scholarly journals Detección del virus de la leprosis de los cítricos tipo citoplasmático en los Llanos Orientales de Colombia

2007 ◽  
Vol 7 (2) ◽  
pp. 67 ◽  
Author(s):  
Guillermo León ◽  
Juliana Freitas-Astúa ◽  
Elliot W. Kitajima ◽  
Nora Cristina Meza
Keyword(s):  
Nucleotide Sequence Identity ◽  
Sweet Orange ◽  
Rt Pcr ◽  
Principal Vector ◽  
Virus Identification ◽  
Sequence Identity ◽  
Transmission Electron ◽  
Brevipalpus Phoenicis ◽  
Citrus Leprosis ◽  
Cdna Fragments

<p>Durante los años 2004 y 2005 se observaron síntomas de la leprosis de los cítricos en los departamentos de Meta y Casanare. Para confirmar la causa de esta sintomatología, se colectaron hojas de naranja ‘Valencia’ con lesiones típicas en municipios de Casanare (Yopal y Aguazul) y Meta (Guamal, Villavicencio y Cumaral). Las muestras fueron procesadas identificar el virus por medio de microscopía electrónica de transmisión (MET) y transcripción reversa - reacción en cadena de la polimerasa (RT-PCR). Diez de las 21 muestras analizadas por MET resultaron positivas para el virus de la leprosis (<em>Citrus Leprosis Virus</em>, CiLV-C). En algunas muestras se observaron partículas baciliformes características del CiLV-C en el retículo endoplasmático y formas irregularles de viroplasmas en el citoplasma. Catorce de las 32 muestras procesadas por RT-PCR resultaron positivas al CiLV-C. Los análisis RT-PCR amplificaron fragmentos de cADN del tamaño esperado para las muestras colectadas en el Meta. Una de las ampliaciones fue secuenciada (GenBank accessión No. DQ272491) y la secuencia obtenida guarda identidad del 98% con la secuencia brasilera aislada de nucleótidos para CiLV-C (GenBank accessión No. AY289190.1). La secuencia obtenida y los <em>primers </em>fueron entregados al Instituto Colombiano Agropecuario —ICA— para el diagnóstico del virus CiLV-C en Colombia. Entre los ácaros recolectados en las plantas afectadas se identificó a <em>Brevipalpus phoenicis </em>(Geijskes) reconocido como principal vector de CiLV-C.</p><p> </p><p><strong>Detection of the Cytoplasmic Citrus Leprosis Virus in the easter plains of Colombia</strong></p><p>Symptoms of citrus leprosis were observed during 2004 - 2005 in the East plains of Colombia, Departments of Meta and Casanare. To identify the causal agent, CORPOICA collected leaves of Valencia sweet orange exhibiting typical lesions of leprosis from several locations in the Departments of Casanare (Yopal, Aguazul) and Meta (Guamal, Villavicencio and Cumaral). Virus identification was done by RT-PCR and transmission electron microscopy (TEM). Ten of the 21 samples examined by TEM resulted positive to the leprosis virus (Citrus Leprosis Virus, CiLV-C). Short bacilliform particles characteristic of CiLV-C were found in the endoplasmic reticulum, and irregularly shaped viroplasms were present in the cytoplasm. Fourteen of the 32 samples processed by RT-PCR were positive to CiLV-C. RT-PCR analyses amplified cDNA fragments of expected size for samples collected in Meta. One of the amplifications was sequenced (GenBank accession No. DQ272491) and found to have 98% nucleotide sequence identity to the Brazilian CiLV-C isolate (GenBank accession No. AY289190.1). Sequence and primers were provided to ICA for CiLV-C diagnosis in Colombia. Mites collected from affected plants were identified as Brevipalpus phoenicis (Geijskes), one of the most important vectors of CiLV-C.</p>

Parámetros de transmisión del virus de la leprosis de los cítricos por Brevipalpus yothersi (Acari: Tenuipalpidae)

