Genomic Epidemiology and Evolution of Scallion Mosaic Potyvirus From Asymptomatic Wild Japanese Garlic

Scallion mosaic virus (ScaMV) belongs to the turnip mosaic virus phylogenetic group of potyvirus and is known to infect domestic scallion plants (Allium chinense) in China and wild Japanese garlic (Allium macrostemon Bunge) in Japan. Wild Japanese garlic plants showing asymptomatic leaves were collected from different sites in Japan during 2012–2015. We found that 73 wild Japanese garlic plants out of 277 collected plants were infected with ScaMV, identified by partial genomic nucleotide sequences of the amplified RT-PCR products using potyvirus-specific primer pairs. Sixty-three ScaMV isolates were then chosen, and those full genomic sequences were determined. We carried out evolutionary analyses of the complete polyprotein-coding sequences and four non-recombinogenic regions of partial genomic sequences. We found that 80% of ScaMV samples have recombination-like genome structure and identified 12 recombination-type patterns in the genomes of the Japanese ScaMV isolates. Furthermore, we found two non-recombinant-type patterns in the Japanese population. Because the wild plants and weeds may often serve as reservoirs of viruses, it is important to study providing the exploratory investigation before emergence in the domestic plants. This is possibly the first epidemiological and evolutionary study of a virus from asymptomatic wild plants.

Download Full-text

Duplex-RT-PCR assay for the simultaneous detection and discrimination of Brome mosaic virus and Cocksfoot mottle virus in cereal plants

Molecular Biology Reports ◽

10.1007/s11033-021-06485-9 ◽

2021 ◽

Author(s):

Katarzyna Trzmiel

Keyword(s):

Mosaic Virus ◽

Simultaneous Detection ◽

Brome Mosaic Virus ◽

Mottle Virus ◽

Grass Species ◽

Replicase Gene ◽

Rt Pcr ◽

Pcr Products ◽

Cereal Plants ◽

Cocksfoot Mottle Virus

AbstractBrome mosaic virus (BMV) and cocksfoot mottle virus (CfMV) are pathogens of grass species including all economically important cereals. Both viruses have been identified in Poland therefore they create a potential risk to cereal crops. In this study, a duplex—reverse transcription—polymerase chain reaction (duplex-RT-PCR) was developed and optimized for simultaneous detection and differentiation of BMV and CfMV as well as for confirmation of their co-infection. Selected primers CfMVdiag-F/CfMVdiag-R and BMV2-F/BMV2-R amplified 390 bp and 798 bp RT-PCR products within coat protein (CP) region of CfMV and replicase gene of BMV, respectively. Duplex-RT-PCR was successfully applied for the detection of CfMV-P1 and different Polish BMV isolates. Moreover, one sample was found to be co-infected with BMV-ML1 and CfMV-ML1 isolates. The specificity of generated RT-PCR products was verified by sequencing. Duplex-RT-PCR, like conventional RT-PCR, was able to detect two viruses occurring in plant tissues in very low concentration (as low as 4.5 pg/µL of total RNA). In contrast to existing methods, newly developed technique offers a significant time and cost-saving advantage. In conclusion, duplex-RT-PCR is a useful tool which can be implemented by phytosanitary services to rapid detection and differentiation of BMV and CfMV.

Download Full-text

Zucchini yellow mosaic virus Genomic Sequences from Papua New Guinea: Lack of Genetic Connectivity with Northern Australian or East Timorese Genomes, and New Recombination Findings

Plant Disease ◽

10.1094/pdis-09-18-1666-re ◽

2019 ◽

Vol 103 (6) ◽

pp. 1326-1336 ◽

Cited By ~ 1

Author(s):

Solomon Maina ◽

Martin J. Barbetti ◽

Owain R. Edwards ◽

David Minemba ◽

Michael W. Areke ◽

...

