scholarly journals Synthesis and Biological Activity of New Brassinosteroid Analogs of Type 24-Nor-5β-Cholane and 23-Benzoate Function in the Side Chain

2021 ◽  
Vol 22 (9) ◽  
pp. 4808
Author(s):  
Nitza Soto ◽  
Karoll Ferrer ◽  
Katy Díaz ◽  
César González ◽  
Lautaro Taborga ◽  
...  
Keyword(s):  
Good Alternative ◽  
Positive Control ◽  
Starting Material ◽  
Chemical Structures ◽  
High Reaction ◽  
Similar Chemical ◽  
Synthetic Procedure ◽  
Hyodeoxycholic Acid ◽  
External Stresses

Brassinosteroids are polyhydroxysteroids that are involved in different plants’ biological functions, such as growth, development and resistance to biotic and external stresses. Because of its low abundance in plants, much effort has been dedicated to the synthesis and characterization of brassinosteroids analogs. Herein, we report the synthesis of brassinosteroid 24-nor-5β-cholane type analogs with 23-benzoate function and 22,23-benzoate groups. The synthesis was accomplished with high reaction yields in a four-step synthesis route and using hyodeoxycholic acid as starting material. All synthesized analogs were tested using the rice lamina inclination test to assess their growth-promoting activity and compare it with those obtained for brassinolide, which was used as a positive control. The results indicate that the diasteroisomeric mixture of monobenzoylated derivatives exhibit the highest activity at the lowest tested concentrations (1 × 10−8 and 1 × 10−7 M), being even more active than brassinolide. Therefore, a simple synthetic procedure with high reaction yields that use a very accessible starting material provides brassinosteroid synthetic analogs with promising effects on plant growth. This exploratory study suggests that brassinosteroid analogs with similar chemical structures could be a good alternative to natural brassinosteroids.

scholarly journals Synthesis and Characterization of Partially Renewable Oleic Acid-Based Ionomers for Proton Exchange Membranes

Polymers ◽  
2020 ◽  
Vol 13 (1) ◽  
pp. 130
Author(s):  
Carlos Corona-García ◽  
Alejandro Onchi ◽  
Arlette A. Santiago ◽  
Araceli Martínez ◽  
Daniella Esperanza Pacheco-Catalán ◽  
...  
Keyword(s):  
Oleic Acid ◽  
Proton Conductivity ◽  
Electrochemical Impedance ◽  
Proton Exchange Membranes ◽  
Proton Exchange ◽  
Molar Ratio ◽  
Aromatic Diamines ◽  
Chemical Structures ◽  
Long Chain

The future availability of synthetic polymers is compromised due to the continuous depletion of fossil reserves; thus, the quest for sustainable and eco-friendly specialty polymers is of the utmost importance to ensure our lifestyle. In this regard, this study reports on the use of oleic acid as a renewable source to develop new ionomers intended for proton exchange membranes. Firstly, the cross-metathesis of oleic acid was conducted to yield a renewable and unsaturated long-chain aliphatic dicarboxylic acid, which was further subjected to polycondensation reactions with two aromatic diamines, 4,4′-(hexafluoroisopropylidene)bis(p-phenyleneoxy)dianiline and 4,4′-diamino-2,2′-stilbenedisulfonic acid, as comonomers for the synthesis of a series of partially renewable aromatic-aliphatic polyamides with an increasing degree of sulfonation (DS). The polymer chemical structures were confirmed by Fourier transform infrared (FTIR) and nuclear magnetic resonance (1H, 13C, and 19F NMR) spectroscopy, which revealed that the DS was effectively tailored by adjusting the feed molar ratio of the diamines. Next, we performed a study involving the ion exchange capacity, the water uptake, and the proton conductivity in membranes prepared from these partially renewable long-chain polyamides, along with a thorough characterization of the thermomechanical and physical properties. The highest value of the proton conductivity determined by electrochemical impedance spectroscopy (EIS) was found to be 1.55 mS cm−1 at 30 °C after activation of the polymer membrane.

