scholarly journals Isolation, conventional and molecular characterization of Salmonella spp. from newly hatched broiler chicks

AMB Express ◽  
2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Mahmoud E. Sedeik ◽  
Nahed A. El-shall ◽  
Ashraf M. Awad ◽  
Sally M. Elfeky ◽  
Mohamed E. Abd El-Hack ◽  
...  
Keyword(s):  
Molecular Characterization ◽  
Broiler Chicks ◽  
Salmonella Spp

Prevalence and Molecular Characterization of Microbial Contaminants in Raw Cow Milk of Tangail District in Bangladesh

2021 ◽  
Vol 17 ◽  
Author(s):  
Shahin Mahmud ◽  
Md. Firoz Ali ◽  
Md. Omar Faruque ◽  
Muhammad Wasim ◽  
Fatematuz Zuhura Evamoni ◽  
...  
Keyword(s):  
Molecular Characterization ◽  
Raw Milk ◽  
Health Impact ◽  
Cow Milk ◽  
Milk Consumption ◽  
Salmonella Spp ◽  
Mean Values ◽  
The Mean ◽  
Quality Of Milk

Objectives: The aim of this study is to evaluate the microbial quality and associated health Methodology: An intensive study was carried out from January¬ to October 2019 at the Tangail district of Bangladesh to assess bacterial contamination of raw milk. A total of 60 samples were examined by following the standard bacteriological methods and the health impact was evaluated with the help of a semi-structured-based questionnaire. Molecular characterization of isolated bacteria was carried out by PCR. Results: Results revealed the mean values of TVC and TCC in raw milk, udder, oil, and utensil samples were 7.6×106, 8.8×106, 4.6×106, and 1.3×106 cfu/ml and 3.7×105, 1.4×106, 4.4×105, and 8.9×104 cfu/ml, respectively. The yeast and mold in raw milk, udder, and oil were 1.5×103, 1.8×103, and 1.3×102cfu/ml, respectively, and the mean values of E. coli in the above-mentioned samples were 1.9×103, 1.8×104, 2.1×103, and 1.6×103cfu/ml, respectively. On the other hand, the mean values of Salmonella spp. in raw milk, udder, oil, and utensil samples were 2.4×102, 7.9×102, 1.5×102, and 1.1×102cfu/ml, respectively. Some selected isolates confirmed by molecular identification were tested for their sensitivity against some common antibiotics used in Bangladesh. Escherichia coli showed 70% resistance to Amoxicillin and 90% sensitivity to Ciprofloxacin whereas Salmonella spp. And Staphylococcus aureus showed 90% resistance to Ampicillin and both were 80% and 90% sensitive to Ciprofloxacin, respectively. Conclusion, Significance, and Impact of Study: Milk producers should be appropriately trained to monitor the overall hygienic conditions surrounding the production and handling of milk until it reaches the consumer. Frequent monitoring of the milk production facility, occasional testing of raw milk, and minimal use of antibiotics will ensure the quality of milk. Consumption of quality milk and avoidance of raw milk consumption will reduce the health risk of the consumers.

scholarly journals Presence of Antibiotic-Resistant Pathogens in School Cafeteria’s Fast Foods in Dhaka City, Bangladesh: A Growing Concern

2021 ◽  
pp. 1-8
Author(s):  
Sompa Reza ◽  
Ila Ismail ◽  
Sharmin Rumi Alim
Keyword(s):  
Molecular Characterization ◽  
Foodborne Pathogens ◽  
Diffusion Method ◽  
Rrna Gene ◽  
Dhaka City ◽  
Biochemical Tests ◽  
Salmonella Spp ◽  
Fast Foods ◽  
Increased Risk

Burden, due to foodborne diseases, particularly Salmonella infection, is high in developing countries like Bangladesh. This research aimed at the molecular characterization of Salmonella spp., isolated from selected school canteen’s fast foods in Dhaka city, Bangladesh, and to evaluate the antibiotic resistance patterns of isolated foodborne pathogens. The school cafeterias were selected by the convenience sampling method. The samples were collected aseptically, and serial dilutions were made. The bacterial colonies were isolated by spread plate technique using appropriate media, and bacterial identification was carried out using gram staining and biochemical tests such as MIU, KIA, Oxidase, and Catalase test. The strain of Salmonella spp. was confirmed by molecular characterization employing the 16S rRNA gene sequencing method. The susceptibility of the isolates to various antibiotics was observed by modified Kirby-Bauer disk diffusion method. Most of the samples were found to contain an unacceptable level of a total aerobic count, which ranged from 5.6×105 to 6.1×107 and 3.4×104 to 7.2×107 for burger and sandwich samples, respectively. Significant isolates from the pathogenic strains were Salmonella spp., Shigella, Klebsiella, Proteus, E. coli, Vibrio spp., Clostridium spp., Staphylococcus spp., and others. The further molecular characterization of isolated Salmonella spp. suggests the similarity with Salmonella enterica serovar Rissen SeqrSC0091. Most isolates were resistant against Ampicillin (100%), Azithromycin (60.87%), Tetracycline (39.43%), Colistin (32.61%), while were highly sensitive to Gentamycin and Chloramphenicol. The presence of multidrug-resistant foodborne pathogens at this high level in the school cafeteria’s fast foods signifies an increased risk for the children’s health.