Keyword(s):

Mosaic Virus ◽

Papua New Guinea ◽

High Throughput Sequencing ◽

Genomic Sequence ◽

Zucchini Yellow Mosaic Virus ◽

New Guinea ◽

Yellow Mosaic Virus ◽

Genetic Connectivity ◽

Genomic Sequences ◽

Nucleotide Identity

Zucchini yellow mosaic virus (ZYMV) isolates were obtained in Papua New Guinea (PNG) from cucumber (Cucumis sativus) or pumpkin (Cucurbita spp.) plants showing mosaic symptoms growing at Kongop in the Mount Hagen District, Western Highlands Province, or Zage in the Goroka District, Eastern Highlands Province. The samples were blotted onto FTA cards, which were sent to Australia, where they were subjected to high-throughput sequencing. When the coding regions of the nine new ZYMV genomic sequences found were compared with those of 64 other ZYMV sequences from elsewhere, they grouped together, forming new minor phylogroup VII within ZYMV’s major phylogroup A. Genetic connectivity was lacking between ZYMV genomic sequences from PNG and its neighboring countries, Australia and East Timor; the closest match between a PNG and any other genomic sequence was a 92.8% nucleotide identity with a sequence in major phylogroup A’s minor phylogroup VI from Japan. When the RDP5.2 recombination analysis program was used to compare 66 ZYMV sequences, evidence was obtained of 30 firm recombination events involving 41 sequences, and all isolates from PNG were recombinants. There were 21 sequences without recombination events in major phylogroup A, whereas there were only 4 such sequences within major phylogroup B. ZYMV’s P1, Cl, N1a-Pro, P3, CP, and NIb regions contained the highest evidence of recombination breakpoints. Following removal of recombinant sequences, seven minor phylogroups were absent (I, III, IV, V, VI, VII, and VIII), leaving only minor phylogroups II and IX. By contrast, when a phylogenetic tree was constructed using recombinant sequences with their recombinationally derived tracts removed before analysis, five previous minor phylogroups remained unchanged within major phylogroup A (II, III, IV, V, and VII) while four formed two new merged phylogroups (I/VI and VIII/IX). Absence of genetic connectivity between PNG, Australian, and East Timorese ZYMV sequences, and the 92.8% nucleotide identity between a PNG sequence and the closest sequence from elsewhere, suggest that a single introduction may have occurred followed by subsequent evolution to adapt to the PNG environment. The need for enhanced biosecurity measures to protect against potentially damaging virus movements crossing the seas separating neighboring countries in this region of the world is discussed.

Download Full-text

First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽

10.1094/pdis-04-11-0350 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 4

Author(s):

C. Zou ◽

J. Meng ◽

Z. Li ◽

M. Wei ◽

J. Song ◽

...

Keyword(s):

Mosaic Virus ◽

Viral Genome ◽

Terminal Region ◽

Mild Mosaic ◽

Rt Pcr ◽

Degenerate Primers ◽

Germplasm Exchange ◽

First Report ◽

Pcr Products ◽

Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

Download Full-text

Alternanthera mosaic virus Found in Scutellaria, Crossandra, and Portulaca spp. in Florida

Plant Disease ◽

10.1094/pd-90-0833c ◽

2006 ◽

Vol 90 (6) ◽

pp. 833-833 ◽

Cited By ~ 11

Author(s):

C. A. Baker ◽

L. Breman ◽

L. Jones

Keyword(s):

Electron Microscopy ◽

United States ◽

Mosaic Virus ◽

Plant Species ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Indicator Plants ◽