Isolation, Identification and Degradation Characterization of Synthetic Dyes Degrading Strain

2012 ◽  
Vol 610-613 ◽  
pp. 3140-3143
Author(s):  
Hui Xing Liang
Keyword(s):  
Pseudomonas Aeruginosa ◽  
Synthetic Dyes ◽  
Complex Chemical ◽  
Chemical Structures ◽  
Cultural Conditions ◽  
Cultural Medium ◽  
Initial Ph

Dyes are usually difficult to be decolorized due to their complex chemical structures. In this work, a bacterium which had the ability of decoloration on synthetic dyes was isolated from Yancheng printworks and was identified as Pseudomonas aeruginosa. The effects of concentration of the dye concentration, cultural time, cultural temperature and initial pH of cultural medium on the efficiency of decoloration were investigated. The result showed that the optimal cultural conditions was: dye concentration was 50mg.L-1, cultural time was 72 h, cultural temperature was 28°C, initial pH of cultural medium was 7.0.

scholarly journals Chemical Derivatization and Characterization of Novel Antitrypanosomals for African Trypanosomiasis

Molecules ◽  
2021 ◽  
Vol 26 (15) ◽  
pp. 4488
Author(s):  
Aboagye Kwarteng Dofuor ◽  
Temitayo Samson Ademolue ◽  
Cynthia Mmalebna Amisigo ◽  
Kwaku Kyeremeh ◽  
Theresa Manful Gwira
Keyword(s):  
Structural Modification ◽  
Spectroscopic Analysis ◽  
Microscopic Analysis ◽  
The Novel ◽  
Chemical Derivatization ◽  
African Trypanosomiasis ◽  
Chemical Structures ◽  
Normal Ratio

The search for novel antitrypanosomals and the investigation into their mode of action remain crucial due to the toxicity and resistance of commercially available antitrypanosomal drugs. In this study, two novel antitrypanosomals, tortodofuordioxamide (compound 2) and tortodofuorpyramide (compound 3), were chemically derived from the natural N-alkylamide tortozanthoxylamide (compound 1) through structural modification. The chemical structures of these compounds were confirmed through spectrometric and spectroscopic analysis, and their in vitro efficacy and possible mechanisms of action were, subsequently, investigated in Trypanosoma brucei (T. brucei), one of the causative species of African trypanosomiasis (AT). The novel compounds 2 and 3 displayed significant antitrypanosomal potencies in terms of half-maximal effective concentrations (EC50) and selectivity indices (SI) (compound 1, EC50 = 7.3 μM, SI = 29.5; compound 2, EC50 = 3.2 μM, SI = 91.3; compound 3, EC50 = 4.5 μM, SI = 69.9). Microscopic analysis indicated that at the EC50 values, the compounds resulted in the coiling and clumping of parasite subpopulations without significantly affecting the normal ratio of nuclei to kinetoplasts. In contrast to the animal antitrypanosomal drug diminazene, compounds 1, 2 and 3 exhibited antioxidant absorbance properties comparable to the standard antioxidant Trolox (Trolox, 0.11 A; diminazene, 0.50 A; compound 1, 0.10 A; compound 2, 0.09 A; compound 3, 0.11 A). The analysis of growth kinetics suggested that the compounds exhibited a relatively gradual but consistent growth inhibition of T. brucei at different concentrations. The results suggest that further pharmacological optimization of compounds 2 and 3 may facilitate their development into novel AT chemotherapy.

Molecular Motion Analysis of 5CB in PDLCs Using Solid-State 13C NMR Relaxation Spectroscopy

1993 ◽  
Vol 47 (7) ◽  
pp. 933-941 ◽  
Author(s):  
Karen L. Buchert ◽  
Jack L. Koenig ◽  
Shi-Qing Wang ◽  
John L. West
Keyword(s):  
Liquid Crystal ◽  
Solid State ◽  
Polymer Matrix ◽  
Nmr Relaxation ◽  
Domain Size ◽  
Chemical Structures ◽  
Similar Chemical ◽  
Polymer Dispersed ◽  
Submicron Droplets ◽  
Significant Change

In samples of polymer-dispersed liquid crystals (PDLCs), submicron droplets of liquid crystal reside within a polymer matrix. By the use of the cross polarization technique for solid-state 13C NMR spectroscopy, the NMR spectrum of the liquid crystal can be obtained without interference from the polymer spectrum, even though the two materials have some similar chemical structures. Both 13C T1 and 13C T1 ρ relaxation experiments were performed on a PDLC system of 5CB in epoxy as a function of 5CB domain size. The 13C T1 relaxation constants and the localized motions they measure showed no significant change over the liquid crystal domain size studied. However, the 13C T1 ρ relaxation constants and the segmental motions of molecules they measure revealed a significant change over the liquid crystal domain size studied. Therefore, the 13C T1 ρ values can be used to determine the change in mobility of the molecular segments of the SCB molecules resulting from increased interaction between the liquid crystal and the polymer matrix and to further understand the importance of the molecular motions of the liquid crystal in the switching phenomenon for PDLC materials.

