 vs. 62%, p=ns). All patients with cardiac AL who completed at least 3 cycles of treatment and survived beyond 3 months remained alive at follow-up date. In univariate analysis for the cohort as a whole, occurrence of non-hematological toxicity grade ≥2 was associated with a lower OS (20% if present vs. 67% when absent; p=0.001), as for the consequence of Bortezomib dose reduction (54% vs. 71%, respectively; p=0.036), and decrease of the total dose received to less than 50% of the initial dose (12% vs. 92% respectively, p=0.009). Bortezomib interruption (36% vs. 78%, respectively; p=0.004), or inability to receive at least 3 cycles of Bortezomib also impacted OS (36% vs. 78%, respectively; p=0,004). The impact on OS appeared even more dramatic in patients with cardiac involvement. In multivariate analysis, independent variables that were associated with poor OS were the number of Bortezomib cycles (inability to receive at least 3 cycles) (OR=34.7; p=0.001), occurrence of a non-hematological toxicity (OR=5.1; p=0.011), and absence of hematological response (OR=3.6; p=0.05). Conclusion. Bortezomib is an effective treatment of AL amyloidosis, and significantly improves the most adverse patients characterized with severe cardiac presentation. However, the safety profile is of particular concern in severe cardiac AL, particularly the non hematological ≥grade 2 incidence rate; patients often characterized with dose reduction or interruption, inability to receive sufficient dose concentration or number of cycles. This study confirms that alteration of the safety profile of Bortezomib may hamper the benefits seen particularly in severe cardiac AL, questioning on the use of weekly and sub-cutaneous Bortezomib for very fragile AL, as optimized in fragile patients with Myeloma. Disclosures No relevant conflicts of interest to declare.

RUNX1 Mutations Can Be Found in 34% of De Novo AML with Normal Karyotype or Single Chromosomal Imbalances and Are Associated with Good Prognosis but Turn to Unfavourable Outcome If Further Cytogenetic or Molecular Mutations Are Acquired

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 146-146 ◽  
Author(s):  
Susanne Schnittger ◽  
Frank Dicker ◽  
Nicole Wendland ◽  
Tamara Weiss ◽  
Wolfgang Kern ◽  
...  
Keyword(s):  
De Novo ◽  
Normal Karyotype ◽  
Combination Group ◽  
Npm1 Mutation ◽  
Chromosomal Imbalances ◽  
Mutational Status ◽  
De Novo Aml ◽  
Molecular Aberrations ◽  
Genetic Events

