scholarly journals An outbreak of caprine toxoplasmosis - investigation and case report

2018 ◽  
Vol 48 (5) ◽  
Author(s):  
José Mauricio Ferreira Neto ◽  
Fernanda Pinto Ferreira ◽  
Ana Carolina Miura ◽  
Jonatas Campos de Almeida ◽  
Felippe Danyel Cardoso Martins ◽  
...  
Keyword(s):  
Management Practices ◽  
Clinical Signs ◽  
Antibody Test ◽  
Buffy Coat ◽  
Soil Samples ◽  
Dairy Goat ◽  
Blood Samples ◽  
Lactating Goats ◽  
Polymerase Chain ◽  
Immunofluorescence Antibody Test

ABSTRACT: The present study aimed to investigate an abortion outbreak in a dairy goat herd in the municipality of Arapoti, Parana, Brazil. At the beginning of the outbreak, blood samples were collected from 33 goats with clinical signs; later, of the whole goat herd, two cats and two dogs. Milk samples were collected from 78 lactating goats. Four environmental soil samples and four samples of feed residue from goat feeders were collected too. Immunofluorescence antibody test (IFA) was used for serodiagnosis, the molecular analysis was conducted by means of the polymerase chain reaction (PCR), for the isolation of the etiological agent the bioassay was used. The results of the IFA revealed that 76.53% (137/179) of the goats, two dogs and two cats were seropositive for Toxoplasma gondii. Bioassay revealed one buffy coat and two milk sample having viable T. gondii. In the PCR, 11 whole blood samples, eight milk, three feeder troughs, and all soil samples were positive. The findings of the present study confirmed an outbreak caused by environmental contamination (of soil and feed) with T. gondii oocysts that could have been shed by kittens that lived on the farm and had access to the stock of goat food, facilitating this contamination, which reinforces the need for veterinary assistance and good management practices on farms.

scholarly journals Evaluation of a Preclinical Blood Test for Scrapie in Sheep Using Immunocapillary Electrophoresis

2006 ◽  
Vol 89 (3) ◽  
pp. 720-727 ◽  
Author(s):  
Roy Jackman ◽  
David J Everest ◽  
Mary Jo Schmerr ◽  
Mohammed Khawaja ◽  
Pat Keep ◽  
...  
Keyword(s):  
Capillary Electrophoresis ◽  
Prion Protein ◽  
Clinical Signs ◽  
Test System ◽  
Buffy Coat ◽  
Infected Sheep ◽  
Test Method ◽  
Peptide Sequence ◽  
Transmissible Spongiform Encephalopathies ◽  
Blood Samples

Abstract An analytical method is described for detection of endogenous disease-associated prion protein in the buffy coat fraction from the blood of sheep infected with scrapie. The method has been improved and evaluated for its performance in the preclinical diagnosis of ovine transmissible spongiform encephalopathies. The test system uses a protocol for sample preparation that includes extraction and concentration and a test method that uses a liquid-phase competitive immunoassay for prion protein. Antibodies directed to a peptide sequence at the C-terminus of the prion protein (PrP) and a fluorescein-labeled peptide conjugate are used in the assay. Free zone capillary electrophoresis with laser-induced fluorescence for detection is used to separate the antibody-bound fluorescently labeled peptide and free labeled peptide. In this assay, the PrP competes with the fluorescently labeled peptide for limited antibody binding sites, which results in a reduction of the peak representing the immunocomplex of the antibody bound to the fluorescently labeled peptide. When blood samples from scrapie-infected sheep aged 712 months and of the scrapie-susceptible PrP genotypes VRQ/VRQ and VRQ/ARQ were analyzed, the abnormal PrP was found in blood samples. These results correlated with the post-mortem diagnosis of scrapie. The sheep were preclinical and appeared normal at the time of testing but later died with clinical disease approximately 12 months after testing. In older animals, and those with clinical signs, a smaller percentage of animals tested positive. This study has demonstrated that this technology can be used as a sensitive, rapid preclinical test to detect the disease-associated PrP in the blood of scrapie-infected sheep. Improvements in the extraction protocol and capillary electrophoresis conditions will enhance the robustness of this test.

