Validation of the Low Risk Prognostic Scoring System (LR-PSS) in Patients with VERY Low, Low and Intermediate Risk IPSS-R Myelodysplastic Syndrome. Results from a Single Center

Abstract Background: Myelodysplastic syndrome (MDS) therapeutic decisions have been traditionally based on the IPSS; however, this score system does not allow the identification of patients with low risk disease (low or intermediate-1 IPSS) but a poor prognosis, who could benefit from an early intervention. Garcia-Manero et al (Leukemia 2008) described a specific prognostic scoring system for this subgroup of patients (LR-PSS) based on age ≥60 years, hemoglobin <10g/dl, platelet count <50k/uL or 50-200k/uL, bone marrow blasts ≥4% and unfavorable cytogenetics (non-del(5q), non-diploid). This LR-PSS score system enables the stratification of low risk MDS patients into 3 different risk categories; interestingly, the third category identifies a subgroup of patients with a median overall survival (OS) similar to that of patients classified as intermediate-2 and high risk IPSS. Besides, the IPSS-R described by Greenberg et al (Blood 2012) has demonstrated a strong prognostic value for OS and LFS as compared to the IPSS when applied to different independent series of MDS patients. The prognostic impact of the LR-PSS has not been analyzed in MDS patients with very low-, low- and intermediate IPSS-R scores. Aim: To analyze the prognostic impact according to OS and leukemia free survival of the LR-PSS when applied to a population MDS patients with very low, low and intermediate IPSS-R. Methods: A total of 789 consecutive patients diagnosed with MDS (01/1992-12/2014) at the Catalan Institute of Oncology of Barcelona were included in the study. 413 (52%) had available cytogenetics and therefore, IPSS-R was calculated. Overall, 371 (89%) patients were classified as very low, low and intermediate IPSS-R and included in the study. Results: 123 (30%) patients were classified as very low, 182 (44%) low and 66 (16%) intermediated IPSS-R risk MDS; median age 72 years (range 32-101) and 258 (69%) male. 1.4 % CRDU, 7.6 % RA, 41.6 % RCMD, 16.2 % RAEB‐1, 4.1 % RAEB‐2, 25.9 % CMML and 3.2 % MDS‐U with isolated 5q deletion according to the 2008 WHO classification. At diagnosis, median hemoglobin, platelet and bone marrow blast were 11.8 g/dL (5.5-17.1), 152 x109/L (1-1492) and 3 % (0-17), respectively and fifty-three (14.3 %) patients had unfavorable LR-PSS cytogenetics. For the whole population, median follow up was 6.6 years (range 6-7.7). At the time of last follow up, 48.2 % (179) had died and only 49 (13%) had progressed to acute myeloid leukemia. When the LR-PSS was applied to the very low, low and intermediate IPSS-R subgroups three well-differentiated prognostic categories could be identified: 58 patients (15.6%) category 1, scores 0-2; 277 (74.6%) patients category 2, scores 3-4 and 36 (9.8%) patients category 3, scores 5-7 with significantly different overall survival and leukemia free survival. Median OS for categories 1 (9.4 years; 95% CI 6.7-12), 2 (6 years; 95% CI 5-7.1) and 3 (2.6 years; 95% CI 2.1-3) were significantly different (p<0.001; Figure 1). Moreover, the rate of progression to acute myeloid leukemia was 5% (3/58), 13% (37/277) and 25% (9/36) for categories 1, 2 and 3, respectively. Summary/Conclusion: When applied to a low risk (very low, low and intermediate) IPSS-R cohort of MDS population, the LR-PSS identifies a subgroup of patients with a significantly worse prognosis who could benefit from an early intervention. Further studies are warranted. Fig 1. Kaplan-Meier survival for patients with very low-, low- and intermediate IPSS-R risk assigned to categories 1 to 3 by LR-PSS. Fig 1. Kaplan-Meier survival for patients with very low-, low- and intermediate IPSS-R risk assigned to categories 1 to 3 by LR-PSS. Disclosures Sureda: Takeda: Consultancy, Speakers Bureau.

Download Full-text

Validation of Low Risk Prognostic Scoring System (LR-PSS) in Patients with Lower Risk IPSS-R Myelodysplastic Syndrome. Results from a Single Center

Blood ◽

10.1182/blood-2019-127901 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 4270-4270

Author(s):

Montserrat Arnan Sangerman ◽

Helena Pomares ◽

Esther Alonso ◽

Mercedes Galiano ◽

Maite Encuentra ◽

...