2017 ◽  
Vol 43 (2) ◽  
pp. 215 ◽  
Author(s):  
Guillermo Leon M. ◽  
Avijit Roy ◽  
Nandlal Choudhary ◽  
Ronald Brlansky
Keyword(s):  
Citrus Sinensis ◽  
Virus Vector ◽  
Rt Pcr ◽  
Principal Vector ◽  
Brevipalpus Phoenicis ◽  
Citrus Leprosis

La leprosis de los cítricos, causada por virus (Citrus Leprosis Virus, CiLV), es un problema fitosanitario de importancia económica y cuarentenaria para la citricultura de países productores. En Colombia su presencia fue confirmada en 2004 en los departamentos del Meta y Casanare; el ácaro Brevipalpus yothersi Baker (antes identificado como Brevipalpus phoenicis Geijskes) (Acari: Tenuipalpidae), se reconoce como el principal vector del virus en el país. Se determinaron los parámetros: período de acceso para adquisición, período de acceso para inoculación y porcentaje de ácaros infectados con CiLV, por medio de pruebas de transmisión y análisis moleculares en el Centro de Investigación “La Libertad” de CORPOICA, Meta, Colombia. Al probar períodos de adquisición entre 10 minutos y 72 horas, se encontró que B. yothersi adquiere el virus después de 30 minutos de alimentación sobre hojas de naranja Valencia (Citrus sinensis L.) Osbeck con lesiones de leprosis. El período mínimo requerido por los ácaros para transmitir el virus hacia plantas de C. sinensis fue de 10 minutos. Para períodos de transmisión desde 10 minutos hasta 24 horas, los porcentajes de infección variaron entre 25 y 68,75 % en las hojas receptoras. De acuerdo a pruebas de transmisión y análisis RT-PCR, después de tres días de alimentación sobre lesiones de leprosis, el 40 % de las poblaciones del ácaro evaluadas adquirió el virus CiLV-C2. Los resultados obtenidos amplían el conocimiento de las interacciones planta - virus - vector, lo cual es fundamental para el establecimiento de programas de prevención y manejo de la enfermedad.

scholarly journals First Report of Citrus leprosis virus on Citrus in Santa Cruz, Bolivia

Plant Disease ◽  
2005 ◽  
Vol 89 (6) ◽  
pp. 686-686 ◽  
Author(s):  
E. C. Gómez ◽  
M. R. Vargas ◽  
C. Rivadameira ◽  
E. C. Locali ◽  
J. Freitas-Astua ◽  
...  
Keyword(s):  
Electron Microscopy ◽  
Transmission Electron Microscopy ◽  
Sweet Orange ◽  
Consensus Sequence ◽  
Santa Cruz ◽  
Rt Pcr ◽  
Brazilian Isolate ◽  
Amino Acid Homology ◽  
Transmission Electron ◽  
Citrus Leprosis