Systemic Mycobacterium avium Infection in a Dog Diagnosed by Polymerase Chain Reaction Analysis of Buffy Coat

2005 ◽  
Vol 41 (2) ◽  
pp. 128-132 ◽  
Author(s):  
James F. Naughton ◽  
Katrina L. Mealey ◽  
K. Jane Wardrop ◽  
J. Lindsay Oaks ◽  
Daniel S. Bradway
Keyword(s):  
Polymerase Chain Reaction ◽  
Clinical Signs ◽  
Mycobacterial Infection ◽  
Polymerase Chain Reaction Analysis ◽  
Buffy Coat ◽  
Pcr Analysis ◽  
Chain Reaction ◽  
The Public ◽  
Avium Infection ◽  
Polymerase Chain

Dogs may be infected by Mycobacterium (M.) tuberculosis, M. bovis, and M. avium complex, and the clinical signs associated with each of these infections may be indistinguishable. Rapid speciation of the infecting organism is desirable because of the public health concerns associated with M. bovis and M. tuberculosis infections. A mycobacterial infection was suspected in the dog of this report based on acid-fast staining of organisms in macrophages obtained from liver aspirates and buffy-coat preparations. Polymerase chain reaction (PCR) analysis of a buffy-coat preparation identified M. avium.

scholarly journals Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus)

2018 ◽  
Vol 42 (1) ◽  
pp. 72-78
Author(s):  
Karim Sadun Ali Al-Ajeeli
Keyword(s):  
Polymerase Chain Reaction ◽  
Molecular Detection ◽  
Clinical Signs ◽  
Epidemiological Studies ◽  
Buffy Coat ◽  
Chain Reaction ◽  
Cervical Lymph Nodes ◽  
Equus Asinus ◽  
Reverse Primer ◽  
Polymerase Chain

     Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

scholarly journals Case Report: A Case of Caprine Arthritis Encephalitis in Dairy Goat Farms in South Korea

2021 ◽  
Vol 8 ◽  
Author(s):  
Ga-In Son ◽  
Eui-Ju Hong ◽  
Hyun-Jin Shin
Keyword(s):  
Clinical Signs ◽  
Capra Hircus ◽  
Dairy Goat ◽  
Dairy Goats ◽  
Chain Reaction ◽  
Caprine Arthritis Encephalitis Virus ◽  
Negative Results ◽  
Capra Aegagrus ◽  
Carpal Joint ◽  
Polymerase Chain

One Saanen dairy goat (Capra aegagrus hircus) farm in Korea reported that some goats showed clinical signs such as arthritis, paralysis, carpal joint swelling, and even death. We monitored clinical signs and pathological lesions. In the laboratory, we confirmed caprine arthritis encephalitis virus (CAEV) infection by polymerase chain reaction (PCR). We examined all the dairy goats on the farm and found that many of them were positive. In conclusion, CAEV infection was detected in the majority of the goats in this farm, and it induced severe clinical signs impacting productivity and causing important economic shortfalls. We need to regularly investigate all dairy goat farms, and, more importantly, inspection of the quarantine stage should be required before importation. Interestingly, we found all negative results in Korean native black goats (Capra hircus linnaeus).

scholarly journals Serological and Molecular Findings of Leishmania Infection in Healthy Donkeys (Equus asinus) from a Canine Leishmaniosis Endemic Focus in Tuscany, Italy: A Preliminary Report

Pathogens ◽  
2019 ◽  
Vol 8 (3) ◽  
pp. 99
Author(s):  
Simona Nardoni ◽  
Iolanda Altomonte ◽  
Federica Salari ◽  
Mina Martini ◽  
Francesca Mancianti
Keyword(s):  
Central Italy ◽  
Antibody Test ◽  
Leishmania Infection ◽  
Canine Leishmaniosis ◽  
Equus Asinus ◽  
Potential Reservoir ◽  
Positive Score ◽  
Polymerase Chain ◽  
Immunofluorescence Antibody Test