Partial Identity ◽

Pcr Products

In the fall of 1998, the Division of Plant Industry (DPI) received vegetative propagations of Scutellaria longifolia (skullcap) with symptoms of foliar mosaic, chlorotic/necrotic ringspots, and wavy line patterns from a nursery in Manatee County. Flexuous particles approximately 500 nm long were found with electron microscopy. The plants tested positive for Papaya mosaic virus (PaMV) in an enzyme-linked immunosorbent assay (ELISA) test with antiserum to PaMV (Agdia, Elkhart, IN). However, in immunodiffusion tests (antiserum from D. Purcifull, University of Florida), this virus gave a reaction of partial identity indicating it was related but not identical to PaMV (1). The original infected plants were kept in a greenhouse. In January 2005, a specimen of Crossandra infundibuliformis (firecracker plant) with mosaic symptoms was submitted to the DPI from a nursery in Alachua County. Inclusions found with light microscopy and particles found with electron microscopy indicated that this plant was infected with a potexvirus. This was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) with primers designed to detect members of the virus family Potexviridae (3). These plants reacted positive to PaMV antiserum in ELISA and gave a reaction of partial identity to PaMV in immunodiffusion. A specimen of Portulaca grandiflora (moss rose) with distorted leaves found at a local retail store was also tested and gave the same results. Leaves from each of the three plant species were rubbed onto a set of indicator plants using Carborundum and potassium phosphate buffer. Total RNA was extracted from symptomatic indicator plants of Nicotiana benthamiana. RT-PCR (3) was performed, and PCR products were sequenced directly. Sequences of approximately 700 bp were obtained for all three plant species and showed 98% identity with each other. BLAST search results showed that these sequences were 93% identical to an Alternanthera mosaic virus (AltMV) sequence at the nucleotide level but only 76% identical to PaMV. The amino acid sequences were 98 and 82% identical to AltMV and PaMV, respectively. The PCR products of the virus from Scutellaria sp. were cloned, resequenced, and the sequence was entered into the GenBank (Accession No. DQ393785). The bioassay results matched those found for AltMV in Australia (2) and the northeastern United States (4), except that the Florida viruses infected Datura stramonium and Digitalis purpurea (foxglove). The virus associated with the symptoms of these three plants appears to be AltMV and not PaMV. AltMV has been found in ornamental plants in Australia, Italy, and the United States (Pennsylvania, Maryland, and now Florida). Since this virus is known to infect several plants asymptomatically and can be easily confused with PaMV serologically, it is likely that the distribution of this virus is much wider than is known at this time. References: (1) L. L. Breman. Plant Pathology Circular No. 396. Fla. Dept. Agric. Consum. Serv. DPI, 1999. (2) A. D. W. Geering and J. E. Thomas. Arch Virol 144:577, 1999. (3) A. Gibbs et al. J Virol Methods 74:67, 1998. (4) J. Hammond et al. Arch Virol. 151:477, 2006.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

Altered Patterns of Gene Expression in Arabidopsis Elicited by Cauliflower Mosaic Virus (CaMV) Infection and by a CaMV Gene VI Transgene

Molecular Plant-Microbe Interactions ◽

10.1094/mpmi.1999.12.5.377 ◽

1999 ◽

Vol 12 (5) ◽

pp. 377-384 ◽

Cited By ~ 38

Author(s):

Chiara Geri ◽

Edi Cecchini ◽

Maria E. Giannakou ◽

Simon N. Covey ◽

Joel J. Milner

Keyword(s):

Gene Expression ◽

Transgenic Plants ◽

Mosaic Virus ◽

Rna Binding ◽

Important Determinant ◽

Blot Hybridization ◽

Cauliflower Mosaic Virus ◽

Slot Blot Hybridization ◽

Pcr Products ◽

Polymerase Chain

Cauliflower mosaic virus (CaMV) gene VI protein (P6) is an important determinant of symptom expression. Differential display polymerase chain reaction (PCR) was used to identify changes in gene expression in Arabidopsis elicited by a P6 transgene that causes a symptomatic phenotype. We used slot blot hybridization to measure the abundance of mRNAs complementary to 66 candidate PCR products in transgenic, CaMV-infected, and uninfected Arabidopsis plants. CaMV-infected and P6 transgenic plants showed broadly similar changes in abundance of mRNA species. In P6 transgenic plants we detected 18 PCR products that showed unambiguous changes in abundance plus another 15 that showed more limited changes (approximately twofold). CaMV-infected plants showed 17 unambiguous and 13 limited changes. Down-regulated species include those encoding a novel, phenol-like sulfotransferase, and a glycine-rich, RNA-binding protein. Up-regulated species included ones encoding an myb protein, glycine-rich and stress-inducible proteins, and a member of a previously unreported gene family. CaMV infection causes alterations in expression of many Arabidopsis genes. Transgene-mediated expression of P6 mimics virus infection in its effect on host gene expression, providing a potential mechanism for this process.