Abstract Mutations in the DNA-binding domain, the Runt homology domain of the AML1/RUNX1 gene have been described mostly in therapy-related myelodysplastic syndrome, in therapy-related AML as well as in AML after MDS (s-AML). Recently we have shown that RUNX1 mutations also can be found in de novo AML with normal karyotype and single or simple chromosomal imbalances. To further address the importance of RUNX1 in these kind of AML we analyzed the RUNX1 mutational status in a selected cohort of 389 de novo AML with: normal karyotype (NK): n=221, +8 (n=40), +11 (n=9), +13 (n=26), +21 (n=14), rare trisomies (n=11), −7/7q- (n=22), 5q- (n=3), 9q- (n=6), 20q- (n=4), or any combinations of these (n=33). Median age was 67.5 years (range: 20.4–88.2), male:female ratio was 216:173. In this selected cohort 134/389 mutations (34.4%) were detected, showing that RUNX1 is one of the most frequently mutated genes in certain de novo AML. The mutations were not randomly distributed according to FAB subtypes: AML M0 (58.3%, n=36), M1 (32.1%, n=84), M2 (34%, n=126), M4 (20.5%, n=39), but only 10.5% in M6 (n=19) and never detected in M5 (n=12). Also within the single different cytogenetic groups the RUNX1 mutations (RUNX1mut) revealed different frequencies: NK: 28.5%; +8: 35%, +11: 44 %, +13: 96%, +21: 56%, −7/7q-: 27%, 20q-: 75% and 23.5% in the combination group. The patients (pts) were also analyzed for CEBPA, FLT3ITD, FLT3TKD, JAK2, MLLPTD, NPM1 and NRAS. 49/134 RUNX1mut cases (36.6%) revealed at least one of these additional mutations. CEBPA and JAK2 mutations were never detected in combination with RUNX1. An NPM1 mutation was observed in one RUNX1mut pts with +21. The mutation found most frequently together with RUNX1 was MLLPTD that was detected in 28/134 pts (20.9%) followed by FLT3-ITD that was detected in 24/134 cases (17.9%). The distribution of additional mutations in the different cytogenetic groups was heterogeneous. Of the 63 pts with RUNX1mut NK 20 had MLLPTD (31.7%) and 13 had FLT3ITD (20.6%). In 14 pts with +8 and RUNX1mut no MLLPTD but 3 (21.4%) FLT3ITD were detected, in addition to one case with NRAS. Two of the 4 RUNX1mut +11 pts had MLL-PTD. The 8 cases with RUNX1 mut and +21 had a very high additional mutational rate with 2 MLLPTD and 6 FLT3ITD and 1 FLT3TKD, 1 NPM1 and 1 NRAS (3 double mutated cases). In contrast only 3 of 25 (12%) RUNX1mut pts with +13 had additional mutations (2 MLLPTD and 1 FLT3ITD). Similarily the −7/7q- group with RUNX1mut (n=6) revealed no additional markers. This finding suggest that some chromosomal aberrations are biologically “ more potent” than others and require less additional molecular events to cause overt leukemia. Clinical follow up data were available for 213 pts (74 RUNX1mut and 139 RUNXunmut). A direct comparison of these two groups showed a trend to shorter overall survival (OS) in the RUNX1mut pts (p=0.094) and a significantly shorter event free survival (EFS) (p=0.008). A subanalysis for RUNX1 and MLLPTD showed worse EFS for all three groups (RUNX1+/MLLPTD+ (n=21), RUNX1+/MLLPTD− (n=53), RUNX1−/MLLPTD+ (n=18) compared to the unmutated group (n=121) (p=0.064, 0.009, 0.081). Similar results were obtained for the combination of RUNX1/FLT3ITD with (RUNX1+/FLT3ITD+ (n=15), RUNX1+/FLT3ITD− (n=59), RUNX1−/FLT3ITD+ (n=24)) compared to the unmutated group (n=114) (p=0.006, 0.033, 0.223). Subsequently an analysis in the NK group was performed (25 RUNX1mut, 82 RUNX1wt). Surprisingly, RUNX1mut AML were not worse than the RUNX1unmut AML. In a subanalysis taking MLL-PTD and FLT3-ITD into account there were only 12 sole RUNX1mut pts and all revealed no event for OS and EFS (median follow up time: 196 days). In a further analysis taking cytogenetic as well as molecular aberrations into account it could be shown that RUNX1mut without any of these further aberrations have no event and are favourable compared to pts with single aberrations (p=0.063) and even more favourable compared to those with two or more cytogenetic or molecular aberrations (p=0.031). A multivariate analysis including age, cytogenetics, molecular genetics, and additional further genetic events shows that only age (p=0.027) and additional genetic events (p=0.005) are independent prognostic markers in this analysis. In conclusion, RUNX1 mutations are frequent in AML with NK or single chromosomal imbalaces, tend to go together with additional mutations which differ dependent on underlying cytogenetics. cooperate most frequently with MLL-PTD 4) per se are prognostically favourable as single genetic aberration but deteriorate by acquisition of other cytogenetic and/or molecular aberrations.

