scholarly journals Metagenomics Analysis of the Wheat Virome Identifies Novel Plant and Fungal-Associated Viral Sequences

Viruses ◽  
2021 ◽  
Vol 13 (12) ◽  
pp. 2457
Author(s):  
Carla Dizon Redila ◽  
Ved Prakash ◽  
Shahideh Nouri
Keyword(s):  
Mosaic Virus ◽  
Crop Yields ◽  
De Novo ◽  
Barley Yellow Dwarf Virus ◽  
Rna Virus ◽  
Triticum Aestivum L ◽  
Full Genome Sequence ◽  
Significant Similarity ◽  
Yellow Dwarf Virus ◽  
Viral Sequences

Wheat viruses including wheat streak mosaic virus, Triticum mosaic virus, and barley yellow dwarf virus cost substantial losses in crop yields every year. Although there have been extensive studies conducted on these known wheat viruses, currently, there is limited knowledge about all components of the wheat (Triticum aestivum L.) virome. Here, we determined the composition of the wheat virome through total RNA deep sequencing of field-collected leaf samples. Sequences were de novo assembled after removing the host reads, and BLASTx searches were conducted. In addition to the documented wheat viruses, novel plant and fungal-associated viral sequences were identified. We obtained the full genome sequence of the first umbra-like associated RNA virus tentatively named wheat umbra-like virus in cereals. Moreover, a novel bi-segmented putative virus tentatively named wheat-associated vipovirus sharing low but significant similarity with both plant and fungal-associated viruses was identified. Additionally, a new putative fungal-associated tobamo-like virus and novel putative Mitovirus were discovered in wheat samples. The discovery and characterization of novel viral sequences associated with wheat is important to determine if these putative viruses may pose a threat to the wheat industry or have the potential to be used as new biological control agents for wheat pathogens either as wild-type or recombinant viruses.

scholarly journals First Report of Soilborne Wheat Mosaic Virus in the United Kingdom

Plant Disease ◽  
1999 ◽  
Vol 83 (9) ◽  
pp. 880-880 ◽  
Author(s):  
G. R. G. Clover ◽  
D. M. Wright ◽  
C. M. Henry
Keyword(s):  
United Kingdom ◽  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Protein A ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Barley Yellow Dwarf ◽  
The United Kingdom ◽  
Field Samples ◽  
Yellow Dwarf Virus

In April 1999, severe soilborne wheat mosaic virus (SBWMV) symptoms were observed in five fields of winter wheat (Triticum aestivum, cvs. Consort, Equinox, and Savannah) on one farm in Wiltshire, UK. Affected plants were markedly stunted and had a pale mosaic on their leaf sheaths that developed into bright yellow, parallel streaks on the leaves as they unfolded. Symptomatic plants were found in discrete, elliptical patches ranging in size from a few square meters to nearly a hectare. During May and June, symptoms became less marked as temperatures increased and were restricted to lower leaves. SBWMV was positively identified in all five fields (60 to 170 plants per field) by double (W. Huth, BBA-Braunschweig, Germany; Sanofi Phyto-Diagnostics, Paris) and triple (T. Wilson, SCRI, Dundee, UK) antibody sandwich enzyme-linked immunosorbent assay and by reversetranscription polymerase chain reaction (2). Identification was confirmed by immunoelectron microscopy, including protein-A gold labeling, which revealed bipartite, rod-shaped particles typical of SBWMV. Neither wheat spindle streak mosaic virus nor barley yellow dwarf virus was detected in the field samples, nor was SBWMV detected in any other field subsequently sampled, despite a survey of the surrounding area. Wheat is the most important economic crop in the United Kingdom (≈1.9 million hectares are grown annually, yielding ≈16 million tonnes), but its position is threatened by the economic impact of SBWMV, which has decreased yields by up to 50% in the United States (1). References: (1) T. A. Kucharek and J. H. Walker. Plant Dis. Rep. 58:763, 1974. (2) R. E. Pennington et al. Plant Dis. 77:1202, 1993.