Leishmania parasites are considered to be emergent zoonotic pathogens, which is a new concept regarding their epidemiology and the identification of novel animal hosts. The present study is the first in Italy to evaluate anti Leishmania seroprevalence, and the first in Europe to detect parasite DNA in donkeys’ blood. The study was performed on jennies living in a Leishmania infantum endemic area of Central Italy. One hundred and ten blood samples were obtained from 67 healthy lactating Amiatina jennies that were semi-extensively reared in Tuscany. When possible, more than one sample was subsequently obtained from the same subject. All samples were processed by immunofluorescence antibody test (IFAT) and by polymerase chain reaction (PCR). For the results, 11 out of 30 animals (36.7%) showed positive scores under IFAT. In addition, 22 out of the other 37 jennies had positive scores, also. The animals showed titers ranging from 40 to 320. Furthermore, 2 subjects that were submitted for 2 and 3 blood samplings, both had more than one positive score. Moreover, 2 seropositive animals were positive for Leishmania DNA. Donkeys are considered to be a preferred source for a sandfly blood meal, even if clinical leishmaniosis has never been reported in Europe for this animal species. In the view of these facts, our preliminary findings would suggest the role of donkey as a potential reservoir for this protozoan agent. Additional studies would be welcome to elucidate the role of the donkey in Leishmania epidemiology of CanL endemic areas and to confirm the preliminary findings and the hypothesis proposed here.

scholarly journals Occurrences of anti-Toxoplasma gondiiand anti-Neospora caninum antibodies in Barbary sheep at Curitiba zoo, southern Brazil

2014 ◽  
Vol 23 (2) ◽  
pp. 255-259 ◽  
Author(s):  
Vivien Midori Morikawa ◽  
Cristina Kraemer Zimpel ◽  
Igor Adolfo Dexheimer Paploski ◽  
Maria do Carmo Custódio de Souza Hunold Lara ◽  
Eliana Monteforte Cassaro Villalobos ◽  
...  
Keyword(s):  
Toxoplasma Gondii ◽  
Neospora Caninum ◽  
Antibody Test ◽  
Southern Brazil ◽  
Intermediate Hosts ◽  
Blood Samples ◽  
Ammotragus Lervia ◽  
Barbary Sheep ◽  
Immunofluorescence Antibody Test ◽  
Immunofluorescence Antibody

Barbary sheep (Ammotragus lervia) have the potential to act as hosts of important infectious diseases, particularly zoonoses. Blood samples from 17 Barbary sheep at the Curitiba zoo were collected to evaluate occurrences of anti-Toxoplasma gondii and anti-Neospora caninum antibodies, tested using the indirect immunofluorescence antibody test (IFAT). Anti-T. gondii and anti-N. caninum antibodies were detected in 4/17 (23.5%) and 4/17 (23.5%) samples, respectively. The present study has shown that Barbary sheep at Curitiba zoo were exposed to T. gondii andN. caninum and therefore may act as intermediate hosts, spreading toxoplasmosis and neosporosis within and between species in shared areas.

scholarly journals Toward Diagnosing Leishmania infantum Infection in Asymptomatic Dogs in an Area Where Leishmaniasis Is Endemic

2009 ◽  
Vol 16 (3) ◽  
pp. 337-343 ◽  
Author(s):  
D. Otranto ◽  
P. Paradies ◽  
D. de Caprariis ◽  
D. Stanneck ◽  
G. Testini ◽  
...  
Keyword(s):  
Leishmania Infantum ◽  
Clinical Signs ◽  
Antibody Test ◽  
Diagnostic Methods ◽  
Canine Leishmaniasis ◽  
Enzyme Linked Immunosorbent Assay ◽  
Canine Monocytic Ehrlichiosis ◽  
Immunofluorescence Antibody Test ◽  
Immunofluorescence Antibody

ABSTRACT The most frequently used diagnostic methods were compared in a longitudinal survey with Leishmania infantum-infected asymptomatic dogs from an area of Italy where leishmaniasis is endemic. In February and March 2005, 845 asymptomatic dogs were tested by an immunofluorescence antibody test (IFAT), a dipstick assay (DS), and an enzyme-linked immunosorbent assay (ELISA) for L. infantum and by IFAT for Ehrlichia canis. Dogs seronegative for L. infantum were further parasitologically evaluated by microscopic examination of lymph node tissues and PCR of skin samples. A total of 204 animals both serologically and parasitologically negative for L. infantum at the first sampling were enrolled in the trial and were further examined for canine leishmaniasis (CanL) and canine monocytic ehrlichiosis in November 2005 (i.e., the end of the first sandfly season) and March 2006 and 2007 (1- and 2-year follow-ups, respectively). At the initial screening, the overall rates of L. infantum seroprevalence were 9.5% by IFAT, 17.1% by ELISA, and 9.8% by DS and the overall rate of E. canis seroprevalence was 15%. The rates of concordance between the results of IFAT and DS were almost equal, whereas the rate of concordance between the results of IFAT and DS and those of the ELISA was lower. The results of the annual incidence of Leishmania infection were variable, depending on the test employed, with the highest values registered for PCR (i.e., 5.7% and 11.4% at the 1- and 2-year follow-ups, respectively), followed by ELISA, IFAT, and DS. Over the 2 years of observation, 55 animals (i.e., 26.9%) became positive for L. infantum by one or more diagnostic tests at different follow-up times, with 12.7% showing clinical signs related to CanL, while the remaining 87.3% were asymptomatic. A diagnostic scheme for assessment of the L. infantum infection status in asymptomatic dogs is suggested.

