scholarly journals Relative Abundance of Alpha-Amylase/Trypsin Inhibitors in Selected Sorghum Cultivars

Molecules ◽  
2020 ◽  
Vol 25 (24) ◽  
pp. 5982
Author(s):  
Sorel Tchewonpi Sagu ◽  
Eva Landgräber ◽  
Michal Rackiewicz ◽  
Gerd Huschek ◽  
Harshadrai Rawel
Keyword(s):  
Relative Abundance ◽  
Protein Extraction ◽  
Alkylating Agents ◽  
Good Alternative ◽  
Trypsin Inhibitors ◽  
Ammonium Bicarbonate ◽  
Bicarbonate Buffer ◽  
Best Response ◽  
Safe Food

Sorghum is of growing interest and considered as a safe food for wheat related disorders. Besides the gluten, α-amylase/trypsin-inhibitors (ATIs) have been identified as probable candidates for these disorders. Several studies focused on wheat-ATIs although there is still a lack of data referring to the relative abundance of sorghum-ATIs. The objective of this work was therefore to contribute to the characterization of sorghum ATI profiles by targeted proteomics tools. Fifteen sorghum cultivars from different regions were investigated with raw proteins ranging from 7.9 to 17.0 g/100 g. Ammonium bicarbonate buffer in combination with urea was applied for protein extraction, with concentration from 0.588 ± 0.047 to 4.140 ± 0.066 mg/mL. Corresponding electrophoresis data showed different protein profiles. UniProtKB data base research reveals two sorghum ATIs, P81367 and P81368; both reviewed and a targeted LC–MS/MS method was developed to analyze these. Quantifier peptides ELAAVPSR (P81367) and TYMVR (P81368) were identified and retained as biomarkers for relative quantification. Different reducing and alkylating agents were assessed and combination of tris (2 carboxyethyl) phosphine/iodoacetamide gave the best response. Linearity was demonstrated for the quantifier peptides with standard recovery between 92.2 and 107.6%. Nine sorghum cultivars presented up to 60 times lower ATI contents as compared to wheat samples. This data suggests that sorghum can effectively be considered as a good alternative to wheat.

scholarly journals Effect of Cereal α-Amylase/Trypsin Inhibitors on Developmental Characteristics and Abundance of Digestive Enzymes of Mealworm Larvae (Tenebrio molitor L.)

Insects ◽  
2021 ◽  
Vol 12 (5) ◽  
pp. 454
Author(s):  
Sorel Tchewonpi Sagu ◽  
Eva Landgräber ◽  
Ina M. Henkel ◽  
Gerd Huschek ◽  
Thomas Homann ◽  
...  
Keyword(s):  
Serine Protease ◽  
Relative Abundance ◽  
Digestive Enzymes ◽  
Growth Parameters ◽  
Oryza Sativa L ◽  
Digestive Enzyme ◽  
Tenebrio Molitor ◽  
Trypsin Inhibitors ◽  
Ammonium Bicarbonate ◽  
Developmental Characteristics

The objective of this work was to investigate the potential effect of cereal α-amylase/trypsin inhibitors (ATIs) on growth parameters and selective digestive enzymes of Tenebrio molitor L. larvae. The approach consisted of feeding the larvae with wheat, sorghum and rice meals containing different levels and composition of α-amylase/trypsin inhibitors. The developmental and biochemical characteristics of the larvae were assessed over feeding periods of 5 h, 5 days and 10 days, and the relative abundance of α-amylase and selected proteases in larvae were determined using liquid chromatography tandem mass spectrometry. Overall, weight gains ranged from 21% to 42% after five days of feeding. The larval death rate significantly increased in all groups after 10 days of feeding (p < 0.05), whereas the pupation rate was about 25% among larvae fed with rice (Oryza sativa L.) and Siyazan/Esperya wheat meals, and only 8% and 14% among those fed with Damougari and S35 sorghum meals. As determined using the Lowry method, the protein contents of the sodium phosphate extracts ranged from 7.80 ± 0.09 to 9.42 ± 0.19 mg/mL and those of the ammonium bicarbonate/urea reached 19.78 ± 0.16 to 37.47 ± 1.38 mg/mL. The total protein contents of the larvae according to the Kjeldahl method ranged from 44.0 and 49.9 g/100 g. The relative abundance of α-amylase, CLIP domain-containing serine protease, modular serine protease zymogen and C1 family cathepsin significantly decreased in the larvae, whereas dipeptidylpeptidase I and chymotrypsin increased within the first hours after feeding (p < 0.05). Trypsin content was found to be constant independently of time or feed material. Finally, based on the results we obtained, it was difficult to substantively draw conclusions on the likely effects of meal ATI composition on larval developmental characteristics, but their effects on the digestive enzyme expression remain relevant.