Occurrence of Viruses in Wheat in the Great Plains Region, 2008

2009 ◽  
Vol 10 (1) ◽  
pp. 14 ◽  
Author(s):  
Mary Burrows ◽  
Gary Franc ◽  
Charlie Rush ◽  
Tamla Blunt ◽  
Dai Ito ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Great Plains ◽  
Barley Yellow Dwarf Virus ◽  
Average Frequency ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
High Plains ◽  
Virus Infections ◽  
Yellow Dwarf Virus ◽  
First Time

Field surveys in 2008 determined the prevalence and diversity of viruses present in the Great Plains wheat crops. Symptomatic plants (n = 754) in nine states were tested for Wheat streak mosaic virus (WSMV), Wheat mosaic virus (WMoV, formerly known as High Plains virus), Triticum mosaic virus (TriMV), Barley yellow dwarf virus-PAV (BYDV-PAV), and Cereal yellow dwarf virus-RPV (CYDV-RPV), using indirect ELISA. Virus prevalence varied greatly, with average frequency of detection highest for WSMV (47%), followed by WMoV (19%), TriMV (17%), BYDV-PAV (7%), and lowest for CYDV-RPV (2%). Most positive plant samples (37%) had one virus present, with decreasing frequencies for co-infection by two (19%), three (5%), or four viruses (1%). TriMV was detected for the first time in Colorado, Nebraska, Oklahoma, South Dakota, Texas, and Wyoming. WMoV was identified for the first time in Montana and Wyoming. Chlorotic streaks were more frequently associated with WSMV, WMoV, and TriMV (R = 0.166 to 0.342; P < 0.05), and stunting was more frequently associated with WMoV (R = 0.142; P = 0.004) or TriMV (R = 0.107; P = 0.033) than WSMV. Symptom severity did not increase with co-infection as compared to single virus infections, with the exception of plants co-infected with mite transmitted viruses in Texas. Accepted for publication 1 May 2009. Published 6 July 2009.

Viruses of New Zealand pasture grasses and legumes: a review

2014 ◽  
Vol 65 (9) ◽  
pp. 841 ◽  
Author(s):  
P. L. Guy
Keyword(s):  
New Zealand ◽  
Mosaic Virus ◽  
Resistance Genes ◽  
Barley Yellow Dwarf Virus ◽  
Cropping Systems ◽  
Alfalfa Mosaic Virus ◽  
Plant Viruses ◽  
Future Research ◽  
Pasture Grasses ◽  
Yellow Dwarf Virus

This article reviews knowledge of 23 plant viruses infecting pasture grasses and legumes in New Zealand. The incidence, ecology and impact of each virus and prospects for control using natural or artificial resistance genes or by vector control is discussed. The most prevalent viruses are Alfalfa mosaic virus and White clover mosaic virus in pasture legumes and Cocksfoot mottle virus, Ryegrass mosaic virus and Barley yellow dwarf virus in pasture grasses. Lucerne Australian latent virus is restricted to the North Island and Red clover necrotic mosaic virus is largely restricted to the South Island. These patterns are likely to be dynamic with ongoing changes in weather patterns, land use, the spread of insect vectors and the continuing introduction of viruses and vectors. The existing and potential threats to 12 pasture species are tabulated and the knowledge gaps for each species highlighted. Control of vectors including aphids, eriophyid mites and soil-borne fungi is probably not economic per se but could be an additional benefit of integrated pest management in pasture and cropping systems. The most cost-effective and practical preventative measures are likely to be the use of virus-tested seed to establish new pastures and the incorporation of resistance genes by conventional breeding or by genetic engineering. Finally, recommendations are made for future research for New Zealand, which is also relevant to other temperate regions of the world.

