scholarly journals Investigations on Biosuppression of Wilt Disease in Tomato Using Cell-Free Culture Filtrate of Phytopathogenic Fusarium oxysporum f.sp. lycopersici

2021 ◽  
pp. 30-41
Author(s):  
Borisade Omotoso Abiodun ◽  
Olofin Adeola Rosemary ◽  
M. J. Falade
Keyword(s):  
Seed Germination ◽  
Ambient Temperature ◽  
Fusarium Oxysporum ◽  
Culture Filtrate ◽  
Disease Incidence ◽  
Wilt Disease ◽  
Post Inoculation ◽  
Tomato Plants ◽  
The Mean ◽  
Colony Area

Potency of cell-free culture filtrate of pathogenic Fusarium oxysporum f.sp. lycopersici as systemic defense inducer against wilt disease in tomato was tested by treating seedlings with the filtrate before pathogen challenge. Infective conidia and the cell-free culture filtrate were prepared from F. oxysporum (Sensu lato) previously isolated from wilt diseased affected plants. Growth relations of the isolates were characterized under ambient temperature (25 ± 2°C) and viability of the infective conidia of the two isolates were evaluated. Treatments were done as follows: (a) treatment of seedlings with infective conidia only (Treatment-A) (b) culture filtrate treatment only (Treatment-B) (c) treatment with culture filtrate followed by inoculation with infective conidia (Treatment-C) and (d) the control which consisted of plants sprayed with sterile distilled water only (Treatment-D). Effects of fungal conidia on tomato seed germination as well as some agronomic characters of the tomato plants and disease incidence under treatments A, B, C and D were evaluated. The growth and sporulation rates of the F. oxysporum F-isolate-1 were 12.1 mm day-1 and 6.5 x 104 conidia cm-2 colony area respectively and the values for the second isolate, F-Isolate 2 were 6.1 mm day-1 and 5.4 x 104 conidia cm-2 colony area. The germination rates of the infective conidia of F-isolate 1 and F-Isolate 2 after 24 hours incubation period at ambient temperature were 70% and 85% respectively. Treatment of tomato seeds with conidia suspension containing 1.0 x 106 had no statistically significant effects on seed germination [F(2,12)=0.148, P=0.64]; the mean percentage germination of the seeds treated with F-Isolate 1, F-Isolate 2 conidia and the control were 52%,46% and 52% respectively after five days. In the Treatment-A (Infective conidia only), F-Isolate 1 and F-isolate 2 caused 100% and 80% wilt of the plant populations at 7 weeks post-inoculation, when the tomato plants were 9 weeks old and no wilt was recorded in the control. There was no wilt recorded under Treatment-B and Treatment-C also, but there was reduced flowering and the mean percentage number of leaves showing chlorosis were significantly higher than the control [F (4, 192) =6.641, P=0.001]. When the plants were 10 weeks old, withered branches at the lower vegetal strata and the senescent leaves in the control were comparable with that recorded under Treatment-B and Treatment-C (F (4, 159) =3.563, P=0.08].

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Efficacy of fungicides in controlling fusarium wilt of gladiolus

2018 ◽  
Vol 42 (4) ◽  
pp. 599-607
Author(s):  
L Yasmin ◽  
MA Ali ◽  
FN Khan
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Field Condition ◽  
Agricultural Research ◽  
Disease Incidence ◽  
Wilt Disease ◽  
Spike Length ◽  
Research Centre ◽  
Agricultural Research Institute ◽  
Infested Field

The efficacy of fungicides in controlling Fusarium wilt of gladiolus was studied at Horticulture Research Centre (HRC), Bangladesh Agricultural Research Institute (BARI), Gazipur during 2010-2012 following RCB design with four replications. Six fungicides such as Bavistin (0.1%), Provax (0.2%), Mancozeb (0.2%), Rovral (0.2%), Chlorax (10%) and Cupravit (0.7%) were evaluated against the Fusarium wilt disease of gladiolus (Fusarium oxysporum f. sp. gladioli) under naturally infested field condition. Bavistin was very effective in reducing the disease incidence and thereby resulting maximum corm germination (99.98%), spike length (73.90 cm), rachis length (43.70 cm), florets spike-1 (12.63), flower sticks plot-1 (38.75) and corm plot-1 (60.23) and cormel yield ha-1 (2.51 t) of gladiolus. Provax and Cupravit were also effective in inhibiting the disease incidence as well as better spike length, rachis length, florets spike-1, no of flower sticks, corm and cormel yield.Bangladesh J. Agril. Res. 42(4): 599-607, December 2017

scholarly journals Biological management of fusarium wilt on tomato caused by Fusarium oxysporum f. sp. lycospersici by some plant growth-promoting bacteria