Topological characterization of dendrimer, benzenoid, and nanocone

2018 ◽  
Vol 74 (1-2) ◽  
pp. 35-43
Author(s):  
Wei Gao ◽  
Muhammad Kamran Siddiqui ◽  
Najma Abdul Rehman ◽  
Mehwish Hussain Muhammad
Keyword(s):  
Chemical Properties ◽  
Chemical Compounds ◽  
Topological Indices ◽  
Zagreb Index ◽  
Topological Characterization ◽  
Complex Molecules ◽  
Chemical Structures ◽  
Physico Chemical ◽  
Quantitative Structure Activity Relationships

Abstract Dendrimers are large and complex molecules with very well defined chemical structures. More importantly, dendrimers are highly branched organic macromolecules with successive layers or generations of branch units surrounding a central core. Topological indices are numbers associated with molecular graphs for the purpose of allowing quantitative structure-activity relationships. These topological indices correlate certain physico-chemical properties such as the boiling point, stability, strain energy, and others, of chemical compounds. In this article, we determine hyper-Zagreb index, first multiple Zagreb index, second multiple Zagreb index, and Zagreb polynomials for hetrofunctional dendrimers, triangular benzenoids, and nanocones.

scholarly journals Evaluation of antipyretic activity of hydroalcoholic extract of Corchorus depressus Linn. in Escherichia coli–induced pyretic rabbits

2018 ◽  
Vol 16 ◽  
pp. 205873921879295
Author(s):  
Saeed Ahmad ◽  
Muhammad Akram ◽  
Syed Muhammad Ali Shah ◽  
Sabira Sultana
Keyword(s):  
Escherichia Coli ◽  
Positive Control ◽  
Negative Control ◽  
The Body ◽  
Hydroalcoholic Extract ◽  
Antipyretic Effect ◽  
E Coli ◽  
Antipyretic Activity ◽  
Experimental Treatments

This study was conducted to investigate the antipyretic effect of the hydroalcoholic extract of Corchorus depressus Linn. against Escherichia coli ( E. coli)-induced pyrexia in rabbits. Hydroalcohalic extracts of C. depressus were given orally at 25, 50, and 100 mg/kg for antipyretic affect in E. coli-induced fever in rabbits. The animals were divided into five groups of five each. Among these five groups, three received various doses of experimental treatments, whereas the fourth one served as positive control and received paracetamol. The fifth group of animals served as negative control and received no treatment. The body temperature of the rabbits was measured rectally over a period of 5 h. C. depressus exhibited better effects at dose rate of 25, 50, and 100 mg/kg. The hydroalcoholic extract of C. depressus has significant antipyretic effect. These results lend support to the popular use of C. depressus in traditional medicine as a remedy for pyrexia and suggest that the characterization of the principles for such activity deserves further investigation.

scholarly journals Competitive cocrystallization and its application in the separation of flavonoids

IUCrJ ◽  
2021 ◽  
Vol 8 (2) ◽  
pp. 195-207
Author(s):  
Yanming Xia ◽  
Yuanfeng Wei ◽  
Hui Chen ◽  
Shuai Qian ◽  
Jianjun Zhang ◽  
...  
Keyword(s):  
Free Energy ◽  
Formation Constant ◽  
Energy Gap ◽  
Hirshfeld Surface ◽  
Methanol Solution ◽  
Model Compounds ◽  
Electronic Density ◽  
Chemical Structures ◽  
Similar Chemical ◽  
Interaction Contribution

Recently, cocrystallization has been widely employed to tailor physicochemical properties of drugs in the pharmaceutical field. In this study, cocrystallization was applied to separate natural compounds with similar structures. Three flavonoids [baicalein (BAI), quercetin (QUE) and myricetin (MYR)] were used as model compounds. The coformer caffeine (CAF) could form cocrystals with all three flavonoids, namely BAI–CAF (cocrystal 1), QUE–CAF (cocrystal 2) and MYR–CAF (cocrystal 3). After adding CAF to methanol solution containing MYR and QUE (or QUE and BAI), cocrystal 3 (or cocrystal 2) preferentially formed rather than cocrystal 2 (or cocrystal 1), indicating that flavonoid separation could be achieved by competitive cocrystallization. After co-mixing the slurry of two flavonoids with CAF followed by centrifugation, the resolution ratio that could be achieved was 70–80% with purity >90%. Among the three cocrystals, cocrystal 3 showed the lowest formation constant with a negative Gibbs free energy of nucleation and the highest energy gap. Hirshfeld surface analysis and density of states analysis found that cocrystal 3 had the highest strong interaction contribution and the closest electronic density, respectively, followed by cocrystal 2 and cocrystal 1, suggesting CAF could competitively form a cocrystal with MYR much more easily than QUE and BAI. Cocrystallization is a promising approach for green and effective separation of natural products with similar chemical structures.