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Scoring System ◽

Lower Risk ◽

Myeloid Leukemia ◽

Prognostic Value ◽

Low Risk ◽

Acute Myeloid

Background: Myelodysplastic syndrome (MDS) therapeutic decisions have been traditionally based on the International Prognostic Scoring System (IPSS) (Greenberg et al, Blood 1997) and IPSS-R (Greenberg et al, Blood 2012). Recently, next-generation sequencing genetics has been incorporated into management of MDS, however its use is limited in routine clinical practice. Current prognostic models do not allow the identification of patients with low risk disease (low or intermediate-1 IPSS) and poor prognosis, who could benefit from an early intervention. Garcia-Manero et al (Leukemia 2008) described a specific prognostic scoring system for this subgroup of patients (LR-PSS) based on age ≥60 years, hemoglobin <10g/dl, platelet count <50k/uL or 50-200k/uL, bone marrow blasts ≥4% and unfavorable cytogenetics (non-del(5q), non-diploid). This LR-PSS score system enables the stratification of low risk MDS patients into 3 different risk categories; interestingly, the third category identifies a subgroup of patients with a median overall survival (OS) similar to that of patients classified as intermediate-2 and high risk IPSS. Besides, the IPSS-R described by Greenberg et al (Blood 2012) has demonstrated a strong prognostic value for OS and LFS as compared to the IPSS when applied to different independent series of MDS patients. The prognostic impact of the LR-PSS has not been analyzed in MDS patients with very low-, low- and intermediate IPSS-R scores. Aim: To analyze the prognostic value of Low Risk Prognostic Scoring System(LR-PSS) in a population of lower risk MDS patients (very low, low and intermediate IPSS-R) analyzing as endpoints overall survival (OS) and leukemia free survival (LFS). Methods: A total of 890 consecutive patients with MDS (01/1992-7/2018) diagnosed at the Catalan Institute of Oncology in Barcelona were included in the study. 539 (60%) had available cytogenetics and therefore, IPSS-R could be assessed. 474 (88%) patients were classified as very low, low and intermediate IPSS-R and were included in the study. Results: 178 (37.6%) patients were classified as very low, 219 (46.2%) low and 77 (16.2%) intermediated IPSS-R risk MDS. Median age at diagnosis was 73 years (range 32-101). 332 (70%) were male. According to the 2008 WHO classification, 2.5% CRDU, 7.4% RA, 42.2% RCMD, 13.7% RAEB‐1, 3.6% RAEB‐2, 26.4% CMML and 4.2% MDS‐U with isolated 5q deletion. At diagnosis, median hemoglobin, platelet and bone marrow blast were 11.6 g/dL (5.5-17.1), 157 x109/L (1-1492) and 2 % (0-17), respectively. 84 (17.7%) patients had unfavorable LR-PSS cytogenetics at diagnosis. Median follow up time for survivors was 5.4 years (range 0.25-23.8). At the time of last follow up, 58.4 % (277) had died and 71 (15%) had progressed to acute myeloid leukemia. When the LR-PSS was applied to the very low, low and intermediate IPSS-R subgroups, three well-differentiated prognostic categories could be identified: 103 patients (21.7%) category 1 (scores 0-2); 330 (69.6%) patients category 2 (scores 3-4) and 41 (8.7%) patients category 3 (scores 5-7) with significant different OS and LFS. Median OS for categories 1, 2 and were 7.1 years (95% CI 4.9-9.2), 5.7 years (95% CI 4.7-6.7) and 2.8 years (95% CI 2.1-3.6), p<0.001 (Figure 1), respectively. Rate of progression to acute myeloid leukemia was 10% (10/99), 15% (48/323) and 27% (11/411) for categories 1, 2 and 3, respectively. Summary/Conclusion: When applied to a low risk (very low, low and intermediate) IPSS-R cohort of MDS population, LR-PSS identifies a subgroup of patients with a significantly worse prognosis who could benefit from an early treatment intervention. Disclosures Sureda: Janssen: Consultancy, Honoraria; Novartis: Consultancy, Honoraria; Gilead: Consultancy; Roche: Honoraria; BMS: Consultancy, Honoraria; Sanofi: Consultancy, Honoraria; Takeda: Consultancy, Honoraria, Speakers Bureau.

Download Full-text

Prognostic impact of WT1 mutations in cytogenetically normal acute myeloid leukemia: a study of the German-Austrian AML Study Group

Blood ◽

10.1182/blood-2008-10-183392 ◽

2009 ◽

Vol 113 (19) ◽

pp. 4505-4511 ◽

Cited By ~ 116

Author(s):

Verena Ingeborg Gaidzik ◽

Richard Friedrich Schlenk ◽

Simone Moschny ◽

Annegret Becker ◽

Lars Bullinger ◽

...

Keyword(s):

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Negative Impact ◽

Serum Lactate Dehydrogenase ◽

Study Group ◽

Prognostic Impact ◽

Relapse Free Survival ◽

Free Survival ◽

Acute Myeloid

AbstractTo evaluate the incidence and clinical impact of WT1 gene mutations in younger adult patients with cytogenetically normal acute myeloid leukemia (CN-AML), sequencing of the complete coding region was performed in diagnostic samples from 617 patients who were treated on 3 German-Austrian AML Study Group protocols. WT1 mutations were identified in 78 (12.6%) of the 617 patients; mutations clustered in exon 7 (54 of 78) and exon 9 (13 of 78), but also occurred in exons 1, 2, 3, and 8. WT1 mutations were significantly associated with younger age, higher serum lactate dehydrogenase levels, higher blood blast counts, and the additional presence of FLT3-ITD (P < .001) and CEBPA mutations (P = .004). There was no difference in relapse-free survival and overall survival between patients with (WT1mut) or without WT1 mutations. Subset analysis showed that patients with the genotype WT1mut/FLT3-ITDpos had a lower complete remission rate (P = .003) and an inferior relapse-free survival (P = .006) and overall survival (P < .001) compared with those with the genotype WT1mut/FLT3-ITDneg. In conclusion, in our large cohort of younger adults with CN-AML, WT1 mutation as a single molecular marker did not impact on outcome. However, our data suggest a negative impact of the genotype WT1mut/FLT3-ITDpos.

Download Full-text

5-Azacitidine In Patients with Myelodysplasia and Acute Myeloid Leukemia: a Single Centre Experience

Blood ◽

10.1182/blood.v116.21.4969.4969 ◽

2010 ◽

Vol 116 (21) ◽

pp. 4969-4969 ◽

Cited By ~ 1

Author(s):