2020 ◽  
Author(s):  
Halima Z. Hussein ◽  
Shaker I. Al-Dulaimi
Keyword(s):  
Fusarium Oxysporum ◽  
Disease Severity ◽  
Fusarium Wilt ◽  
Wilt Disease ◽  
Systemic Resistance ◽  
Control Treatment ◽  
Plant Growth Promoting Bacteria ◽  
Tomato Plants ◽  
Fusarium Wilt Disease ◽  
Infection Percentage

AbstractChemical approaches have been applied to combat Fusarium wilt disease for a long time. Even though pesticides are effective in controlling the disease, they continue to damage the environment. Environmental-friendly approaches to manage plant disease are the goal of many studies recently. This study was conducted to assess the efficacy of some bio-agents in induction of systemic resistance in tomato plants as a management approach of Fusarium wilt disease caused by Fusarium oxysporum f.sp. lycopersici (FOL) under condition Plastic house. Results of the plastic house experiments showed that all treatments in decreased Fusarium disease percentage and severity on tomato, two bacterial combinations (Streptomyces sp. (St) and Pseudomonas fluorescence (Pf)) decreased the infection percentage and disease severity with 16.6% and 8.3%, respectively. Treatment with St reduced the infection percentage and disease severity with 33.3% and 22.8%, while the Pf treatment showed 41.6% and 31.2% reduction in infection percentage and disease severity, compared to 100% and 91.6% in the control treatment. Results of induced systemic resistance (ISR) biochemical indicators showed significant differences in tomato plants. Peroxidase and Phenylalanine-Ammonia-Lyase (PAL) activity and the Phenol content increased significantly 14 days after treatments compared to the control treatment, which contains only the fungal pathogen FOL.

scholarly journals Interaction of Meloidogyne incognita and fungi: a potential threat to cotton crop in Punjab

2021 ◽  
Vol 58 (04) ◽  
pp. 1277-1290
Author(s):  
Mehwish Naz
Keyword(s):  
Fusarium Oxysporum ◽  
Root System ◽  
Meloidogyne Incognita ◽  
Disease Incidence ◽  
Wilt Disease ◽  
Economic Losses ◽  
Root Knot Nematodes ◽  
Nematode Reproduction ◽  
Colletotrichum Spp ◽  
Cotton Wilt

Cotton is an important cash crop of Pakistan and is severely affected with wilt in cotton-growing areas of Punjab province. Research was carried out on two major pathogens of cotton Fusarium oxysporum f. sp. vasinfectum and Meloidogyne incognita and their possible role in wilt disease complex. During 2017-19, a survey of cotton growing areas of Punjab (Jhang, Multan, Vehari, Mianwali, Rahim Yar Khan, Bahawalpur, Kabir Wala, Dakota, Basti Dharik, Tibba Sultan Pur, Rajan Pur, Chak 27 (Layyah), Chak 99B (Layyah), Lodhran, Fateh Pur and Dagar Rohtass) was conducted to collect a sample on symptomology basis of yellowing of leaves, discoloured bark of lower part of the stem, blackened xylem vessel and wilting. Data were recorded on wilt disease incidence, prevalence, associated pathogens and root-knot nematodes. Prevalence of cotton wilt was recorded the maximum 85% in areas of Vehari, Kabir Wala and Rajan Pur while the maximum incidence in both Multan and Tibba Sultan Pur was 15%. Percentage association of wilting fungi was recorded from the soil, roots, stem and leaves on placing them in artificial media and soil dilution techniques were used to determine fungi in rhizosphere such as Fusarium oxysporum, Verticillium spp., Penicillium spp., Aspergillus spp., Rhizoctonia spp., Colletotrichum spp., Rhizopus spp., Mucor and Pythium. Root associated fungi were isolated by Hyphal tip method and isolated F. oxysporum, Rhizoctonia spp. and Pythium spp. From stem and leaf sample, F. oxysporum, Verticillium spp., Colletotrichum spp., Alternaria spp. and Botryodiplodia spp. were recorded. Relative density nematode was recorded from different locations and highest occurrence was observed in Bahawalpur (85%) by using different extraction methods. Eggs masses of root knot nematodes were staining by using Phloxin B and nematodes inside root system was done by using acid fuchsin. Nematode reproduction parameters like No. of J2/roots system, J2 in 100ml of soils, eggs masses/root system, females/ roots system, galls/ root system were recorded. Cotton wilt caused by the interaction of Fusarium and Root knot nematode is threat to cotton industry in Pakistan and it should be treated to avoid economic losses.