The citrus crop is rapidly expanding in the Province of Santa Cruz de la Sierra, Bolívia. Citrus, mostly planted by small growers, currently comprises approximately 15,000 ha. Sweet oranges (Citrus sinensis) and mandarins (C. reticulate) are the main citrus-types grown primarily for internal consumption. Recently, there has been an increase in incidence of leprosis-like symptoms (round to elliptic lesions on the leaves, chlorotic to necrotic lesions in young twigs, and depressed small lesions on the fruits). These symptoms were associated with infestations by the tenuipalpid mite Brevipalpus sp. To verify if Citrus leprosis virus was the causal agent of the observed symptoms, leaf and fruit samples (mostly from Valencia sweet orange) were collected from commercial groves in El Torno, 32 km south of Santa Cruz, and Yapacani and Colónia San Juan, 130 km northwest of Santa Cruz. Small fragments of these samples were placed immediately in a mixture of glutaraldehyde and paraformaldehyde in cacodylate buffer and later processed with transmission electron microscopy at ESALQ, Piracicaba, SP, Brazil. Some of the leaf samples were dried at 35°C and used for reverse transcription-polymerase chain reaction (RT-PCR) with primers that specifically amplify portions of the genome of Citrus leprosis virus, cytoplasmic type (CiLV-C) (1) at Centro APTA Citros, Cordeirópolis, SP, Brazil. Brevipalpus sp. mites were also collected and kept in 90% ethanol for further identification at the University of Florida, Gainesville and ESALQ. In the samples from the three surveyed areas, transmission electron microscopy confirmed the presence of short bacilliform particles within endoplasmic reticulum cisternae and electron dense viroplasms in the cytoplasm, typical of infection by CiLV-C (2). CiLV-C specific primers amplified DNA fragments of expected sizes in RT-PCR from dried leaf samples that came from these three localities. Direct sequencing of at least three amplicons of each sample confirmed the identity of the virus. The consensus sequence of the putative movement protein gene in samples from Yapacani and Colónia San Juan (GenBank Accessions Nos. AY960216 and AY960215, respectively) were identical and exhibited 99% nucleotide and 98% amino acid homology with the Brazilian isolate sequence available at GenBank (Accession No. AY289190). The consensus sequence of the putative replicase gene found in the sample from El Torno (GenBank Accession No. AY960214) exhibited 96 and 93% nucleotide and amino acid homology, respectively with the Brazilian isolate (GenBank Accession No. AY289191). Sampled mites were identified as B. phoenicis (Geijskes), the known vector of CiLV-C (2). The symptomatology, particle morphology and cytopathology, detection by molecular methods and the association with infestation by B. phoenicis, together indicate that the foliar, stem, and fruit lesions in sweet orange observed in the Santa Cruz region were caused by CiLV-C. To our knowledge, this is the first report of this virus in Bolivia. References: (1) E. C. Locali et al. Plant Dis. 87:1317, 2003. (2) J. C. V. Rodrigues et al. Exp. Appl. Acarol. 30:161, 2003.

scholarly journals First Report of Cucurbit aphid-borne yellows virus in Spain

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
M. Juarez ◽  
V. Truniger ◽  
M. A. Aranda
Keyword(s):  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
E Coli ◽  
Sequence Identity ◽  
Tissue Print ◽  
Sigma Chemical ◽  
Beet Pseudo Yellows Virus ◽  
Cucumis Melo L

In late spring 2003, field-grown melon plants (Cucumis melo L.) showing bright yellowing of older leaves were observed near Valladolises in Campo de Cartagena, Murcia, Spain. Symptoms resembled those caused by viruses of the genus Crinivirus (family Closteroviridae), but absence or very low populations of whiteflies were observed. However, diseased foci showed clear indications of heavy aphid infestations. Later, during the fall of 2003, squash plants (Cucurbita pepo L.) grown in open fields in the same area showed similar symptoms. Tissue print hybridizations to detect Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo yellows virus (BPYV) in symptomatic samples were negative. CYSDV and BPYV are two yellowing-inducing criniviruses previously described in Spain. In contrast, standard double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with antiserum against Cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, family Luteoviridae) that was kindly provided by H. Lecoq (INRA-Montfavet Cedex, France) were consistently positive. Definitive confirmation of CABYV associated with symptomatic samples was obtained by performing reverse-transcription polymerase chain reaction (RT-PCR) analyses for the CABYV coat protein gene. Total RNA extracts (TRI reagent; Sigma Chemical, St. Louis, MO) were obtained from symptomatic and asymptomatic leaf samples and RT-PCR reactions were carried out using the primers 5′-GAATACGGTCGCGGCTAGAAATC-3′ (CE9) and 5′-CTATTTCGGGTTCTGGACCTGGC-3′ (CE10) based on the CABYV sequence published by Guilley et al. (2). A single DNA product of approximately 600 bp was obtained only from symptomatic samples. Amplified DNA fragments from two independent samples (samples 36-2 and 37-5) were cloned in E. coli and sequenced (GenBank Accession Nos. AY529653 and AY529654). Sequence comparisons showed a 95% nucleotide sequence identity between the two sequences. A 97% and 94% nucleotide sequence identity was found among 36-2 and 37-5, respectively and the CABYV sequence published by Guilley et al. (2). CABYV seems to be widespread throughout the Mediterranean Basin (1,3) but to our knowledge, it has not previously been described in Spain. Additionally, our data suggest that significant genetic variability might be present in the Spanish CABYV populations. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) H. Guilley et al. Virology 202:1012, 1994. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992.