scholarly journals Dinucleoside polyphosphates act as 5’-RNA caps in Escherichia coli

2019 ◽  
Author(s):  
Oldřich Hudeček ◽  
Roberto Benoni ◽  
Martin Culka ◽  
Martin Hubálek ◽  
Lubomír Rulíšek ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Rna Stability ◽  
E Coli ◽  
Chemical Structures ◽  
Additional Layer ◽  
Similar Chemical ◽  
Decapping Enzyme ◽  
Almost All ◽  
Dinucleoside Polyphosphates ◽  
Rna Caps

Dinucleoside polyphosphates (NpnNs), discovered more than 50 years ago,1 are pleiotropic molecules present in almost all types of cells.2 It has been shown that their intracellular concentration can under stress conditions increase from the µM to mM range 2,3. However, the cellular roles and mechanisms of action of NpnNs are still speculative4,5. They have never been considered as part of the RNA, even though they have similar chemical structures as already known RNA caps, such as the nicotinamide adenine dinucleotide (NAD)6-8 and 7-methylguanylate cap9. Here, we show that both methylated and non-methylated Npn Ns serve as RNA caps in Escherichia coli (E. coli). NpnNs are excellent substrates for T7 and E. coli RNA polymerases (RNAP) and efficiently initiate transcription. Further, we demonstrate that the E. coli decapping enzyme RNA 5’ pyrophosphohydrolase (RppH) is able to remove the NpnNs-cap from the RNA. RppH was, however, not able to cleave the methylated forms of the NpnN-caps, suggesting that the methylation adds an additional layer to the RNA stability regulation. Our work introduces an original perspective on the chemical structure of RNA in prokaryotes and the function of RNA caps. This is the first evidence that small molecules like NpnNs can act in cells via their incorporation into RNA and influence the cellular metabolism.

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

scholarly journals Mono-/Bis-Alkenoic Acid Derivatives From an Endophytic Fungus Scopulariopsis candelabrum and Their Antifungal Activity

2022 ◽  
Vol 9 ◽  
Author(s):  
Jun Tang ◽  
Xueshuang Huang ◽  
Ming-Hang Cao ◽  
Zhiyan Wang ◽  
Zhiyin Yu ◽  
...  
Keyword(s):  
Candida Albicans ◽  
Minimum Inhibitory Concentration ◽  
Inhibitory Concentration ◽  
High Resolution Mass Spectrometry ◽  
2D Nmr ◽  
Positive Control ◽  
Diffusion Method ◽  
Exserohilum Turcicum ◽  
Chemical Structures ◽  
Alkenoic Acid

During a screening for antifungal secondary metabolites, six new mono-/bis-alkenoic acid derivatives (2–7) and one known alkenoic acid derivative (1) were isolated from an endophytic fungi Scopulariopsis candelabrum. Their chemical structures were identified by 1H-NMR, 13C-NMR, 2D NMR, and high-resolution mass spectrometry, as well as comparisons with previously reported literatures. Among them, fusariumesters C‒F (2–5) are bis-alkenoic acid derivatives dimerized by an ester bond, while acetylfusaridioic acid A (6) and fusaridioic acid D (7) are alkenoic acid monomers. All the isolates were submitted to an antifungal assay against Candida albicans and the corn pathogen Exserohilum turcicum using the filter paper agar diffusion method. As a result, only compound 1 decorating with β-lactone ring turned out to be active against these two tested fungi. The broth microdilution assay against Candida albicans showed the minimum inhibitory concentration (MIC) value of 1 to be 20 μg/ml, while the minimum inhibitory concentration value of the positive control (naystatin) was 10 μg/ml. And the half maximal inhibitory concentration (IC50) value (21.23 μg/ml) of 1 against Exserohilum turcicum was determined by analyzing its inhibition effect on the mycelial growth, using cycloheximide (IC50 = 46.70 μg/ml) as the positive control.

Sign in / Sign up

Export Citation Format

Share Document