scholarly journals First Report of Fusarium wilt disease on Watermelon Caused by Fusarium oxysporum f. sp. niveum (FON) in Malaysia

Plant Disease ◽  
2021 ◽  
Author(s):  
Muhammad Ziaur Rahman ◽  
Khairulmazmi Ahmad ◽  
Yasmeen Siddiqui ◽  
Norsazilawati Saad ◽  
Tan Geok Hun ◽  
...  
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Cover Crops ◽  
Fungal Pathogen ◽  
Disease Incidence ◽  
Wilt Disease ◽  
Likelihood Method ◽  
Distilled Water ◽  
First Report ◽  
Fusarium Wilt Disease

Fusarium wilt disease incited by Fusarium oxysporum f. sp. niveum (FON) is the utmost devastating soil-inhabiting fungal pathogen limiting watermelon (Citrullus lanatus) production in Malaysia and globally. The field disease survey of fusarium wilt was carried out during December 2019 and November 2020, in three major production areas (3 farmer fields per location) in Peninsular Malaysia namely, Mersing, Serdang and Kuantan and disease incidence of 30 and 45%, was recorded for each year, respectively. Infected watermelon plants showed symptoms such as vascular discoloration, brown necrotic lesions to the soil line or the crown, one-sided wilt of a plant, or a runner or the whole plant. Infected root and stem tissues, 1-2 cm pieces were surface sterilized with 0.6% NaOCl for 1 minute followed by double washing with sterile water. The disinfected tissues were air-dried and transferred onto semi-selective Komada’s medium (Komada 1975) and incubated for 5 days. The fungal colonies produced were placed on potato dextrose agar (PDA) to attain a pure culture and incubated at 25±2℃ for 15 days. The pure fungal colony was flat, round and light purple in color. Macroconidia were straight to slightly curved, 18.56-42.22 µm in length, 2.69-4.08 µm width, predominantly 3 septate and formed in sporodochia. Microconidia measured 6.16-10.86 µm in length and 2.49-3.83 µm in width, kidney-shaped, aseptate and were formed on short monophialides in false-heads. Chlamydospores were single or in pairs with smooth or rough walls, found both terminally or intercalary. To confirm their pathogenicity, two-week-old watermelon seedlings (cv. NEW BEAUTY) were dipped into spore suspension (1 ˟ 106 spores/ml) of representative isolates of JO20 (Mersing), UPM4 (Serdang) and KU41 (Kuantan) for 30 second and then moved into 10 cm diameter plastic pots containing 300 g sterilized soil mix. Disease symptoms were assessed weekly for one month. Control seedlings were immersed in sterile distilled water before transplanting. The inoculated seedlings showed typical Fusarium wilt symptoms like yellowing, stunted growth, and wilting, which is similar to the farmer field infected plants. However, the seedlings inoculated by sterile distilled water remained asymptomatic. The pathogen was successfully re-isolated from the infected seedlings onto Komada’s medium, fulfilling the Koch’s postulate. For the PCR amplification, primers EF-1 and EF-2 were used to amplify the tef1-α region. A Blastn analysis of the tef1-α sequences of the isolates JO20 (accession nos. MW315902), UPM4 (MW839560) and KU41 (MW839562) showed 100% similarity; with e-value of zero, to the reference sequences of F. oxysporum isolate FJAT-31690 (MN507110) and F. oxysporum f. sp. niveum isolate FON2 790-2 (MN057702). In Fusarium MLST database, isolates JO20, UPM4 and KU41 revealed 100% identity with the reference isolate of NRRL 22518 (accession no. FJ985265). Though isolate FJ985265 belongs to the f. sp. melonis, earlier findings had revealed Fusarium oxysporum f. sp. are naturally polyphyletic and making clusters with diverse groups of the Fusarium oxysporum species complex (O’Donnell et al. 2015). The isolates JO20, UPM4 and KU41 were identified as F. oxysporum f. sp. niveum based on the aligned sequences of tef1-α and molecular phylogenetic exploration by the maximum likelihood method. To the best of our knowledge, this is the first report of F. oxysporum f. sp. niveum as a causative pathogen of Fusarium wilt disease of watermelon in Malaysia. Malaysia enables to export watermelon all-year-round in different countries like Singapore, Hong-Kong, The United Arab Emirates (UAE), and Netherlands. The outburst of this destructive soil-borne fungal pathogen could cause hindrance to watermelon cultivation in Malaysia. Thus, growers need to choice multiple management tactics such as resistant varieties, cultural practices (soil amendments and solarization), grafting, cover crops and fungicide application to control this new pathogen.