Capodanno Isabella ◽

Paolo Avanzini ◽

Francesco Merli

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Progression Free Survival ◽

Median Number ◽

Study Population ◽

Blast Count ◽

Acute Myeloid

Abstract Abstract 4969 Introduction Hypomethylating agents have recently been shown to prolong overall survival and improve quality of life in patients with INT-2 and high IPSS risk myelodysplasia (MDS) and low bone marrow blast count acute myeloid leukemia (AML). Patients and Methods Since September 2008 we have been treating 26 patients affected by acute myeloid leukemia (13 patients), MDS (11 patients) or chronic myelomonocytic leukemia (2 patients) with 5-azacitidine. According to recent guidelines, most of myelodysplastic patients eligible for treatment belonged to the IPSS INT-2 or high risk groups. Patients with acute myeloid leukemia had a medullary blast count of 20–30%, except for four cases. Patients with chronic myelomonocytic leukemia had a medullary blast count > 10% and < 20%. The median age of patients when treatment was started was 69,5 years (range: 51–82). Azacitidine was administered subcutaneously (75 mg/m2/d) for 7 days of every 28-day cycle until loss of response or disease progression. Patients received a median number of 5,5 cycles of therapy (range 1–24). We evaluated overall improvement (CR + PR+ HI), the best response obtained and adverse events in the overall study population, according to International Working Group MDS and LMA criteria. In the subgroup of patients who received at least 6 cycles of therapy (10 patients) we also evaluated overall survival (OS) and progression free survival (PFS). Results The results of 5-azacitidine therapy in our cohort of patients are described in Table 1. In the AML cohort, after a median number of 4 cycles (range 1–10), we observed a hematological improvement (HI) in 15% of the patients, a stable disease (SD) in 31% of patients and a lack of response in 38% of patients. In the MDS cohort, after a median number of 7 cycles (range 2–24), we observed a complete response (CR) (including a cytogenetic response) in 36.5% of patients, a partial response (PR) in 9% of patients, a hematological improvement in 45.5% of patients and a stable disease in 18% of patients. The overall improvement (CR + PR + HI) was 15% in the AML cohort and 91% in the MDS cohort. In the LMMC cohort, after a median number of 2.5 cycles (range 1–4), we observed a hematological improvement in 50% of the patients. In the subgroup of patients who received at least six cycles of therapy, the overall survival was 11.5 months and the progression free survival was 9 months. In the overall study population, two patients (8%) discontinued treatment as a result of adverse events. In four non-responder patients (15%) death was due to a rapid progression of disease. Discussion In this analysis we have reported good response rates in MDS patients, with 36.5% of complete response (including a complete cytogenetic response). No CR or PR were observed in AML patients; however, in this subgroup of patients the median follow-up was short (median number of cycles of therapy: four). Furthermore, in these patients even a stable disease with no need of hospitalization and a good quality of life can be considered an important result. Due to the short period of follow-up, 57.5% of our patients received fewer than 6 cycles of 5-azacitidine and their therapy is still ongoing. Conclusions The limited number of cases and the short period of follow-up did not allow us to evaluate overall survival and progression free survival in the overall study population. We will update these data as time progresses. We reported these data in the subgroup of patients who received at least six cycles of therapy. According to current evidence, we observed that 5-azacitidine plays an important role in the treatment of patients with MDS (both with high- and low-IPSS risk) and low bone marrow blast counts AML. In these subgroups of patients, 5-azacitidine prolongs survival and is well tolerated. In our limited experience, this drug had no efficacy when a higher degree of bone marrow blasts (> 30%) was present. Further trials should assess the number of cycles required for treatment, the role of hypometilating agents in low-risk MDS and in patients with AML and a bone marrow blasts counts > 30%. Disclosures: No relevant conflict of interest to declare. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

The Impact of Bone Marrow Hematogones on Umbilical Cord Blood Transplant Outcomes in Acute Myeloid Leukemia Patients,

Blood ◽

10.1182/blood.v118.21.4148.4148 ◽

2011 ◽

Vol 118 (21) ◽

pp. 4148-4148

Author(s):

Theodore Honebrink ◽

Vanessa J. Dayton ◽

Karen Larsen ◽

Qing Cao ◽

Claudio Brunstein ◽

...