Fibrillin molecules aggregate to form an extendible beaded structure which is a major component of “Elastin Associated” microfibrils

1989 ◽  
Vol 47 ◽  
pp. 246-247
Author(s):  
Douglas R. Keene ◽  
B. Kerry Maddox ◽  
Marie B. Spurgin ◽  
Lynn Y. Sakai ◽  
Robert W. Glanville
Keyword(s):  
Molecular Sieve ◽  
Room Temperature ◽  
Culture Medium ◽  
Weight Fraction ◽  
Ammonium Bicarbonate ◽  
High Molecular Weight Fraction ◽  
Bicarbonate Buffer ◽  
Human Amnion ◽  
Gold Conjugate ◽  
Ammonium Bicarbonate Buffer

A mouse monoclonal antibody was used to identify beaded aggregates found in guanidine extracts of human amnion as assemblies of fibrillin molecules. These aggregates were also shown to be a major component of extracellular matrix microfibrils. We further demonstrated that the periodicity of these aggregates can be increased when subjected to mechanical stress.Human amnion was extracted with guanidine and the extracted material purified using ion exchange and molecular sieve chromatography. A high molecular weight fraction was precipitated by dialyzing against dilute acetic acid. Part of the precipitate was suspended in 0.2 M ammonium bicarbonate buffer and rotary shadowed. A second portion was resuspended in culture medium containing antibody which recognizes matrix microfibrils, diluted 1:5 in ammonium bicarbonate and reacted for 120 minutes at room temperature. Antibody labeled precipitate was washed by repeated pelleting and resuspension in buffer and then incubated in Janssen GAM 5 nm gold conjugate for 60 minutes at room temperature.

scholarly journals Synthesis and Biological Activity of New Brassinosteroid Analogs of Type 24-Nor-5β-Cholane and 23-Benzoate Function in the Side Chain

2021 ◽  
Vol 22 (9) ◽  
pp. 4808
Author(s):  
Nitza Soto ◽  
Karoll Ferrer ◽  
Katy Díaz ◽  
César González ◽  
Lautaro Taborga ◽  
...  
Keyword(s):  
Good Alternative ◽  
Positive Control ◽  
Starting Material ◽  
Chemical Structures ◽  
High Reaction ◽  
Similar Chemical ◽  
Synthetic Procedure ◽  
Hyodeoxycholic Acid ◽  
External Stresses

Brassinosteroids are polyhydroxysteroids that are involved in different plants’ biological functions, such as growth, development and resistance to biotic and external stresses. Because of its low abundance in plants, much effort has been dedicated to the synthesis and characterization of brassinosteroids analogs. Herein, we report the synthesis of brassinosteroid 24-nor-5β-cholane type analogs with 23-benzoate function and 22,23-benzoate groups. The synthesis was accomplished with high reaction yields in a four-step synthesis route and using hyodeoxycholic acid as starting material. All synthesized analogs were tested using the rice lamina inclination test to assess their growth-promoting activity and compare it with those obtained for brassinolide, which was used as a positive control. The results indicate that the diasteroisomeric mixture of monobenzoylated derivatives exhibit the highest activity at the lowest tested concentrations (1 × 10−8 and 1 × 10−7 M), being even more active than brassinolide. Therefore, a simple synthetic procedure with high reaction yields that use a very accessible starting material provides brassinosteroid synthetic analogs with promising effects on plant growth. This exploratory study suggests that brassinosteroid analogs with similar chemical structures could be a good alternative to natural brassinosteroids.

scholarly journals New Insights on the Zeugodacus cucurbitae (Coquillett) Bacteriome

2021 ◽  
Vol 9 (3) ◽  
pp. 659
Author(s):  
Elias Asimakis ◽  
Panagiota Stathopoulou ◽  
Apostolis Sapounas ◽  
Kanjana Khaeso ◽  
Costas Batargias ◽  
...  
Keyword(s):  
Relative Abundance ◽  
Bacterial Communities ◽  
High Throughput Sequencing ◽  
Mutual Exclusion ◽  
Bacterial Composition ◽  
Operational Taxonomic Units ◽  
Host Diet ◽  
Dominant Bacteria ◽  
High Degree