scholarly journals Prevalence of Fusarium Wilt Disease of Cucumber (Cucumis sativus Linn) in Peninsular Malaysia Caused by Fusarium oxysporum and F. solani

2020 ◽  
Vol 31 (3) ◽  
pp. 29-45
Author(s):  
Hazirah Mohd Din ◽  
Osamah Rashed ◽  
Khairulmazmi Ahmad
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Disease Incidence ◽  
Infected Plant ◽  
Peninsular Malaysia ◽  
Disease Prevalence ◽  
Wilt Disease ◽  
Infested Soil ◽  
Pathogenicity Test ◽  
Fusarium Wilt Disease

Fusarium wilt disease is one of the most problematic and destructive disease in cucumber production. The causative agents are Fusarium oxysporum and F. solani. These pathogens are soil borne and transmitted through infested soil and water. A field survey was conducted to study the disease prevalence in the major growing areas of cucumber in Peninsular Malaysia. Field study revealed that the disease was highly prevalence in the field with the disease incidence was in the range of 10%–60%. The morphological properties of F. oxysporum are microconidia (3.8–15.7 μm × 2.9–4.9 μm), macroconidia (14.8–38.5 μm × 2.4–5.7 μm) and number of septate was 1–4. While for F. solani are microconidia (3.39–14.63 μm × 2.36–4.44 μm), macroconidia (7.22–50.46 μm × 2.43–6.14 μm) and number of septate was 1–5. Based on molecular identification had confirmed that the disease is caused by F. oxysporum and F. solani with similarity index of 99%–100% based on internal transcribed spacer (ITS) gene sequences. The pathogenicity test showed that the symptoms of Fusarium wilt disease was firstly appeared as yellowing of old leaves. Progressively, the infected plant will be wilted and finally died. The outputs of this study are highly important to establish an effective disease management programme to reduce disease prevalence and yield loss in the field.

scholarly journals SURVEY ON THE INCIDENCE OF FUSARIUM WILT OF TOMATO INCITED BY FUSARIUM OXYSPORUM F.SP. LYCOPERSICI (FOL) IN MAJOR TOMATO GROWING AREAS OF KRISHNAGIRI DISTRICT

2020 ◽  
Vol 21 (supplemenet 1) ◽  
Author(s):  
K. Vignesh ◽  
K. Rajamohan ◽  
P. Balabaskar ◽  
R. Anandan ◽  
R. Udhayakumar
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Fungal Pathogen ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Wilt Disease ◽  
Tomato Seedlings ◽  
Collar Region ◽  
Wide Range ◽  
Wilt Incidence

Tomato is one of the most important, commercial and widely grown vegetable crop in the world. It is affected by several fungal, bacterial and viral diseases. Among these Fusarium wilt caused by the fungus Fusarium oxysporum f.sp. lycopersici causes 30-40% yield loss. A survey was conducted to investigate the incidence and severity of Fusarium wilt incited by Fusarium oxysporum f.sp. lycopersici in ten major tomato growing areas of Krishnagiri district. The occurrence of wilt disease incidence ranged from 18 % to 49% was noticed. Plant showing typical symptoms were taken from 10 fields and identified based on symptom appearance as well as morphological characteristics. The result of the survey revealed that wide range of infection and severity of wilt disease were occurred in the major tomato growing areas in Krishnagiri district. Isolation of the pathogen associated with tomato wilt was made from the diseased tissues in roots and collar region of the plant on the Potato dextrose agar (PDA) medium. Fol3 recorded the maximum wilt incidence followed by Fol4 and the minimum wilt incidence was recorded by Fol6 . The pathogenicity of the fungal pathogen was also proved after artificial inoculation of the tomato seedlings

scholarly journals Aplikasi Beberapa Bentuk Formulasi Trichoderma spp dalam Mengendalikan Penyakit Layu Fusarium pada Tanaman Tomat