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Donor Number ◽

Free Survival ◽

Cord Blood Transplant ◽

Differential Counts ◽

Related Mortality ◽

Acute Myeloid

Abstract Abstract 4148 Hematogones are B-lymphocyte precursors which reside in the marrow and undergo an orderly maturation sequence to give rise to mature B cells. (McKenna, Blood 2001) Recently, the percentage of hematogones detected in the bone marrow (BM) after induction therapy for acute myeloid leukemia (AML) has been associated with improved leukemia-free survival and overall survival. (Chantepie, Blood 2011) Early after umbilical cord blood transplant (UCBT), patients show marked differences in BM hematogone percentages. Little is known about whether such differences are clinically relevant, which may explain why hematogones are not routinely reported in BM differential counts and are, instead, combined with other lymphocytes. We hypothesized that increased hematogones would be associated with superior transplant outcomes. Two independent reviewers assessed hematogone percentages in BM aspirates performed on day 21 and 100 post-UCBT (i.e. D21 & D100) from 88 patients with AML undergoing myeloablative UCBT at the University of Minnesota between 02/1999 and 07/2008. Patients with evidence of relapse at the time of the marrow analysis were excluded. Because of the morphological similarity between hematogones and leukemic lymphoblasts, only patients with AML were included in this analysis. The reviewers were blinded to clinical outcomes. Correlation coefficients for the morphologic assessment of hematogones at D21 and D100 were each >0.8, confirming good interobserver reproducibility (p<0.01). Prospective outcome data for patients in the lowest marrow hematogone quartile (0% at D21 after UCBT and ≤0.9% at D100 after UCBT) were compared with those of patients in the upper three quartiles using a multivariate analysis (MVA) model. This model incorporated donor number (single vs. double), recipient age (<21 vs. ≥ 21), recipient CMV status (negative vs. positive), total, post-thaw CD34 (<0.50 vs. ≥0.50), total, post-thaw CFU (<0.042 vs. ≥ 0.042), and total nucleated cell (TNC) (<0.38 vs. ≥0.38). Endpoints studied included time to neutrophil and platelet recovery, overall survival, disease free survival (DFS), transplant related mortality (TRM), risk of relapse, acute GVHD (aGVHD), and chronic GVHD (cGVHD). At D21 after UCBT, the percentage of marrow hematogones varied from 0 to 10.8% (N = 85). In MVA, a high percentage of hematogones at D21 was associated less aGVHD grade 3–4 (RR=0.3 [0.15–0.59], p=0.01). At D100 after UCBT the percentage of marrow hematogones varied from 0 to 29.8% (N = 69). In MVA, a high percentage of BM hematogones at D100 was associated with improved overall survival (p=0.02) and this was due to a lower treatment related mortality (p=<0.01). (See Table 1) Table 1: MVA examining the percentage hematogones detected in the BM at D100 after UCBT. Outcome Variable RR (95% CI) p value Overall Survival Hem @ Day 100 <0.9 1.00 >=0.9 0.20 (0.05–0.76) 0.02 Donor number 1 1.00 2 0.19 (0.04–0.84) 0.03 Transplant Age <20.5 1.00 >=20.5 4.89 (1.11–21.51) 0.04 Relapse Hem @ Day 100 <0.9 1.00 >=0.9 2.84 (0.32–24.91) 0.35 TRM Hem @ Day 100 <0.9 1.00 >=0.9 0.03 (0–0.34) <0.01 HLA (engrafting unit) 4/6 1.00 5/6 0.61 (0.05–7.13) 0.69 6/6 0 <0.01 CGVHD Hem @ Day 100 <0.9 1.00 >=0.9 0.44 (0.11–1.69) 0.23 Transplant Age <20.5 1.00 >=20.5 3.61 (1.18–11.06) 0.02 RR = relative risk. Hem = percentage hematogones. TRM = transplant-related mortality. HLA = human leukocyte antigen; values correspond to number of matched allelic loci for HLA-A, HLA-B and HLA-DR between recipient and engrafting donor. CGVHD = chronic graft vs. host disease. This study shows that BM hematogone percentage may be a useful prognostic indicator in AML patients following UCBT. We propose that hematogones be routinely reported in BM differential counts. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

Prognostic Impact of 3q21 and 3q26 Cytogenetic Abnormalities in Acute Myeloid Leukemia.

Blood ◽

10.1182/blood.v120.21.2594.2594 ◽

2012 ◽

Vol 120 (21) ◽

pp. 2594-2594

Author(s):

Mario Annunziata ◽

Piera Angelillo ◽

Laura Vicari ◽

Clelia Criscuolo ◽

Felicetto Ferrara

Keyword(s):

Overall Survival ◽

Acute Myeloid Leukemia ◽

Stem Cell ◽

Platelet Count ◽

Myeloid Leukemia ◽

Median Overall Survival ◽

Chromosome 3 ◽

Prognostic Impact ◽

Acute Myeloid

Abstract Abstract 2594 Background: Abnormalities affecting long arm of chromosome 3 are rare but recurrent in Acute Myeloid Leukemia (AML) and are detected in a variable percentage of AML patients according to different series. The 2008 World Health Organization classification recognizes AML with inv(3)(q21q26.2) or t(3;3)(q21;q26.2) as a distinct subtype characterized by a poor prognosis. Allogeneic stem cell transplantation seems to improve outcome in eligible patients with these aberrations. Inappropriate expression of the ecotropic viral integration site 1 (EVI1) was demonstrated in virtually all patients with t(3;3)(q21;q26.2) and inv(3)(q21q26.2); as well as in a majority of patients with other 3q26 rearrangements. Other chromosome 3 abnormalities are rarely recognized in AML patients; clinical and prognostic relevance of these alterations is not yet defined. The aim of this study is to assess the prognostic impact of chromosome 3 abnormalities on disease characteristics and treatment outcome in AML. Patients and methods: A total of 580 consecutive adult patients were diagnosed with AML at our institution between February 2002 and July 2012. Conventional cytogenetic analysis performed on diagnostic bone marrow samples detected the presence of 3q abnormalities in 16 patients (2.7%). Two patients were lost to follow-up and were not evaluated for survival analysis. Molecular status of FLT3 and NPM1 was also performed and results are available for 10 patients. Median follow-up time for patients in this series was 47 months ( range 6–125). Results: There were 10 male and 6 female patients, the median age being 64.5 years (range 33–81), 10 patients had de novo AML while 6 evolved from a previously diagnosed myelodysplastic syndrome (MDS). Karyotype from MDS phase was available in 2 patients; both acquired 3q rearrangement at time of progression to AML. At time of diagnosis median haemoglobin value was 9.0 g/dL (range 4–11); median leucocyte count was 10.5 × 103̂/L (range 2.3 – 431). Median platelet count was 116 × 109̂/L (range 28 – 529), consistently with previous studies, which have shown that these patients present with higher platelet count at diagnosis when compared with no 3q rearranged ones. Regarding cytogenetic features 3 patients had t(3;3)(q21;q26), 3 patients had inv(3) (q21; q26), 3 patients showed a balanced rearrangement involving 3q26, while 6 patients harbored a del3q. One patient showed monosomy 3. Additional chromosomal changes were demonstrated in 5 patients, two of them had a complex karyotype (see Table 1), 3 had a monosomy 7. Thirteen patients out of 14 received intensive induction chemotherapy; complete remission (CR) was achieved in 5 patients (CR rate: 35.7%), the remaining 7 patients were resistant to induction as well as to salvage chemotherapy. Four patients underwent autologous stem cell transplantation. Median overall survival in this series is 5.5 months (range 0 – 20). At present only one patient is still alive and in CR, 20 months after diagnosis. Median disease free survival (DFS) for patients achieving a CR was 9 months (range 6–20). Median overall survival for patients resistant to first-line therapy was 3 months (range 0–6). Clinical features and treatment outcome of the patients are summarized in Table 1. Conclusions: The incidence of 3q abnormalities in our single institution series is 2.4%, in keeping with previous studies. Our findings confirm the association between these alterations and thrombocytosis at diagnosis, preceding MDS or multilineage dysplasia, presence in all FAB subtypes (except M3), association with additional chromosomal abnormalities as well as the poor response to conventional chemotherapy (CR rate 35.7%), and very short DFS in spite of obtaining CR. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