High Dose Daunorubicin Improves Survival in AML up to Age 60, Across All Cytogenetic Risk Groups Including Patients with Unfavorable Cytogenetic Risk, and FLT3-ITD Mutant AML: Updated Analyses from Eastern Cooperative Oncology Trial E1900

Blood ◽  
2014 ◽  
Vol 124 (21) ◽  
pp. 373-373 ◽  
Author(s):  
Marlise R. Luskin ◽  
Ju-Whei Lee ◽  
Hugo F Fernandez ◽  
Hillard M. Lazarus ◽  
Jacob M. Rowe ◽  
...  
Keyword(s):  
Overall Survival ◽  
Induction Therapy ◽  
Risk Group ◽  
Multivariable Analysis ◽  
Risk Groups ◽  
Prognostic Impact ◽  
Npm1 Mutation ◽  
Mutation Status ◽  
The Impact

Abstract Background: Eastern Cooperative Oncology Group trial E1900 (E1900) showed that induction therapy with a high daily dose of daunorubicin (90 mg/m2) (DNR 90) improves survival in younger patients (pts) (<50 yrs) and intermediate (int) cytogenetic risk AML, but at 2 years of follow-up no benefit was seen in older pts (50-60 yrs), or in those with unfavorable cytogenetic risk or FLT3-ITD mutant AML (Fernandez et al. N Engl J Med 2009). Here we update results of E1900 with longer follow-up, focusing on the benefit of DNR 90 in cytogenetic and common molecular subgroups. Methods: Overall survival (OS) was measured from randomization for induction therapy to death from any cause (censored at last contact). Hazard ratios (HR) for death were computed using univariate and multivariable Cox proportional hazards models; multivariable Cox models were adjusted for sex, age, hemoglobin level, leukocyte count, platelet count, and cytogenetic profile. All conclusions regarding the impact of DNR 90, unless noted, are similar based on univariate and multivariable analysis. Results: Overall, 657 pts were enrolled with a median follow-up of 80.1 months. The HR for death in the DNR 90 group as compared with the standard-dose daunorubicin (45 mg/m2) (DNR 45) group was 0.74 (p=0.001). Pts <50 yrs benefited from DNR 90 (p = 0.002) while those >=50 yrs were not proven to benefit (p = 0.12). Pts with favorable (fav) and int. cytogenetic risk benefited from DNR 90 (p = 0.03 and p = 0.02, respectively). A benefit for pts with unfavorable cytogenetic risk was seen on multivariable analysis (p = 0.04). Impact of DNR 90 by mutation status: The 3 most common mutations were FLT3-ITD (24%), NPM1 (26%), and DNMT3A (24%). AML pts with any of these 3 mutations benefited from DNR 90 (p = 0.009, p = 0.002, and p = 0.02, respectively). FLT3-ITD pts who received DNR 90 had a 4-yr OS of 31%. Benefit was seen in pts age 50-60 with FLT3-ITD or NPM1 mutation (p = 0.02 and p = 0.04, respectively). No benefit of DNR 90 was seen in a small cohort of pts with MLL-PTD (p = 0.06). Benefit of DNR 90 in FLT3-ITD, NPM1, and DNMT3A mutant AML was confirmed in the int. cytogenetic risk group. Impact of DNR 90 on prognostic impact of NPM1: The presence of an NPM1 mutation conferred an improvement in OS in the DNR 90 group which was not seen in the DNR 45 group (p = 0.01 vs p = 0.3). This finding was confirmed in the int. cytogenetic risk group. Conclusion: With median follow-up of over 6 years on E1900, we confirm that DNR 90 improves outcome in pts with fav/int cytogenetic risk, DNMT3A or NPM1 mutant AML, or age < 50 (Patel et al. N Engl J Med 2012). Additionally, we now demonstrate that DNR 90 additionally benefits pts with FLT3-ITD AML, and pts with unfavorable cytogenetic risk, regardless of age. Moreover, we show that the favorable prognostic impact of the NPM1 mutation is only present when pts receive DNR 90. Given the benefit of DNR 90 across all cytogenetic risk groups as well as common molecularly defined subgroups of AML, DNR 90 should be the standard for all pts up to age 60 who are candidates for induction chemotherapy. Table HR for death by AML cohort. Subgroup N Univariate Model DNR 45 DNR 90 HR (DNR 90/DNR 45) & 95% CI Wald P All patients (n=657) Overall 330 327 0.74 (0.61, 0.89) 0.001 Age < 50 yrs³ 50 yrs 188 142 172 155 0.66 (0.50, 0.85) 0.81 (0.62, 1.06) 0.002 0.12 Cytogenetic Favorable Intermediate Unfavorable 38 232 59 51 212 63 0.51 (0.28, 0.93) 0.76 (0.61, 0.96) 0.79 (0.54, 1.16) 0.03 0.02 0.22 FLT3-ITD WT MUT 215 83 241 64 0.74 (0.59, 0.92) 0.61 (0.42, 0.89) 0.008 0.009 MLL-PTD WT MUT 290 16 296 15 0.70 (0.58, 0.86) 0.46 (0.21, 1.04) 0.0004 0.06 NPM1* WT MUT 180 65 192 65 0.70 (0.55, 0.89) 0.50 (0.32, 0.78) 0.003 0.002 DNMT3A WT MUT 177 61 194 58 0.66 (0.52, 0.85) 0.62 (0.41, 0.94) 0.001 0.02 * Statistically significant test of interaction (p<0.2) Figure 1A: Overall Survival by NPM1 Mutation Status and Treatment Arm Figure 1A:. Overall Survival by NPM1 Mutation Status and Treatment Arm Figure 1B: Overall Survival of FLT-ITD Mutant AML Patients by Treatment Arm Figure 1B:. Overall Survival of FLT-ITD Mutant AML Patients by Treatment Arm Disclosures No relevant conflicts of interest to declare.