2020 ◽  
Vol 3 (2) ◽  
pp. 20-30
Author(s):  
Muhammad Fazil ◽  
Tjut Chamzurni ◽  
Rina Sriwati
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Liquid Product ◽  
Wilt Disease ◽  
Trichoderma Spp ◽  
Soil Pathogens ◽  
Tomato Plants ◽  
Product Formulation ◽  
Fusarium Wilt Disease ◽  
Randomized Design

Abstrak: Fusarium oxysporum f.sp. lycopersici (Fol) adalah salah satu patogen tular tanah yang sangat berbahaya bagi tanaman tomat, hal itu dikarenakan patogen ini mampu bertahan dalam jangka waktu yang lama di dalam tanah. Salah  satu  alternatif  pengendalian  secara  biologi  yang  ramah  lingkungan  adalah dengan cara memanfaatkan cendawan antagonis sebagai agen biokontrol yaitu Trichoderma spp. penggunaan cendawan antagonis sebagai agen hayati harus dalam bentuk formula yang tepat dengan bahan yang mudah tersedia. Penelitian  ini   bertujuan  untuk  mengetahui  pengaruh  aplikasi  beberapa   bentuk formulasi  Trichoderma  spp  dalam  mengendalikan penyakit  layu  fusarium  pada  tanaman tomat. Penelitian ini menggunakan Rancangan Acak Lengkap pola non faktorial yang terdiri dari 4 perlakuan dengan menggunakan 5 ulangan, setiap ulangan terdiri dari 4 unit tanaman. Susunan perlakuan bentuk formulasi berbahan aktif Trichoderma spp yaitu F0 = Kontrol (tanpa perlakuan),F1 = Formulasi pelet daun katuk 3 g (+ 10 butir)/polibag, F2 = Formulasi padat jagung kering 3 g/polibag dan F3 = Formulasi cair produk komersil 100 ml/polibag. Hasil penelitian menunjukkan bahwa aplikasi beberapa bentuk formulasi  Trichoderma spp  mampu memberikan pengaruh yang nyata terhadap persentase layu tanaman dan tinggi tanaman serta persentase batang yang xylemnya terdiskolorasi. Application of Several Forms by Trichoderma spp Formulation in Controlling Fusarium Wilt Disease on Tomato PlantsAbstract. Fusarium oxysporum f.sp. lycopersici (Fol) is one of the soil pathogens that is very harmful for tomato plants, it is because these pathogens are able to survive for a long time in the soil. One of the alternative biological controls that are environmentally friendly is by utilizing the antagonist fungus as a biocontrol agent that is Trichoderma spp. the use of antagonistic fungi as biological agents should be in the form of the right formula with easily available materials. This study aims to determine the effect of application of some form of Trichoderma spp formulation in controlling fusarium wilt disease in tomato plants. This research uses Completely Randomized Design of non factorial pattern consisting of 4 treatments using 5 replications, each replication consisting of 4 plant units. the active formulation by several form formulation of Trichoderma spp is F0 = Control (without treatment), F1 = Leaf pelet formulation 3 g (+ 10 grain) / polybag, F2 = Dry corn solid formula 3 g / polybag and F3 = Commercial liquid product formulation 100 ml / polybag. The results showed that the application of some form of formulation Trichoderma spp able to give a real effect on the percentage of wilting plants and plant height as well as the percentage of stems that discoloration on xylem.

scholarly journals Disease Development Following Infection of Tomato and Basil Foliage by Airborne Conidia of the Soilborne Pathogens Fusarium oxysporum f. sp. radicis-lycopersici and F. oxysporum f. sp. basilici

2000 ◽  
Vol 90 (12) ◽  
pp. 1322-1329 ◽  
Author(s):  
Y. Rekah ◽  
D. Shtienberg ◽  
J. Katan
Keyword(s):  
Fusarium Oxysporum ◽  
Disease Incidence ◽  
Selective Medium ◽  
Management Program ◽  
Causal Agent ◽  
Soilborne Pathogens ◽  
Tomato Plants ◽  
Pathogen Invasion ◽  
Crown And Root Rot