High Expression of Myocyte Enhancer Factor 2C (MEF2C) Is Associated with Adverse Risk Features and Poor Outcome in Pediatric Acute Myeloid Leukemia: A Report from the Children's Oncology Group

Blood ◽

10.1182/blood.v126.23.2570.2570 ◽

2015 ◽

Vol 126 (23) ◽

pp. 2570-2570

Author(s):

George S. Laszlo ◽

Todd A. Alonzo ◽

Chelsea J. Gudgeon ◽

Kimberly H. Harrington ◽

Alex Kentsis ◽

...

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Research Funding ◽

Event Free Survival ◽

Free Survival ◽

Expression Levels ◽

Acute Myeloid ◽

Enhancer Factor

Abstract Background: Myocyte enhancer factor 2C (MEF2C) was initially identified as essential transcription factor for cardiac muscle development. However, subsequent studies have indicated that MEF2C plays a much broader biological role, including in the normal hematopoietic system. Recent studies have now identified MEF2C as cooperating oncogene in acute myeloid leukemia (AML) and suggested a contribution to the aggressive nature of at least some subtypes of AML. These findings raised the possibility that MEF2C could serve as marker of poor-risk disease and, therefore, have prognostic significance in AML. To test this hypothesis, we retrospectively quantified MEF2C expression in participants of the AAML0531 trial and correlated expression levels with disease characteristics and clinical outcome. Patients and Methods: AAML0531 (NCT00372593) was a multicenter phase 3 study that determined the addition of gemtuzumab ozogamicin to intensive chemotherapy among 1,022 eligible patients aged <30 yearswith newly diagnosed de novo non-APL AML, excluding those with bone marrow failure syndromes, juvenile myelomonocytic leukemia, or Down syndrome (if ≤3 years of age) between 2006 and 2010. Cryopreserved pretreatment ("diagnostic") specimens from patients enrolled on AAML0531 who consented to the biology studies and had bone marrow samples were available were included in this study. Total RNA from unsorted specimens was extracted, quantified, and subjected to quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) using TaqMan primers to determine expression of MEF2C and, for normalization, the housekeeping gene, β-glucuronidase (GUSB). Patient samples were run in duplicate, and the ΔΔCT method quantified as 2(-ΔΔCT) was used to determine the expression levels of MEF2C relative to GUSB. Results: In all 751 available patient specimens, MEF2C mRNA was detectable and varied >3,000-fold relative to GUSB (0.0091-29.1272 [median: 0.7978]). Patients with the highest relative MEF2C expression (4th quartile) less likely achieved a complete remission after one course of chemotherapy than the other patients (67% vs. 78%, P=0.005). They also had an inferior overall survival (P=0.014; at 5 years: 55±8% vs. 67±4%), inferior event-free survival (P<0.001; at 5 years: 38±7% vs. 54±4%), and higher relapse risk than patients within the lower 3 quartiles of MEF2C expression (P<0.001; at 5 years: 53±9% vs. 35±5%). Of note, exploratory multiple cutpoint analyses for overall and event-free survival indicated that the most statistically significant results were centered around the Q4 cutpoint region, supporting our approach of comparing patients with the highest quartile of relative MEF2C expression with those having lower relative MEF2C expression. Importantly, MEF2C expression was strongly associated with cytogenetic and molecular abnormalities. Specifically, patients with high MEF2C expression less likely had CBF translocations (inv(16): P=0.007, and t(8;21): P<0.001) or normal karyotype AML (P<0.001); conversely, they were more likely to have leukemia with monosomy 7 (P<0.001) and abnormalities involving 11q23 (P<0.001). Furthermore, patients with high MEF2C less likely had a FLT3/ITD (P =0.018) or a mutation in either NPM1 (P=0.010) or CEBPA (P =0.002). Consistently, patients with high MEF2C expression less likely had low-risk disease (16% vs. 46%, P<0.001) and more likely had standard-risk disease (68% vs. 42%, P <0.001) than those with lower MEF2C expression. Indeed, after adjustment for disease risk, age, FAB category, and treatment arm, high MEF2C expression was no longer statistically significantly associated with inferior overall survival (hazard ratio [HR]=0.99 [95% confidence interval: 0.72-1.36], P=0.929), inferior event-free survival (HR: 1.14 [0.86-1.49], P=0.365), or higher relapse risk (HR: 1.32 [0.91-1.92], P=0.137), suggesting that MEF2C cooperates with additional pathogenic abnormalities. Conclusion: High MEF2C expression identifies a subset of AML patients with adverse-risk disease features and poor outcome. These findings provide the rationale for therapeutic targeting of MEF2C transcriptional activation in AML. Disclosures Walter: AstraZeneca, Inc.: Consultancy; Covagen AG: Consultancy; Seattle Genetics, Inc.: Research Funding; Amgen, Inc.: Research Funding; Pfizer, Inc.: Consultancy; Amphivena Therapeutics, Inc.: Consultancy, Research Funding.

Download Full-text

Real World Efficacy Evaluation of Branded and Copy Imatinib in Chronic Myeloid Leukemia: A Retrospective Multicentric Study from Argentina

Blood ◽

10.1182/blood-2020-137792 ◽

2020 ◽

Vol 136 (Supplement 1) ◽

pp. 36-37

Author(s):

Ana Ines Varela ◽

Georgina Bendek ◽

Carolina Pavlovsky ◽

Maria Josefina Freitas ◽

Veronica Ventriglia ◽

...