scholarly journals Transmission of Citrus leprosis virus C by Brevipalpus phoenicis (Geijskes) to Alternative Host Plants Found in Citrus Orchards

Plant Disease ◽  
2012 ◽  
Vol 96 (7) ◽  
pp. 968-972 ◽  
Author(s):  
M. A. Nunes ◽  
C. A. L. de Oliveira ◽  
M. L. de Oliveira ◽  
E. W. Kitajima ◽  
M. E. Hilf ◽  
...  
Keyword(s):  
Host Plants ◽  
Sweet Orange ◽  
Hibiscus Rosa Sinensis ◽  
Brevipalpus Phoenicis ◽  
Orange Fruit ◽  
Necrotic Spots ◽  
Citrus Orchards ◽  
Citrus Leprosis ◽  
Polymerase Chain ◽  
Virus C

The equivalent of US$75 million is spent each year in Brazil to control Brevipalpus phoenicis, a mite vector of Citrus leprosis virus C (CiLV-C). In this study, we investigated the possibility that hedgerows and windbreaks normally found in citrus orchards could host CiLV-C. Mites confined by an adhesive barrier were reared on sweet orange fruit with leprosis symptoms then were transferred to leaves of Hibiscus rosa-sinensis, Malvaviscus arboreus, Grevilea robusta, Bixa orellana, and Citrus sinensis. Ninety days post infestation, the descendant mites were transferred to Pera sweet orange plants to verify the transmissibility of the virus back to citrus. Nonviruliferous mites which had no feeding access to diseased tissue were used as controls. Local chlorotic or necrotic spots and ringspots, symptoms of leprosis disease, appeared in most plants tested. Results generated by reversetranscription polymerase chain reaction with primers specific for CiLV-C and by electron microscope analyses confirmed the susceptibility of these plants to CiLV-C.

scholarly journals Detection of Sweet potato virus 2 in Sweet Potato in New Zealand

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 427-427 ◽  
Author(s):  
Z. Perez-Egusquiza ◽  
L. I. Ward ◽  
G. R. G. Clover ◽  
J. D. Fletcher
Keyword(s):  
New Zealand ◽  
Nucleotide Sequence ◽  
Real Time ◽  
Sweet Potato ◽  
Potato Virus ◽  
Nucleotide Sequence Identity ◽  
Rt Pcr ◽  
Sequence Identity ◽  
Sweet Potato Virus ◽  
Composite Samples