The Efficacy of Etoposide-Based Therapy in Adult Secondary Hemophagocytic Lymphohistiocytosis

2021 ◽  
pp. 1-9
Author(s):  
Leonard Naymagon ◽  
Douglas Tremblay ◽  
John Mascarenhas
Keyword(s):  
Hemophagocytic Lymphohistiocytosis ◽  
Proportional Hazards ◽  
Multivariable Analysis ◽  
Cox Proportional Hazards ◽  
Rank Test ◽  
Kaplan Meier ◽  
Hazard Ratios ◽  
Significant Difference ◽  
The Impact

Data supporting the use of etoposide-based therapy in hemophagocytic lymphohistiocytosis (HLH) arise largely from pediatric studies. There is a lack of comparable data among adult patients with secondary HLH. We conducted a retrospective study to assess the impact of etoposide-based therapy on outcomes in adult secondary HLH. The primary outcome was overall survival. The log-rank test was used to compare Kaplan-Meier distributions of time-to-event outcomes. Multivariable Cox proportional hazards modeling was used to estimate adjusted hazard ratios (HRs) with 95% confidence intervals (CIs). Ninety adults with secondary HLH seen between January 1, 2009, and January 6, 2020, were included. Forty-two patients (47%) received etoposide-based therapy, while 48 (53%) received treatment only for their inciting proinflammatory condition. Thirty-three patients in the etoposide group (72%) and 32 in the no-etoposide group (67%) died during follow-up. Median survival in the etoposide and no-etoposide groups was 1.04 and 1.39 months, respectively. There was no significant difference in survival between the etoposide and no-etoposide groups (log-rank <i>p</i> = 0.4146). On multivariable analysis, there was no association between treatment with etoposide and survival (HR for death with etoposide = 1.067, 95% CI: 0.633–1.799, <i>p</i> = 0.8084). Use of etoposide-based therapy was not associated with improvement in outcomes in this large cohort of adult secondary HLH patients.

Sign in / Sign up

Export Citation Format

Share Document