scholarly journals Morphological and molecular characters of Cherax quadricarinatus (von Martens, 1868) from Sermo Reservoir and Tambakboyo Retention Basin, Daerah Istimewa Yogyakarta, Indonesia

2021 ◽  
Vol 9 (1) ◽  
pp. 18
Author(s):  
Rury Eprilurahman ◽  
Aplina Krismutia Simarmata ◽  
Lukman Hakim ◽  
Trijoko Trijoko
Keyword(s):  
Genetic Information ◽  
Morphological Analysis ◽  
Similarity Index ◽  
Freshwater Crayfish ◽  
Cherax Quadricarinatus ◽  
Retention Basin ◽  
Reverse Primer ◽  
Pcr Method ◽  
Molecular Characters ◽  
Forward Primer

The Australian red claw freshwater crayfish, Cherax quadricarinatus is one of the most widely distributed and cultivated freshwater crayfish due to its high tolerance towards various environmental conditions. Native to North Australia and South Papua New Guinea, this crayfish was found in Tambakboyo Retention Basin in 2016 and Sermo Reservoir in 2019. This research was aimed to identify the morphological and molecular characters of  C. quadricarinatus collected from Sermo Reservoir and Tambakboyo Retention Basin, Yogyakarta. The genetic information of the samples was compared to Australian red claw freshwater crayfish currently available. The methodology used for this research are morphological, morphometrical, meristic identification, and molecular identification using the PCR method. The primer used to be 1471 primers as the forward primer and 1472 primers as the reverse primer. In conclusion, all six specimens obtained were identified to be C. quadricarinatus. Morphological analysis using UPGMA showed that all specimens were formed one big cluster and has the highest similarity index (1.00). Molecular analysis using BLAST showed that specimen from Sermo Reservoir was 98.96% identical to C. quadricarinatus and specimen from Tambakboyo Retention Basin was 100% identical to C. quadricarinatus. Thus concluding that based on their morphological and molecular character, all samples of this study were C.  quadricarinatus. This finding also contributes to the distribution information of C. quadricarinatus in Daerah Istimewa Yogyakarta

scholarly journals Primer Design and Analysis for Detection of mecA gene

2021 ◽  
Vol 5 (3) ◽  
pp. 245-253
Author(s):  
Armini Syamsidi ◽  
Nuur Aanisah ◽  
Reyhan Fiqram ◽  
Imanuel Al Jultri
Keyword(s):  
Secondary Structure ◽  
Dna Polymerase ◽  
Base Pair ◽  
Meca Gene ◽  
Chain Reaction ◽  
Base Sequences ◽  
Reverse Primer ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Forward Primer

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Expression patterns of two carbonic anhydrase genes, Na+/K+-ATPase and V-type H+-ATPase, in the freshwater crayfish, Cherax quadricarinatus, exposed to low pH and high pH

2017 ◽  
Vol 65 (1) ◽  
pp. 50 ◽  
Author(s):  
Muhammad Yousuf Ali ◽  
Ana Pavasovic ◽  
Peter B. Mather ◽  
Peter J. Prentis
Keyword(s):  
Carbonic Anhydrase ◽  
Expression Patterns ◽  
Maximum Level ◽  
Low Ph ◽  
Freshwater Crayfish ◽  
Α Subunit ◽  
Cherax Quadricarinatus ◽  
High Ph ◽  
Internal Ph ◽  
Ph Conditions

Carbonic anhydrase (CA), Na+/K+-ATPase (NKA) and Vacuolar-type H+-ATPase (HAT) play vital roles in osmoregulation and pH balance in decapod crustaceans. As variable pH levels have a significant impact on the physiology of crustaceans, it is crucial to understand the mechanisms by which an animal maintains its internal pH. We examined expression patterns of cytoplasmic (CAc) and membrane-associated form (CAg) of CA, NKA α subunit and HAT subunit a in gills of freshwater crayfish, Cherax quadricarinatus, at three pH levels – 6.2, 7.2 (control) and 8.2 – over 24 h. Expression levels of CAc were significantly increased at low pH and decreased at high pH conditions 24 h after transfer. Expression increased at low pH after 12 h, and reached its maximum level by 24 h. CAg showed a significant increase in expression at 6 h after transfer at low pH. Expression of NKA significantly increased at 6 h after transfer to pH 6.2 and remained elevated for up to 24 h. Expression for HAT and NKA showed similar patterns, where expression significantly increased 6 h after transfer to low pH and remained significantly elevated throughout the experiment. Overall, CAc, CAg, NKA and HAT gene expression is induced at low pH conditions in freshwater crayfish.