In New Zealand, sweet potato (Ipomoea batatas) is a crop of cultural importance and an important food source; it is grown mainly in the districts of Kaipara, Auckland, and the Bay of Plenty in the North Island. In January of 2008, virus symptoms that included chlorotic spots, ring spots, and mottling were observed on the leaves of commercial sweet potato crops (cvs. Beauregard, Owairaka Red, and Toka Toka Gold) growing in the three main production areas. A survey was done to determine the extent of virus infection in these crops. Fifty to one hundred leaves were collected randomly from each of 26 different fields. Leaves from each field were bulked into groups of 10, giving a total of 173 composite samples. All samples tested negative for Cucumber mosaic virus, C-6 virus, Sweet potato caulimo-like virus, Sweet potato chlorotic fleck virus, Sweet potato chlorotic stunt virus (SPCSV), Sweet potato latent virus, and Sweet potato mild specking virus by nitrocellulose membrane enzyme-linked immunosorbent assays (International Potato Center-CIP, Lima, Peru). Total nucleic acid was extracted from all 173 composite samples and used in real-time PCR assays specific for Sweet potato leaf curl virus (SPLCV) and real-time reverse transcription (RT)-PCR specific for SPCSV, Sweet potato feathery mottle virus (SPFMV), Sweet potato virus G (SPVG), and Sweet potato virus 2 (SPV2; synonym Sweet potato virus Y) (1). No samples were positive for SPLCV or SPCSV, but 107 and 138 samples tested positive for SPFMV and SPVG, respectively. SPFMV and SPVG have been reported previously in New Zealand (2,3). Sixty four samples from 16 different fields tested positive for SPV2. Of the 64 samples, 52 were also infected with SPVG and SPFMV, and 10 were co-infected with SPVG but not SPFMV; no samples were co-infected with SPV2 and SPFMV when SPVG was absent. From a representative SPV2 positive sample, the 70-bp amplicon obtained by the real-time RT-PCR primers was cloned and sequenced A BLAST search showed 100% nucleotide sequence identity with SPV2 (GenBank Accession Nos. AM050887 and AY178992). Subsequently, primers (V2-F1c: 5′-AGAACAGGACAAACTCAACC-3′; V2-R1: 5′-TAATCACCCTTCACACCTTC-3′) were designed to amplify an approximately 434-bp fragment within the SPV2 coat protein gene. One-step RT-PCR was done on four of the SPV2 positive samples and amplicons of the expected size were sequenced directly (GenBank Accession No. FJ461774). Sequence comparison showed 99% nucleotide sequence identity with SPV2 (GenBank Accession Nos. AM050886, AM050887, AY178992, and EF577437). SPV2 is a member of the genus Potyvirus but the virus has not been fully characterized. It is known that single-potyvirus infections cause mild or no symptoms in sweet potato, and consequently, no significant yield reduction is observed generally. However, co-infection with other viruses such as SPCSV produces a synergistic effect and more severe disease symptoms (4). To our knowledge, this is the first report of SPV2 infecting sweet potato in New Zealand. References: (1) C. D. Kokinos and C. A. Clark. Plant Dis. 90:783, 2006. (2) M. N. Pearson et al. Australas. Plant Pathol. 35:217, 2006. (3) M. Rännäli et al. Plant Dis. 92:1313, 2008. (4) M. Untiveros et al. Plant Dis. 91:669, 2007.

scholarly journals Transmissibility of Citrus leprosis virus by Brevipalpus phoenicis to Solanum violaefolium

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 911-911 ◽  
Author(s):  
J. C. V. Rodrigues ◽  
E. C. Locali ◽  
J. Freitas-Astua ◽  
E. W. Kitajima
Keyword(s):  
Host Plant ◽  
Plant Species ◽  
Virus Particles ◽  
Transmission Electron ◽  
Brevipalpus Phoenicis ◽  
Cross Transmission ◽  
Citrus Orchards ◽  
Citrus Leprosis ◽  
Citrus Leaves ◽  
Viral Components

Citrus leprosis virus (CiLV) constitutes one of the most important viruses in citrus in the areas where it occurs. Two morphological types of virus particles have been described from associated leprosis symptoms, nuclear (CiLV-N) and cytoplasmic (CiLV-C) (4). The CiLV-C is more common, representing more than 99% of samples collected from South and Central America (E. W. Kitajima and J. C. V. Rodrigues, unpublished). Both virus types are associated with the mite vector, Brevipalpus phoenicis (Geijskes) (Acari: Tenuipalpidae). So far, CiLV-C has only been naturally transmitted by these mites to citrus (3). Plants of Solanum violaefolium Schott (Solanaceae) and ornamental and sweet orange seedlings were infested with viruliferous adult female mites, colony no. 61 (GenBank Accession No. AY320027) that were previously maintained on citrus seedlings infected with CiLV-C according to Rodrigues et al. (3). Fifteen days after the mites were transferred, spotted yellowish symptoms were observed on leaves of plants of S. violaefolium and similar symptoms were observed after 25 days on citrus leaves. The symptomatic tissues were studied using transmission electron microscopy. Particles typical of CiLV-C were observed in samples from both plant species. To our knowledge, this is the first reported case of mites transmitting CiLV-C to a noncitrus host. Subsequent experiments showed that mites were able to transmit the virus between plants of S. violaefolium. Attempts to transmit the virus by mites from S. violaefolium to citrus were unsuccessful. The dsRNA viral electrophoresis profile showed differences between the two host plants. Reverse transcription-polymerase chain reaction (RT-PCR) and sequencing assays with primers designed to detect CiLV-C (2) amplified DNA fragments of the expected size and base composition. These data suggest the loss or alteration of some viral components from the Solanum sp. host that might be essential for the transmission or infection in citrus. Such a mechanism may explain why, despite the ever-increasing number of Brevipalpus-transmitted viruses in a large number of different host plant species (1), cross transmission is not common. This information shows one of the potential routes for CiLV to invade citrus orchards, and suggests one alternative host plant that allows rapid multiplication of the virus for characterization. References: (1) E. W. Kitajima et al. Exp. Appl. Acarol. 30:135, 2003. (2) E. C. Locali et al. Plant Dis. 87:1317, 2003. (3) J. C. V. Rodrigues et al. Proc. Int. Org. Citrus Virol. 174, 2000 (4) J. C. V. Rodrigues et al. Exp. Appl. Acarol. 30:161, 2003.