scholarly journals Application of different techniques to detect Toxoplasma gondii in slaughtered sheep for human consumption

2015 ◽  
Vol 24 (4) ◽  
pp. 416-421 ◽  
Author(s):  
Annelise Castanha Barreto Tenório Nunes ◽  
Edna Maria Vieira da Silva ◽  
José Aelson de Oliveira ◽  
Elise Myuki Yamasaki ◽  
Pomy de Cássia Peixoto Kim ◽  
...  
Keyword(s):  
Toxoplasma Gondii ◽  
Antibody Test ◽  
Human Consumption ◽  
Cerebral Tissue ◽  
Serum Samples ◽  
Kappa Test ◽  
Polymerase Chain ◽  
Immunofluorescence Antibody Test ◽  
Perivascular Cuff ◽  
Immunofluorescence Antibody

Abstract The aim of this study was to investigate occurrence of Toxoplasma gondii in sheep slaughtered in the state of Alagoas, Brazil, by means of different diagnosis techniques. Serum samples and tissues from 100 slaughtered sheep were used. To detect antibodies, the indirect immunofluorescence antibody test (IFAT) was used, and tissues from seropositive animals (cut-off ≥1:64) were submitted to Polymerase Chain Reaction (PCR) and immunohistochemistry (IHC). To assess the concordance between the direct techniques, the kappa test was used. In the IFAT, it was observed that 14% (14/100) of the ovine samples were serum-positive. In the PCR, 21.43% (3/14) of the animals were positive and in IHC, it was observed that 7.14% (1/14) were positively stained for T. gondii in cerebral tissue. Histopathologically, the predominant finding was the presence of mononuclear cell infiltrate in the heart and a perivascular cuff in the cerebrum and cerebellum. The concordance between the direct diagnosis techniques was moderate (k=0.44). Thus, it is important to use different direct techniques in diagnosing toxoplasmosis in naturally infected sheep.

scholarly journals Toxoplasma gondii, Neospora caninum and Leishmania spp. serology and Leishmania spp. PCR in dogs from Pirassununga, SP

2015 ◽  
Vol 24 (4) ◽  
pp. 454-458 ◽  
Author(s):  
Nathália Mendonça de Seabra ◽  
Vanessa Figueredo Pereira ◽  
Marcos Vinícius Kuwassaki ◽  
Julia Cristina Benassi ◽  
Trícia Maria Ferreira de Sousa Oliveira
Keyword(s):  
Toxoplasma Gondii ◽  
Neospora Caninum ◽  
Antibody Test ◽  
Seropositivity Rate ◽  
Three Samples ◽  
Leishmania Spp ◽  
Polymerase Chain ◽  
The City ◽  
Immunofluorescence Antibody Test ◽  
Immunofluorescence Antibody

Abstract We examined the presence of antibodies against the parasites Toxoplasma gondii, Neospora caninum, and Leishmania spp., as well the presence of DNA from Leishmania spp., in dogs from Pirassununga - SP. The seropositivity rate was compared with the animals’ originating location. Three hundred seventy-three blood samples from the county’s kennel and local veterinary clinics were collected and analyzed. A total of 300 samples were tested for T. gondii and N. caninum using an indirect immunofluorescence antibody test (IFAT); 45% (135/300) were positive for T. gondii and 24.3% (73/300) were positive for N. caninum. Three hundred seventy-three samples were tested for Leishmania spp. using the IFAT. Of these, 4.6% (17/373) were positive. Additionally, 145 samples were tested using a polymerase chain reaction (PCR); of these samples, 0.7% (1/145) was positive. Considering the results, we conclude that these parasites are present in the city of Pirassununga - SP and that the animals have contact with the protozoan. It is therefore necessary to create methods for disease prevention to maintain both animal and human health in regard to leishmaniasis and toxoplasmosis.

Sign in / Sign up

Export Citation Format

Share Document