Keyword(s):

Overall Survival ◽

Board Of Directors ◽

Myeloid Leukemia ◽

Molecular Response ◽

Advisory Committees ◽

Free Survival ◽

Safety And Efficacy ◽

Kaplan Meier ◽

Sokal Score

Background: Data on the safety and efficacy of copy drugs is usually unavailable. Imatinib mesylate is used to treat chronic myeloid leukemia (CML) patients in Argentina since 2002. During the last decade more than ten different imatinib copies are marketed by the different health-care systems in the country, usually for cost issues. In spite of the undoubted benefit of this tyrosine-kinase inhibitor indication in CML, there is no solid evidence that supports copy drug equivalent outcomes for this patient population. Aim: To compare the clinical presentation, treatment response and outcome of a chronic phase (CP) CML patient cohort treated with branded and copy imatinib in the real-life setting. Methods: Multicentric, retrospective trial based on data obtained from medical charts of adult CP CML patients treated with imatinib in 9 centers in Argentina from 2002 to 2020.We analyzed demographic characteristics and clinical characteristics described for branded and copy imatinib treated cohorts. Frequency of complete cytogenetic response (CCyR) at 12 months, Major molecular response or better(≥MMR) at 12, 18 and 24 months and overall MR4.0, MR4.5 and deep molecular response (MR4.0 +MR4.5 IS) were analyzed. Event was defined as failure, progression or CML related death. Kaplan Meier comparison of event free, progression free and overall survival. Statistics: IBM SPSS version 1. Results: A total of 568 CP CML adult patients (pt) treated with imatinib were included. Mean age at diagnosis: 45.7 years (range 18 - 85). Male 55.6% (316/568). Sokal Score was recorded in 471 pt: 57% (269/471) low, 26% (122/471) intermediate and 17% (80/471) high-risk. Median follow-up 107 months (RIQ: 36-149). Branded imatinib treatment 330 (58%) and imatinib copies 238 (42%). For branded and copy imatinib cohorts mean age 46,1 (18-85) and 45.3(18-80), male 53% (175/330) and 59% (141/238), median follow up 102 (RIQ 101-130) and 61 (RIQ 62-146) respectively. Sokal score low 58% (164/284) and 56% (105/187), intermediate 27% (77/284) and 24% (45/187) and high 15% (43/284) and19% (37/187). Frequency of CCyR at 12 months 71% (67/94) and 69% (41/59), ≥MMR at 12 months 57% (79/138) and 43% (39/89), ≥MMR 18m 66 % (61/92) and 71% (43/60), ≥MMR 24m 65% (96/147) and 79% (58/73). Overall MR4, MR 4.5 and Deep MR with branded imatinib 62.4% (186/298), 42% (118/276) and 63% (189/300), compared to 45(97/214), 24% (50/207) and 46% (99/215) with copies. Difference in evaluation throughout the treatment periods with loss of data did not allow response rate statistical comparison in predetermined timepoints. Kaplan Meier Event free survival median 229 months vs 75 months p 0.001, Progression free survival mean 318 months vs 208 pt 0.034 and Overall Survival mean 275 months vs 206 months for branded and copy imatinib respectively. Discussion: Several case reports have shown poor outcomes in patients treated with imatinib copy drugs, including loss of responses previously attained with branded imatinib. This study reports data from a large cohort of CP CML patients treated in daily practice during a long period of time. Treatment results at determined timepoints is comparable. Although management and treatment decisions were performed in different time periods, results show different outcomes in EFS and PFS between patients treated with branded vs copy imatinib. Overall survival in both cohorts is comparable. As studies assesing the safety and efficacy of the copy drugs compared with branded imatinib will hardly be performed this evidence calls for careful attention and strict follow up measures when managing CML patients with copy imatinib. Figure Disclosures Varela: Novartis: Consultancy, Speakers Bureau. Pavlovsky:Pint Pharma: Speakers Bureau; Pfizer: Speakers Bureau; BMS: Speakers Bureau; Novartis: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Freitas:Pfizer: Consultancy, Other: Advisory Board. Pavlovsky:Varifarma: Speakers Bureau; Astra Zeneca: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Janssen: Membership on an entity's Board of Directors or advisory committees, Other: travel grants, Speakers Bureau; Abbvie: Membership on an entity's Board of Directors or advisory committees, Other: Travel grants, Speakers Bureau. Moiraghi:Novartis: Speakers Bureau; BMS: Speakers Bureau.

Download Full-text

High Dose Cytarabine Is Superior to Intermediate Dose Cytarabine As Post-Remission Therapy for Younger Patients with Favorable Risk Acute Myeloid Leukemia

Blood ◽

10.1182/blood.v128.22.4032.4032 ◽

2016 ◽

Vol 128 (22) ◽

pp. 4032-4032

Author(s):

Nurul Aidah Abdul Halim ◽

Gee Chuan Wong ◽

Ho YL Aloysius ◽

William YK Hwang ◽

Yeh Ching Linn ◽

...