scholarly journals First Report of Impatiens necrotic spot virus (INSV) Infecting Basil (Ocimum basilicum) in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 850-850 ◽  
Author(s):  
S. Poojari ◽  
R. A. Naidu
Keyword(s):  
United States ◽  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
The United States ◽  
Ocimum Basilicum ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Sequence Identity

Basil (Ocimum basilicum L.), a native of India belonging to the Lamiaceae family, is an aromatic herb with distinctive aroma, and several commercial varieties are used extensively for culinary and ornamental purposes. During the summer of 2011 and 2012, potted plants of basil in a commercial greenhouse in the Richland-Kennewick area of Washington State were observed showing foliar symptoms consisting of chlorotic spots, ring spots, leaf distortion, and stem necrosis. In initial tests, extracts of symptomatic leaves were positive for Impatiens necrotic spot virus (INSV; genus Tospovirus, family Bunyaviridae), when tested with INSV immnunostrips (Agdia, Inc., Elkhart, IN). These samples were negative with immunostrips specific to Tomato spotted wilt virus (genus Tospovirus) and group-specific potyviruses. The virus from symptomatic leaves of basil was transmitted by leaf rub inoculation to Nicotiana benthamiana and Emilia sonchifolia, where it produced necrosis on inoculated leaves followed by systemic necrosis in the former and chlorotic spots and mosaic mottling in newly developed leaves in the latter. Symptomatic leaves from both host plants tested positive with INSV, but not with TSWV, immunostrips. For additional confirmation of INSV, total RNA was extracted from symptomatic leaves of basil using RNeasy Plant Minikit (Qiagen, Inc., Valencia, CA) and used for reverse transcription (RT)-PCR amplification of the nucleocapsid (N) gene using forward (5′-AGCTTAAATCAATAGTAGCA-3′) and reverse (5′-AGCTTCCTCAAGAATAGGCA-3′) primers. RT was carried out at 52°C for 60 min followed by denaturation at 94°C for 3 min. Subsequently, 35 cycles of PCR was carried out with each cycle consisting of 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The amplicons of about 610 nt obtained from RT-PCR were cloned into pTOPO2.1 vector (Invitrogen Corporation, Carlsbad, CA) and three independent clones were sequenced in both directions. Sequence analyses of these clones (GenBank Accession No. KC218475) showed 100% nucleotide sequence identity among themselves and 99% nucleotide sequence identity with INSV isolates from the United States (DQ523598, JX138531, and D00914) and a basil isolate (JQ724132) from Austria. These results further confirm the presence of INSV in symptomatic leaves of basil. Previously, basil has been reported to be naturally infected with TSWV in the United States (3) and INSV in Austria (2). Therefore, this study represents the first confirmed report of the virus in basil in the United States. No species of thrips vector was observed on the affected basil plants. The discovery of INSV in basil has important implications for the nursery industry due to the broad host range of the virus (1); stock plants may serve as a source of inoculum in production areas and infected plants could be distributed to homeowners. It is important for commercial nurseries to monitor for INSV to identify infected mother plants to prevent virus spread. Since more than 31 viruses belonging to 13 different genera have been reported in basil ( http://pvo.bio-mirror.cn/famly073.htm#Ocimumbasilicum ), further studies are in progress to determine if the observed symptoms on basil are only due to single infection of INSV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2). S. Grausgruber-Gröger. New Dis. Rep. 26:12, 2012. (3) G. E. Holcomb et al. Plant Dis. 83:966.