Download Full-text

African Basil (Ocimum gratissimum) Is a Reservoir of Divergent Begomoviruses in Uganda

Plant Disease ◽

10.1094/pdis-08-19-1675-re ◽

2020 ◽

Vol 104 (3) ◽

pp. 853-859

Author(s):

Happyness G. Mollel ◽

Joseph Ndunguru ◽

Peter Sseruwagi ◽

Titus Alicai ◽

John Colvin ◽

...

Keyword(s):

Mosaic Virus ◽

Phylogenetic Analyses ◽

Plant Viruses ◽

Wild Plants ◽

Bipartite Begomoviruses ◽

Ocimum Gratissimum ◽

Genomic Characterization ◽

Open Access Article

Begomoviruses are plant viruses that cause major losses to many economically important crops. Although they are poorly understood, begomoviruses infecting wild plants may have an important role as reservoirs in the epidemiology of viral diseases. This study reports the discovery and genomic characterization of three novel bipartite begomoviruses from wild and cultivated African basil (Ocimum gratissimum) plants collected in Uganda, East Africa. Based on the symptoms shown by the infected plants, the names proposed for these viruses are Ocimum yellow vein virus (OcYVV), Ocimum mosaic virus (OcMV), and Ocimum golden mosaic virus (OcGMV). Genome and phylogenetic analyses suggest that DNA-A of OcGMV is mostly related to begomoviruses infecting tomato in Africa, whereas those of OcYVV and OcMV are closely related to one another and highly divergent within the Old World begomoviruses. The DNA-A of all characterized begomovirus isolates are of a recombinant nature, revealing the role of recombination in the evolution of these begomoviruses. The viruses characterized here are the first identified in O. gratissimum and the first in Ocimum spp. in the African continent and could have important epidemiological consequences for cultivated basils and other important crops. [Formula: see text] Copyright © 2020 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Download Full-text

Identification of Divergent Isolates of Banana Mild Mosaic Virus and Development of a New Diagnostic Primer to Improve Detection

Pathogens ◽

10.3390/pathogens9121045 ◽

2020 ◽

Vol 9 (12) ◽

pp. 1045

Author(s):

Marwa Hanafi ◽

Rachid Tahzima ◽

Sofiene Ben Kaab ◽

Lucie Tamisier ◽

Nicolas Roux ◽

...

Keyword(s):

Mosaic Virus ◽

High Throughput Sequencing ◽

Plant Viruses ◽

Mild Mosaic ◽

Genome Variability ◽

Molecular Tests ◽

Pcr Products ◽

Reverse Primer ◽

Mild Mosaic Virus ◽

Germplasm Accessions

Banana mild mosaic virus (BanMMV) (Betaflexiviridae, Quinvirinae, unassigned species) is a filamentous virus belonging to the Betaflexiviridae family. It infects Musa spp. with a very wide geographic distribution. The genome variability of plant viruses, including the members of the Betaflexiviridae family, makes their molecular detection by specific primers particularly challenging. During routine indexing of the Musa germplasm accessions, a discrepancy was observed between electron microscopy and immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) test results for one asymptomatic accession. Filamentous viral particles were observed while molecular tests failed to amplify any fragment. The accession underwent high-throughput sequencing and two complete genomes of BanMMV with 75.3% of identity were assembled. Based on these sequences and on the 54 coat protein sequences available from GenBank, a new forward primer, named BanMMV CP9, compatible with Poty1, an oligodT reverse primer already used in diagnostics, was designed. A retrospective analysis of 110 different germplasm accessions from diverse origins was conducted, comparing BanMMCP2 and BanMMV CP9 primers. Of these 110 accessions, 16 tested positive with both BanMMCP2 and BanMMV CP9, 3 were positive with only BanMMCP2 and 2 tested positive with only BanMMV CP9. Otherwise, 89 were negative with the two primers and free of flexuous virions. Sanger sequencing was performed from purified PCR products in order to confirm the amplification of the BanMMV sequence for the five accessions with contrasting results. It is highly recommended to use the two primers successively to improve the inclusiveness of the protocol.

Download Full-text