Occurrence and phenotypic and molecular characterization of Listeria monocytogenes and Salmonella spp. in slaughterhouses in southern Brazil

2017 ◽  
Vol 100 ◽  
pp. 96-101 ◽  
Author(s):  
Mariana Almeida Iglesias ◽  
Isabela Schneid Kroning ◽  
Luana Tombini Decol ◽  
Bernadette Dora Gombossy de Melo Franco ◽  
Wladimir Padilha da Silva
Keyword(s):  
Listeria Monocytogenes ◽  
Molecular Characterization ◽  
Southern Brazil ◽  
Salmonella Spp

scholarly journals Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern

2019 ◽  
Vol 5 (3) ◽  
pp. 219-225
Author(s):  
Nazmi Ara Rumi ◽  
Md Aoulad Hosen ◽  
Tonmoy Kundu ◽  
Md Shajedur Rahman
Keyword(s):  
Antibiotic Resistance ◽  
Molecular Characterization ◽  
Salmonella Enterica ◽  
Universal Primers ◽  
Rrna Gene ◽  
Salmonella Spp ◽  
Internal Organs ◽  
Phylogenetic Tree Analysis ◽  
Wide Range

Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans. Asian J. Med. Biol. Res. June 2019, 5(3): 219-225

scholarly journals Molecular characterization of Salmonella spp. and Listeria monocytogenes strains from biofilms in cattle and poultry slaughterhouses located in the federal District and State of Goiás, Brazil

PLoS ONE ◽  
2021 ◽  
Vol 16 (11) ◽  
pp. e0259687
Author(s):  
Emilia Fernanda Agostinho Davanzo ◽  
Rebecca Lavarini dos Santos ◽  
Virgilio Hipólito de Lemos Castro ◽  
Joana Marchesini Palma ◽  
Bruno Rocha Pribul ◽  
...  
Keyword(s):  
Listeria Monocytogenes ◽  
Molecular Characterization ◽  
Foodborne Pathogens ◽  
Federal District ◽  
Multidrug Resistant ◽  
Animal Origin ◽  
Meat Production ◽  
Salmonella Spp

Listeria monocytogenes and Salmonella spp. are considered important foodborne pathogens that are commonly associated with foods of animal origin. The aim of this study was to perform molecular characterization of L. monocytogenes and Salmonella spp. isolated from biofilms of cattle and poultry slaughterhouses located in the Federal District and State of Goiás, Brazil. Fourteen L. monocytogenes isolates and one Salmonella sp. were detected in poultry slaughterhouses. No isolates were detected in cattle slaughterhouses. All L. monocytogenes isolates belonged to lineage II, and 11 different pulsotypes were detected. Pulsed-field gel electrophoresis analysis revealed the dissemination of two strains within one plant, in addition to the regional dissemination of one of them. The Salmonella isolate was identified via whole genome sequencing as Salmonella enterica serovar Minnesota ST548. In the sequence analysis, no premature stop codons were detected in the inlA gene of Listeria. All isolates demonstrated the ability to adhere to Caco-2 cells, while 50% were capable of invading them. Antimicrobial resistance was detected in 57.1% of the L. monocytogenes isolates, and resistance to sulfonamide was the most common feature. The tetC, ermB, and tetM genes were detected, and four isolates were classified as multidrug-resistant. Salmonella sp. was resistant to nine antimicrobials and was classified as multidrug-resistant. Resistance genes qnrB19, blaCMY-2, aac(6’)-Iaa, sul2, and tetA, and a mutation in the parC gene were detected. The majority (78.5%) of the L. monocytogenes isolates were capable of forming biofilms after incubation at 37°C for 24 h, and 64.3% were capable of forming biofilms after incubation at 12°C for 168 h. There was no statistical difference in the biofilm-forming capacity under the different evaluated conditions. Salmonella sp. was capable of forming biofilms at both tested temperatures. Biofilm characterization was confirmed by collecting the samples consistently, at the same sampling points, and by assessing biofilm formation in vitro. These results highlight the potential risk of cross-contamination in poultry slaughterhouses and the importance of surveillance and pathogen control maintenance programs within the meat production industry.

Sign in / Sign up

Export Citation Format

Share Document