The effect of elevated CO2 and virus infection on the primary metabolism of wheat

2016 ◽  
Vol 43 (9) ◽  
pp. 892 ◽  
Author(s):  
Simone Vassiliadis ◽  
Kim M. Plummer ◽  
Kevin S. Powell ◽  
Piotr Trębicki ◽  
Jo E. Luck ◽  
...  
Keyword(s):  
Virus Infection ◽  
Barley Yellow Dwarf Virus ◽  
Rhopalosiphum Padi ◽  
Disease Status ◽  
Co2 Concentration ◽  
Triticum Aestivum L ◽  
Primary Metabolism ◽  
Total N ◽  
Co2 Concentrations ◽  
Yellow Dwarf Virus

Atmospheric CO2 concentrations are predicted to double by the end of this century. Although the effects of CO2 fertilisation in crop systems have been well studied, little is known about the specific interactions among plants, pests and pathogens under a changing climate. This growth chamber study focuses on the interactions among Barley yellow dwarf virus (BYDV), its aphid vector (Rhopalosiphum padi) and wheat (Triticum aestivum L. cv. Yitpi) under ambient (aCO2; 400µmolmol–1) or elevated (eCO2; 650µmolmol–1) CO2 concentrations. eCO2 increased the tiller number and biomass of uninoculated plants and advanced the yellowing symptoms of infected plants. Total foliar C content (percentage of the total DW) increased with eCO2 and with sham inoculation (exposed to early herbivory), whereas total N content decreased with eCO2. Liquid chromatography–mass spectrometry approaches were used to quantify the products of primary plant metabolism. eCO2 significantly increased sugars (fructose, mannitol and trehalose), irrespective of disease status, whereas virus infection significantly increased the amino acids essential to aphid diet (histidine, lysine, phenylalanine and tryptophan) irrespective of CO2 concentration. Citric acid was reduced by both eCO2 and virus infection. Both the potential positive and negative biochemical impacts on wheat, aphid and BYDV interactions are discussed.

SUSCEPTIBILITY OF COMMON AND DURUM SPRING WHEATS TO BARLEY YELLOW DWARF VIRUS

1967 ◽  
Vol 47 (5) ◽  
pp. 571-576 ◽  
Author(s):  
C. C. Gill
Keyword(s):  
Common Wheat ◽  
Barley Yellow Dwarf Virus ◽  
Triticum Aestivum L ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Average Height ◽  
Leaf Stage ◽  
Barley Yellow Dwarf ◽  
Yellow Dwarf Virus ◽  
Temporary Decrease

Nine varieties of common wheat (Triticum aestivum L.) and four varieties of durum wheat (T. durum Desf.) were inoculated with three isolates of barley yellow dwarf virus (BYDV) in the greenhouse. All varieties proved susceptible to BYDV, and yields were severely reduced. Yellow discoloration and chlorosis of leaves was slight in most varieties inoculated with the two stronger isolates, though stunting, delay in heading and a reduction in the number of tillers were apparent. In the most susceptible varieties, the rate of growth suffered a marked temporary decrease during the early shock phase of infection.Manitou, one of the varieties of common wheat tested in the greenhouse, was also inoculated with one of the virus isolates in a field plot. The yield from plants inoculated at the three-leaf stage was 64% less than that from uninfected plants. There was a reduction of 40% in yield from plants inoculated when each plant had four to five tillers and the average height was 20.3 cm. Stunting and reduction in the number of tillers and size of heads were apparent in mature plants inoculated at the three-leaf stage. The only symptom on plants inoculated when tillers had developed was a slight yellowing of the leaf tips, first noticeable about 18 days after inoculation.

scholarly journals Deep Sequencing of Recombinant Virus Populations in Transgenic and Nontransgenic Plants Infected with Cucumber mosaic virus

2013 ◽  
Vol 26 (7) ◽  
pp. 801-811 ◽  
Author(s):  
Marco Morroni ◽  
Mireille Jacquemond ◽  
Mark Tepfer
Keyword(s):  
Transgenic Plants ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
De Novo ◽  
Recombinant Viruses ◽  
Viral Genomes ◽  
Large Deletions ◽  
Cp Gene ◽  
Viral Sequences ◽  
Virus Variability