Improvements to a PCR-Based Serogrouping Scheme for Salmonella enterica from Dairy Farm Samples

2015 ◽  
Vol 78 (6) ◽  
pp. 1182-1185 ◽  
Author(s):  
JEFFREY S. KARNS ◽  
BRADD J. HALEY ◽  
JO ANN S. VAN KESSEL
Keyword(s):  
Salmonella Enterica ◽  
Dairy Farm ◽  
Disease Outbreaks ◽  
In Silico Analysis ◽  
Pcr Assay ◽  
Molecular Serotyping ◽  
Reverse Primer ◽  
Pcr Method ◽  
Silico Analysis

Molecular serotyping through the use of PCR is a simple and useful technique for characterizing isolates of Salmonella enterica subsp. enterica belonging to serogroups B, C1, C2, D1, and E1, which are the majority of the isolates associated with human disease outbreaks. However, many of the Salmonella strains currently isolated from dairy farms in the northeastern United States are serovar Cerro, a group K strain not detected by this assay. Primers from a well-known PCR assay for the identification of Salmonella were added to a commonly used serotyping assay so that strains, such as Salmonella Cerro, that do not produce bands in the original assay can be confirmed as belonging to S. enterica subsp. enterica. The modified assay frequently misidentified the serogroup of Salmonella Mbandaka isolates because of failure to amplify the wzxC1 amplicon. Therefore, the reverse primer for the wzxC1 target was modified based on in silico analysis to provide consistent classification of Salmonella Mbandaka as belonging to serogroup C1. These two modifications to the serogrouping PCR method enhance the utility of the method for characterizing Salmonella isolates.

scholarly journals In vitro evaluation of the effect of mutations in primer binding sites on detection of SARS-CoV-2 by RT-qPCR

2021 ◽  
Author(s):  
Fee Zimmermann ◽  
Maria Urban ◽  
Christian Krueger ◽  
Mathias Walter ◽  
Roman Woelfel ◽  
...  
Keyword(s):  
Binding Sites ◽  
Detrimental Effect ◽  
In Vitro Evaluation ◽  
In Vitro Transcripts ◽  
Nucleotide Mismatch ◽  
Reverse Primer ◽  
Forward Primer

A number of RT-qPCR assays for the detection of SARS-CoV-2 have been published and are listed by the WHO as recommended assays. Furthermore, numerous commercial assays with undisclosed primer and probe sequences are on the market. As the SARS-CoV-2 pandemic progresses, the virus accrues mutations, which in some cases - as seen with the B.1.1.7 variant - can outperform and push back other strains of SARS-CoV-2. If mutations occur in primer or probe binding sites, this can impact RT-qPCR results and impede SARS-CoV-2 diagnostics. Here we tested the effect of primer mismatches on RT-qPCR performance in vitro using synthetic mismatch in vitro transcripts. The effects of the mismatches ranged from a shift in ct values from -0.13 to +7.61. Crucially, we found that a mismatch in the forward primer has a more detrimental effect for PCR performance than a mismatch in the reverse primer. Furthermore, we compared the performance of the original Charite RdRP primer set, which has several ambiguities, with a primer version without ambiguities and found that without ambiguities the ct values are ca. 3 ct lower. Finally, we investigated the shift in ct values observed with the Seegene Allplex kit with the B.1.1.7 SARS-CoV-2 variant and found a three-nucleotide mismatch in the forward primer of the N target.

scholarly journals A novel DDX5 gene in the freshwater crayfish Cherax quadricarinatus is highly expressed during ontogenesis and spermatogenesis

2011 ◽  
Vol 10 (4) ◽  
pp. 3963-3975 ◽  
Author(s):  
D.-A. Fang ◽  
Q. Wang ◽  
J. Wang ◽  
L. He ◽  
L.-H. Liu ◽  
...  
Keyword(s):  
Freshwater Crayfish ◽  
Cherax Quadricarinatus

scholarly journals PCR-based detection of cow’s milk in goat and sheep cheeses marketed in the Czech Republic