Various factors, including the insect host, diet, and surrounding ecosystem can shape the structure of the bacterial communities of insects. We have employed next generation, high-throughput sequencing of the 16S rRNA to characterize the bacteriome of wild Zeugodacus (Bactrocera) cucurbitae (Coquillett) flies from three regions of Bangladesh. The tested populations developed distinct bacterial communities with differences in bacterial composition, suggesting that geography has an impact on the fly bacteriome. The dominant bacteria belonged to the families Enterobacteriaceae, Dysgomonadaceae and Orbaceae, with the genera Dysgonomonas, Orbus and Citrobacter showing the highest relative abundance across populations. Network analysis indicated variable interactions between operational taxonomic units (OTUs), with cases of mutual exclusion and copresence. Certain bacterial genera with high relative abundance were also characterized by a high degree of interactions. Interestingly, genera with a low relative abundance like Shimwellia, Gilliamella, and Chishuiella were among those that showed abundant interactions, suggesting that they are also important components of the bacterial community. Such knowledge could help us identify ideal wild populations for domestication in the context of the sterile insect technique or similar biotechnological methods. Further characterization of this bacterial diversity with transcriptomic and metabolic approaches, could also reveal their specific role in Z. cucurbitae physiology.

scholarly journals Characterization of five new low-molecular-mass trypsin inhibitors from white mustard (Sinapis alba L.) seed

2000 ◽  
Vol 267 (21) ◽  
pp. 6486-6492 ◽  
Author(s):  
Margherita Ruoppolo ◽  
Angela Amoresano ◽  
Piero Pucci ◽  
Stefano Pascarella ◽  
Fabio Polticelli ◽  
...  
Keyword(s):  
Molecular Mass ◽  
Sinapis Alba ◽  
Trypsin Inhibitors ◽  
White Mustard ◽  
Sinapis Alba L

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals Gut microbiome and its cofactors are linked to lipoprotein distribution profiles

2021 ◽  
Author(s):  
Josue Castro Mejia ◽  
Bekzod Khakimov ◽  
Mads Lind ◽  
Eva Garne ◽  
Petronela Paulova ◽  
...  
Keyword(s):  
Relative Abundance ◽  
Gut Microbiome ◽  
Short Chain Fatty Acids ◽  
Future Research ◽  
Lipoprotein Subfractions ◽  
Lipoprotein Subclasses ◽  
Metagenome Sequencing ◽  
Lipoprotein Distribution ◽  
Host Characteristics

Increasing evidence indicates that the gut microbiome (GM) plays an important role in the etiology of dyslipidemia. To date, however, no in depth characterization of the associations between GM and its metabolic attributes with deep profiling of lipoproteins distributions (LPD) among healthy individuals has been conducted. To determine associations and contributions of GM composition and its cofactors with distribution profiles of lipoprotein subfractions, we studied blood plasma LPD, fecal short-chain fatty acids (SCFA) and GM of 262 healthy Danish subjects aged 19-89 years. Stratification of LPD segregated subjects into three clusters of profiles that reflected differences in the lipoprotein subclasses, corresponded well with limits of recommended levels of main lipoprotein fractions and were largely explained by host characteristics such as age and body mass index. Higher levels of HDL, particularly driven by large subfractions (HDL2a and HDL2b), were associated with a higher relative abundance of Ruminococcaceae and Christensenellaceae. Increasing levels of total cholesterol and LDL, which were primarily associated with large 1 and 2 subclasses, were positively associated with Lachnospiraceae and Coriobacteriaceae, and negatively with Bacteroidaceae and Bifidobacteriaceae. Metagenome sequencing showed a higher abundance of genes involved in the biosynthesis of multiple B-vitamins and SCFA metabolism among subjects with healthier LPD profiles. Metagenomic assembled genomes (MAGs) affiliated mainly to Eggerthellaceae and Clostridiales were identified as the contributors of these genes and whose relative abundance correlated positively with larger subfractions of HDL. The results of this study demonstrate that remarkable differences in composition and metabolic traits of the GM are associated with variations in LPD among healthy subjects. Findings from this study provide evidence for GM considerations in future research aiming to shade light on mechanisms of the GM - dyslipidemia axis.

Proteomic and genomic characterization of Kunitz trypsin inhibitors in wild and cultivated soybean genotypes

2007 ◽  
Vol 164 (6) ◽  
pp. 756-763 ◽  
Author(s):  
Savithiry Natarajan ◽  
Chenping Xu ◽  
Hanhong Bae ◽  
Bryan A. Bailey
Keyword(s):  
Trypsin Inhibitors ◽  
Soybean Genotypes ◽  
Genomic Characterization ◽  
Cultivated Soybean
Sign in / Sign up

Export Citation Format

Share Document