scholarly journals First Report of Citrus leprosis virus Nuclear Type in Sweet Orange in Colombia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1162-1162 ◽  
Author(s):  
Avijit Roy ◽  
M. G. León ◽  
A. L. Stone ◽  
J. S. Hartung ◽  
R. H. Brlansky
Keyword(s):  
Mixed Infection ◽  
Protein Gene ◽  
Sweet Orange ◽  
N Gene ◽  
Rt Pcr ◽  
M Gene ◽  
Total Rna ◽  
First Report ◽  
Citrus Leprosis ◽  
Cytoplasmic Type

Colombia is ranked 18th in the world in citrus production and contributed 0.9% of the total world share. Among four important citrus-producing regions of Colombia, the Orinoco region (3 to 6°N, 68 to 74°W) consists of two citrus-producing states, Meta and Casanare. Citrus leprosis is the most important viral disease of citrus in Colombia (1,3). Three types of Citrus leprosis virus (CiLV) infect citrus, producing leprosis-like lesion symptoms. Two of the three CiLV species, Citrus leprosis virus cytoplasmic type (CiLV-C) and cytoplasmic type 2 (CiLV-C2), produce particles only in the cytoplasm (3). The other species, Citrus leprosis virus nuclear type (CiLV-N), produces particles in both the cytoplasm and nucleus (4). CiLV-C is more prevalent and destructive while CiLV-N has been reported only in Brazil, Panama, and Mexico (4). Interestingly, both CiLV-C and -C2 were reported from the same regions of Meta and Casanare States in Colombia in 2004 and 2012 (1,3). CiLV-C lesions are usually rounded (initially 2 to 3 mm in diameter and extending up to 30 mm), have dark-brown or greenish central chlorotic spots, and are surrounded by yellow halos. CiLV-N lesions have been described as smaller in size and form three well-defined regions including a necrotic center with an intermediate orange color halo and an outer chlorotic halo (2). In 2013, ‘Valencia’ sweet orange (Citrus sinensis L.) leaves with suspected CiLV-N symptoms were collected from 8 plants in Casanare State and shipped under permit to the USDA-APHIS-PPQ-CPHST, Beltsville, MD. Total RNA from symptomatic and healthy sweet orange leaves were extracted using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR primers specific to CiLV-C, CiLV-C2 (3), and CiLV-N nucleocapsid (N) (CiLV-N-NPF: 5′-ATGGCTAACCCAAGTGAGATCGATTA-3′; CiLV-N-NPR: 5′-AGTTGCCTTGAGATCATCACATTGGT-3′) and putative matrix protein (M) genes (CiLV-N-MF: 5′-ATGTCTAAACAGATTAATATGTGCACTGTG-3′; CiLV-N-MR: 5′-CTAACCACTGGGTCCCGC-3′) were utilized to identify the CiLV associated with the leprosis-affected leaf samples from Casanare. RT-PCR with CiLV-C primers failed to produce any amplicon, but CiLV-N primers successfully amplified the partial N gene (681 bp) and entire M gene (552 nt) amplicons from multiple leaves of all leprosis samples. In addition, a 795-bp amplicon specific to CiLV-C2 also was amplified from the CiLV-N suspected samples. Similar results were obtained when the vector, flat spider mite (Brevipalpus spp.) total RNA was used as template for RT-PCR. For further confirmation, each amplicon was cloned and sequenced. Sequencing of the N and M gene amplicons of CiLV-N (accession nos. KJ195893 and KJ195894) and coat protein gene of CiLV-C2 showed 97 to 99% nucleotide sequence identity with the CiLV-N M2345 isolate sequence (KF209275) from Mexico (4) and CiLV-C2 L147V1 isolate sequence (JX000024) from Colombia (3), respectively. Phylogenetic analyses of these N and M protein gene sequences confirmed a mixed infection of the same plant with two viruses, one from an unassigned new genus Dichorhavirus (CiLV-N) and another from genus Cilevirus (CiLV-C2). This is the first report of CiLV-N in Colombia, and also the first report of an occurrence of CiLV-N in mixed infection with CiLV-C2. All three known species of CiLV occur in the Orinoco region of Colombia. References: (1) M. G. León et al. Plant Dis. 90: 682, 2006. (2) J. P. R. Marques et al. Anais da Academia Brasileira de Ciências 82:501, 2010. (3) A. Roy et al. Phytopathology 103:488, 2013. (4) A. Roy et al. Genome Announc. 1(4): e00519-13, 2013.