Recombination is a major source of virus variability, and the question of whether novel recombinant viruses would emerge in transgenic plants expressing viral sequences has been a biosafety issue. We describe the results of pyrosequencing the recombinant viral RNAs appearing in transgenic plants expressing the coat protein (CP) gene and 3′ noncoding region of Cucumber mosaic virus RNA3, as well as in nontransgenic controls. The populations of recombinants in both transgenic and nontransgenic plants were similar to those previously described from Sanger sequencing but many more recombinant types were observed, including a novel class of large deletions removing all or nearly the entire CP gene. These results show that populations of recombinant viral genomes arising de novo can be characterized in detail by pyrosequencing, and confirm that the transgenic plants did not harbor novel recombinants of biosafety concern.

scholarly journals First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 849-849 ◽  
Author(s):  
E. S. Mustafayev ◽  
L. Svanella-Dumas ◽  
S. G. Kumari ◽  
Z. I. Akparov ◽  
T. Candresse
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
The United States ◽  
Yellow Dwarf ◽  
Dwarf Virus ◽  
Cereal Crops ◽  
Cereal Yellow Dwarf Virus ◽  
Barley Yellow Dwarf ◽  
Nucleotide Divergence ◽  
Yellow Dwarf Virus

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

scholarly journals First Record of Barley yellow striate mosaic virus Affecting Wheat Summer-Nurseries in Syria

Plant Disease ◽  
2004 ◽  
Vol 88 (1) ◽  
pp. 83-83 ◽  
Author(s):  
Khaled M. Makkouk ◽  
Safaa G. Kumari ◽  
Widad Ghulam ◽  
Nouran Attar
Keyword(s):  
Mosaic Virus ◽  
Barley Yellow Dwarf Virus ◽  
Polyclonal Antibodies ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
First Record ◽  
Structural Protein ◽  
Western Blots ◽  
N Protein ◽  
Yellow Dwarf Virus

A limited survey to identify virus diseases affecting wheat in summer nurseries in agricultural stations in southern Syria was conducted during October 2002. A total of 94 bread and durum wheat samples with symptoms suggestive of virus infection (stripping, stunting, and yellowing) were collected. All samples were tested for the presence of four viruses by tissue-blot immunoassay (2) at the Virology Laboratory of ICARDA, Aleppo, Syria using the following polyclonal antibodies: Barley stripe mosaic virus (BSMV); Barley yellow dwarf virus-PAV (BYDV-PAV) and Wheat streak mosaic virus (WSMV) from the Virology Laboratory at ICARDA; and Barley yellow striate mosaic virus (BYSMV) isolated from Italy (BYSMV-Italy) and provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. Serological results obtained indicated that BYSMV was the most commonly encountered virus (78.7%) followed by BYDV-PAV (22.3%), whereas, BSMV and WSMV were not detected in any of the samples tested. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, purified BYSMV preparations were observed to contain a 47-kDa structural protein typical of the N protein of Rhabdoviruses that reacted strongly with three BYSMV antisera (BYSMV-Italy, BYSMV-Lebanon [4], and BYSMV-Morocco [1]). Samples that reacted with BYSMV antisera were transmitted from wheat to wheat, barley, and oat plants by the planthopper Laodelphax striatella (Fallen) (Hemiptera: family Delphacidae) in a persistent manner, and the major symptoms of BYSMV on cereal crops were stripping and stunting. BYDV-PAV has been reported from Syria earlier (3) but to our knowledge, this is the first report of BYSMV affecting wheat in Syria. References: (1) B. E. Lockhart et al. Plant Dis. 70:1113, 1986. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) K. M. Makkouk et al. Phytopathol. Mediterr. 28:164, 1989. (4) K. M. Makkouk et al. Plant Dis. 85:446, 2001.

Sign in / Sign up

Export Citation Format

Share Document