Keyword(s):

Overall Survival ◽

Myeloid Leukemia ◽

Risk Group ◽

High Dose ◽

Free Survival ◽

Younger Patients ◽

High Dose Cytarabine ◽

Acute Myeloid ◽

Intermediate Dose

Abstract In the initial CALGB study and the retrospective analysis that followed 4 years later, high dose cytarabine, used as postremission chemotherapy in patients with acute myeloid leukemia (AML), resulted in significantly better overall survival and sustained remission when compared to lower doses of cytarabine, especially in young patients with core binding factor mutations (CBF). However, the toxicity seen with high dose cytarabine (HiDAC) prompted several studies to evaluate the role of intermediate dose cytarabine (MidAc). These studies concluded that MidAc produced similar overall survival and leukemia free survival to HiDAC while achieving a better side effect profile. Following these later findings, the consolidation protocol for AML patients 60 years or younger treated in the Singapore General Hospital was changed to 3 - 4 cycles of cytarabine 1.5g/m2 q12 D1, 3, and 5 (MidAc) from 3g/m2 q12 D1, 3, and 5 (HiDAC) in 2011. Cytarabine dose for older patients remain unchanged at 1g/m2 q12 D1, 3, and 5. A five year landmark analysis was performed to assess the difference in outcomes between these two regimens. Patients with non-M3 AML treated between 2004 and 2015 who received a cytarabine consolidation after achieving complete morphologic remission post standard 3+7 induction procotol (idarubicin 12mg/m2 D1-3 and cytarabine 100mg/m2 as a continuous infusion from D1-7) were included in the analysis. Patients who received an autologous or allogeneic hematopoietic stem cell transplant at first complete remission were excluded. 92 patients were identified for analysis with median age of 47 (range 16-76). The majority of patients belonged to the ELN favorable risk group (62 out of 92). 77 patients were aged 60 years or younger amongst which 48 patients received HiDAC and 29 patients received MidAc after a change in protocol. The median follow up for patients receiving HiDAC and MidAc was 104 and 39 months respectively. The 5-year overall survival (OS) between patients who had HiDAC and MidAc was 66.7% and 45.7% (p=0.16); and the 5-year leukemia free survival (LFS) was 51.9% and 41.6% (p=0.23). For comparison, the 5-year OS for patients above the age of 60 treated before and after 2011 was 16.7% and 46.7% (p = 0.3) and LFS was 16.7% and 55.6% (p= 0.35) respectively. Amongst 55 patients aged 60 or younger with favorable ELN risk, the survival outcomes were significantly better in the cohort receiving HiDAC compared with MidAc. 5 year OS were 86.1% vs. 44.5%, median OS not reached vs. 45 mths (p= 0.004). 5 year LFS were 63.9 vs. 36.8%, median LFS not reached vs. 20mths (p= 0.03). The cumulative incidence of relapse at 5 years was 33.4% in HiDAC and 61.1% in MidAc (p=0.04). No survival differences between the HiDAC and MidAc cohort were seen in the non-favorable risk group; 5 year OS was 26.7% vs 36.7% (p = 0.22), 5 year LFS was 26.7% vs 33.3%(p = 0.78) respectively. 13 (23.7%) favorable risk patients aged 60 or younger died during the follow up period. 5 patients died of complications of treatment, 4 (8%) in the HiDAC cohort and 1(3%) in the MidAc group (p= 0.4). Most deaths (4 out of 5) were attributable to neutropenic sepsis. Median age of patients who died during treatment was 54 years (range: 36 to 58) compared to 45 years (range: 15 to 60), (p = 0.23) amongst those who did not die from treatment related complications. In conclusion, in our cohort of patients consolidated with cytarabine monotherapy, HiDAC offers a better OS and LFS outcomes compared with MidAc in younger patients with favorable risk profile, albeit with a non-significant trend to an increase in treatment related mortality. Further studies looking into the interaction of cytarabine dose with specific genetic and cytogenetic AML sub-groups are warranted. OS of patients aged 60 or younger with ELN favorable risk AML (p= 0.01) Cumulative Incidence of Relapse of patients aged 60 or younger with ELN favorable risk AML (p= 0.04) Figure 1 Figure 1. Figure 2 Figure 2. Disclosures Hwang: Roche: Honoraria, Other: Travel support; Celgene: Honoraria, Other: Travel support; Pfizer: Honoraria, Other: Travel support; Sanofi: Honoraria, Other: Travel support; Janssen: Honoraria, Other: Travel support; MSD: Honoraria, Other: Travel support; Novartis: Honoraria, Other: Travel support; BMS: Honoraria, Other: Travel support.

Download Full-text

Using Circ-ANAPC7 As a Novel Type of Biomarker in the Monitoring of Acute Myeloid Leukemia

Blood ◽

10.1182/blood-2019-128179 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 5179-5179

Author(s):

Ying Shen ◽

Yachun Jia ◽

Ru Zhang ◽

Hongli Chen ◽

Yuandong Feng ◽

...

Keyword(s):