scholarly journals First Report of Pepino mosaic virus Infecting Tomato in Mexico

Plant Disease ◽  
2011 ◽  
Vol 95 (8) ◽  
pp. 1035-1035 ◽  
Author(s):  
K.-S. Ling ◽  
W. Zhang
Keyword(s):  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Nucleotide Sequence Identity ◽  
The United States ◽  
Rt Pcr ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Product ◽  
Greenhouse Tomatoes

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

scholarly journals Citrus leprosis virus N: A New Dichorhavirus Causing Citrus Leprosis Disease

2017 ◽  
Vol 107 (8) ◽  
pp. 963-976 ◽  
Author(s):  
Pedro Luis Ramos-González ◽  
Camila Chabi-Jesus ◽  
Orlene Guerra-Peraza ◽  
Aline Daniele Tassi ◽  
Elliot Watanabe Kitajima ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
Viral Disease ◽  
Sensu Stricto ◽  
Amino Acid Sequences ◽  
Western Hemisphere ◽  
Open Reading Frames ◽  
Yield Reduction ◽  
Sequence Identity ◽  
Citrus Leprosis

Citrus leprosis (CL) is a viral disease endemic to the Western Hemisphere that produces local necrotic and chlorotic lesions on leaves, branches, and fruit and causes serious yield reduction in citrus orchards. Samples of sweet orange (Citrus × sinensis) trees showing CL symptoms were collected during a survey in noncommercial citrus areas in the southeast region of Brazil in 2013 to 2016. Transmission electron microscopy analyses of foliar lesions confirmed the presence of rod-like viral particles commonly associated with CL in the nucleus and cytoplasm of infected cells. However, every attempt to identify these particles by reverse-transcription polymerase chain reaction tests failed, even though all described primers for the detection of known CL-causing cileviruses and dichorhaviruses were used. Next-generation sequencing of total RNA extracts from three symptomatic samples revealed the genome of distinct, although highly related (>92% nucleotide sequence identity), viruses whose genetic organization is similar to that of dichorhaviruses. The genome sequence of these viruses showed <62% nucleotide sequence identity with those of orchid fleck virus and coffee ringspot virus. Globally, the deduced amino acid sequences of the open reading frames they encode share 32.7 to 63.8% identity with the proteins of the dichorhavirids. Mites collected from both the naturally infected citrus trees and those used for the transmission of one of the characterized isolates to Arabidopsis plants were anatomically recognized as Brevipalpus phoenicis sensu stricto. Molecular and biological features indicate that the identified viruses belong to a new species of CL-associated dichorhavirus, which we propose to call Citrus leprosis N dichorhavirus. Our results, while emphasizing the increasing diversity of viruses causing CL disease, lead to a reevaluation of the nomenclature of those viruses assigned to the genus Dichorhavirus. In this regard, a comprehensive discussion is presented.

Sign in / Sign up

Export Citation Format

Share Document