2011 ◽  
Vol 24 (No. 3) ◽  
pp. 127-132 ◽  
Author(s):  
E. Mašková ◽  
I. Paulíčková
Keyword(s):  
Mitochondrial Gene ◽  
Retail Trade ◽  
Animal Origin ◽  
The Czech Republic ◽  
Goat Cheese ◽  
Gene Coding ◽  
Reverse Primer ◽  
Pcr Method ◽  
Italian Origin ◽  
Species Specific

A method based on the polymerase chain reaction (PCR) principle was validated for detecting cow’s milk in goat and sheep cheeses. DNA was isolated from the cheeses using the isolation kit Invisorb Spin Food I by Invitek Co., designed for the samples of animal origin. The PCR method applied utilizes the sequence of the mitochondrial gene coding cytochrome b which is specific for mammals. It uses the common forward primer and the reverse primer species-specific. After electrophoresis, cow DNA was characterised by the fragment of the size of 274 bp, goat DNA by the fragment of 157 bp, and sheep DNA by the fragment of 331 bp. The detection limit of the PCR method described (1%) was determined with model samples made from pure goat cheese with a defined addition of cheese made from cow’s milk. The method validated was applied in the analysis of 17 goat cheeses and 7 sheep cheeses obtained from retail trade. Products of Czech, Slovak, French, Dutch, and Italian origin were examined. The presence of undeclared cow’s milk was detected in three kinds of goat cheese and in one of sheep cheese.  

scholarly journals IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA

2020 ◽  
Vol 7 (2) ◽  
pp. 57
Author(s):  
Ni Putu Merthaningsih ◽  
I Putu Sudiarta ◽  
Gusti Ngurah Alit Susanta Wirya
Keyword(s):  
Entomopathogenic Fungi ◽  
Natural Enemies ◽  
Evolutionary Genetics ◽  
Morphological Identification ◽  
Chemical Insecticide ◽  
Negative Effect ◽  
Citrus Production ◽  
Reverse Primer ◽  
Environmentally Friendly Method ◽  
Forward Primer

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target  of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is  Paraleyrodes minei.

scholarly journals PCR Analysis of the Distribution of Unicellular Cyanobacterial Diazotrophs in the Arabian Sea

2004 ◽  
Vol 70 (12) ◽  
pp. 7355-7364 ◽  
Author(s):  
Sophie L. Mazard ◽  
Nicholas J. Fuller ◽  
Karen M. Orcutt ◽  
Oliver Bridle ◽  
Dave J. Scanlan
Keyword(s):  
Arabian Sea ◽  
Marine Diatom ◽  
Pcr Analysis ◽  
Oligonucleotide Primer ◽  
Rrna Gene ◽  
Key Factor ◽  
Subsurface Waters ◽  
Reverse Primer ◽  
The 16S Rrna Gene ◽  
Forward Primer

ABSTRACT An oligonucleotide primer, NITRO821R, targeting the 16S rRNA gene of unicellular cyanobacterial N2 fixers was developed based on newly derived sequences from Crocosphaera sp. strain WH 8501 and Cyanothece sp. strains WH 8902 and WH 8904 as well as several previously described sequences of Cyanothece sp. and sequences of intracellular cyanobacterial symbionts of the marine diatom Climacodium frauenfeldianum. This oligonucleotide is specific for the targeted organisms, which represent a well-defined phylogenetic lineage, and can detect as few as 50 cells in a standard PCR when it is used as a reverse primer together with the cyanobacterium- and plastid-specific forward primer CYA359F (U. Nübel, F. Garcia-Pichel, and G. Muyzer, Appl. Environ. Microbiol. 63:3327-3332, 1997). Use of this primer pair in the PCR allowed analysis of the distribution of marine unicellular cyanobacterial diazotrophs along a transect following the 67°E meridian from Victoria, Seychelles, to Muscat, Oman (0.5°S to 26°N) in the Arabian Sea. These organisms were found to be preferentially located in warm (>29°C) oligotrophic subsurface waters between 0 and 7°N, but they were also found at a station north of Oman at 26°N, 56°35′E, where similar water column conditions prevailed. Slightly cooler oligotrophic waters (<29°C) did not contain these organisms or the numbers were considerably reduced, suggesting that temperature is a key factor in dictating the abundance of this unicellular cyanobacterial diazotroph lineage in marine environments.

Sign in / Sign up

Export Citation Format

Share Document