Bone Marrow ◽

Overall Survival ◽

Acute Myeloid Leukemia ◽

Myeloid Leukemia ◽

Expression Level ◽

Circular Rnas ◽

Newly Diagnosed ◽

Free Survival ◽

Non Coding Rnas ◽

Acute Myeloid

Introduction: Acute myeloid leukemia (AML) is a heterogeneous disease characterized by the clonal proliferation of immature myeloid progenitor cells in the bone marrow, compressing normal blood cell production and leading to bone marrow failure ultimately. Overwhelming evidence has established that non-coding RNAs (ncRNAs), such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs) have great role in AML pathogenesis. Circular RNAs (circRNAs) that occupy gene expression at the transcriptional or post-transcriptional level have great potential to be biomarker for types of cancers. We have screened one altered circRNA named circ-ANAPC7 in AML before. In this study, we aimed to validate its expression by enlarging sample size and illuminating the diagnostic and monitoring value of circ-ANAPC7 in AML. Methods: Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was supposed to confirm the expression of circ-ANAPC7 of AML patients. The sequences of circ-ANAPC7 primers were as follows: 5′- GGGAGCAGCACTTAGGAACAT -3′ (sense) and 5′-AAAGCTGGTACTTCTGAGGTGG-3′ (antisense). Receiver operating characteristic (ROC) curve was carried out to evaluate the diagnostic value. Overall survival rate and event-free survival rate were estimated by the Kplan-Meier analysis and compared using the log-rank test. All tests were two-sided, and P < 0.05 was defined as a significant difference. Results: The expression level of circ-ANAPC7 in newly diagnosed AML was significantly higher than CR patients and iron deficiency anemia (IDA) control group (P < 0.001) (Figure 1A). Furthermore, we chose 24 AML patients who undergo the condition of newly diagnosed AML, CR and relapse to dynamical monitor the expression of circ-ANAPC7. We discovered that circ-ANAPC7 expression level changed accompanied with the disease condition transformation. It was high expressed in newly diagnosed and relapsed AML patients. When patients got CR, the expression level of circ-ANAPC7 decreased (P < 0.05). In the continuous CR patients, it remained in a minimal level (Figure 1C). ROC curve analysis revealed that circ-ANAPC7 has significant value of AML diagnosis (AUC = 0.915, P < 0.001) (Figure 1B). Moreover, we conducted survival analysis to explore long-term effect of circ-ANAPC7 expression in AML patients. The result revealed that circ-ANAPC7 expression was not related to overall survival (OS) and disease-free survival (DFS) of AML patients (P > 0.05) (Figure 1D). Conclusions: We validated that circ-ANAPC7 was upregulated in AML patients. The clinical analysis revealed that circ-ANAPC7 may be a predictive index for diagnosing and supervising early recurrence of AML. What's more, additional molecular mechanisms and biological functions of circ-ANAPC7 merit deeper investigation. Figure 1 Disclosures No relevant conflicts of interest to declare.

Download Full-text

Minimal Residual Disease in Patients with Acute Myeloid Leukemia Quantified by Multiparameter Flow Cytomety and Quantitative RT-PCR Is an Independent Prognostic Parameter.

Blood ◽

10.1182/blood.v104.11.319.319 ◽

2004 ◽

Vol 104 (11) ◽

pp. 319-319 ◽

Cited By ~ 1

Author(s):

Wolfgang Kern ◽

Claudia Schoch ◽

Torsten Haferlach ◽

Daniela Voskova ◽

Wolfgang Hiddemann ◽

...

Keyword(s):

Bone Marrow ◽

Acute Myeloid Leukemia ◽

Minimal Residual Disease ◽

Myeloid Leukemia ◽

Residual Disease ◽

Prognostic Impact ◽

Cox Regression Analysis ◽

Minimal Residual ◽

Acute Myeloid

Quantification of minimal residual disease (MRD) is becoming increasingly important to guide therapy in patients with acute myeloid leukemia (AML). While MFC can be applied to more patients with AML than QPCR, the latter has the advantage of a higher sensitivity in many cases. We compared data obtained by both methods in parallel in bone marrow samples in 160 patients at diagnosis and at 469 follow-up checkpoints. MFC was applied at diagnosis with a comprehensive panel of antibodies to identify leukemia-associated aberrant immunophenotypes (LAIP) useful for MRD monitoring. QPCR targeted on the leukemia-specific fusion transcripts AML1-ETO, AML1-EVI1, CBFB-MYH11, MLL-AF10, MLL-AF6, MLL-AF9, MLL-ELL, MLL-ENL, and PML-RARA as well as overexpression of EVI1, length mutations of FLT3, and partial tandem duplications of MLL. In order to adjust for differences in the percentages of bone marrow cells covered by the respective LAIP by MFC at diagnosis and for the heterogeneity of transcript levels detected by QPCR at diagnosis, the logarithmic difference (LD) was calculated for each follow-up sample in comparison to the diagnostic sample. There was a significant correlation between MFC and QPCR with regard to the LD from diagnosis to follow-up checkpoint (r=0.645, p=0.000001). Concordant results with regard to negativity between QPCR (no signal) and MFC (<0.01% positive cells) was found in 301/469 (64.2%) samples (both methods positive, 270 (57.6%); both methods negative, 31 (6.6%)). In 44 samples (9.4%) QPCR detected positivity and MFC negativity while in 124 samples (26.4%) MFC detected positivity and QPCR negativity (sensitivity of QPCR was lower than 1:100,000 in some cases). In 133 patients clinical follow-up data was available allowing the analysis of the prognostic impact of MRD levels. Cytogenetics were favorable, intermediate, and unfavorable in 86, 30, and 17 cases, respectively. Median age was 46 years (range, 17–83). Median event-free survival (EFS) was 22.1 months, overall survival (OS) at three years was 77%. The median LDs for MFC and QPCR at the checkpoint 1 (up to day 21), 2 (day 22–60), 3 (day 61–120), 4 (day 121–365), and 5 (after day 365) were 2.40 and 0.62, 2.05 and 1.55, 2.51 and 3.34, 2.71 and 3.70, and 2.60 and 3.45, respectively. Separating patients according to these median LDs resulted in a better EFS and OS for cases with higher LDs at all five checkpoints for each method. Significant differences in EFS were observed at checkpoints 2 (MFC, 22.1 vs. 12.6 months, p=0.0379; QPCR, median not reached vs. 9.9, p=0.0081), 3 (QPCR, 30.9 vs. 14.1 months, p=0.0011), 4 (MFC, median not reached vs. 16.9 months, p=0.0007; QPCR, median not reached vs. 15.1 months, p=0.0102), and 5 (QPCR, median not reached vs. 17.2, p=0.0008). Cox regression analysis taking into consideration cytogenetics, age, WBC count, and bone marrow blast count at diagnosis identified the LD at checkpoint 4 determined by MFC and the LD at checkpoints 2 and 5 determined by QPCR as independent prognostic factors. The results of our analyses confirm that both MFC and QPCR are highly sensitive methods capable of quantifying MRD in AML. While data are concordant for both methods in many cases, either of the two has advantages in distinct cases depending on the individual MRD marker. Clinical trials should consider MRD monitoring by both methods in order to prove their respective roles in risk prediction and treatment stratification.

Download Full-text