Fusarium oxysporum f. sp. radicis-lycopersici, the causal agent of Fusarium crown and root rot of tomato, and F. oxysporum f. sp. basilici, the causal agent of Fusarium wilt in basil, are soilborne pathogens capable of producing conspicuous masses of macroconidia along the stem. The role of the airborne propagules in the epidemics of the disease in tomato plants was studied. In the field, airborne propagules of F. oxysporum f. sp. radicis-lycopersici were trapped with a selective medium and their prevalence was determined. Plants grown in both covered and uncovered pots, detached from the field soil, and exposed to natural aerial inoculum developed typical symptoms (82 to 87% diseased plants). The distribution of inoculum in the growth medium in the pots also indicated the occurrence of foliage infection. In greenhouse, foliage and root inoculations were carried out with both tomato and basil and their respective pathogens. Temperature and duration of high relative humidity affected rate of colonization of tomato, but not of basil, by the respective pathogens. Disease incidence in foliage-inoculated plants reached 75 to 100%. In these plants, downward movement of the pathogens from the foliage to the crown and roots was observed. Wounding enhanced pathogen invasion and establishment in the foliage-inoculated plants. The sporulation of the two pathogens on stems, aerial dissemination, and foliage infection raise the need for foliage protection in addition to soil disinfestation, in the framework of an integrated disease management program.

scholarly journals Evaluation of Different Fungicides and Bioagents for the Management of Chickpea Wilt (Fusarium oxysporum f. sp. ciceri)

2020 ◽  
pp. 19-30
Author(s):  
Seethiya Mahajan ◽  
Deepak Kumar ◽  
Santosh Kumar Singh ◽  
Deepak Mahajan ◽  
Devendra Kumar ◽  
...  
Keyword(s):  
Grain Yield ◽  
Fusarium Oxysporum ◽  
Disease Incidence ◽  
Maximum Growth ◽  
Wilt Disease ◽  
Copper Oxychloride ◽  
Maximum Increase ◽  
Chickpea Wilt ◽  
Highly Sensitive

The incidence of the chickpea wilt disease caused by Fusarium oxysporum f. sp. ciceri ranged between 8.11 - 21.67 and 10.98 - 23.99 per cent with an overall mean disease incidence of 15.64 and 16.86 per cent respectively during Rabi seasons of 2016-17 and 2017-18 in surveys conducted fortnightly in the different chickpea growing areas of Jammu sub-tropics. The maximum growth inhibition of pathogen i.e., 78.44 per cent was observed by local isolate T. harzianum (Th-III) and P. fluorescens (Pf-III) was least effective in controlling the growth of pathogen i.e., 53.00 per cent in In vitro studies. Among chemicals, carbendazim at 100 ppm was significantly effective in inhibiting the growth of pathogen (98.67%), while copper oxychloride and mancozeb showed inhibition of 83.11 and 82.22 per cent, respectively. Both the antagonists were highly sensitive to propiconazole (Tilt), carbendazim (Bavistin), difenoconazole (Score), iprodione + carbendazim (Quintal) and metalaxyl (Ridomil), giving no growth of T. viride (TV-III) and T. harzianum (TH-III). TMTD (Thiram) recorded least inhibition of both the bioagents. Under field conditions, bioagents recorded maximum seed germination of 90.21 and 90.07 per cent, whereas least germination was recorded in mancozeb (84.17 and 83.10%). Carbendazim recorded lowest disease incidence (14.92 and 14.97%) over untreated control (44.42 and 45.77%). However, maximum grain yield was recorded in azoxystrobin + T. harzianum-III (14.30 and 14.57 q/ha) and azoxystrobin + T. viride-III (14.15 and 14.38 q/ha) and the least grain yield was recorded in mancozeb (10.58 and 10.64 q/ha) during Rabi 2016-17 and 2017-18. Maximum increase in grain yield was recorded in azoxystrobin + T. harzianum-III (62.31 and 62.43%) followed by azoxystrobin + T. viride-III (62.61 and 60.87%) during Rabi 2016-17 and 2017-18.

Sign in / Sign up

Export Citation Format

Share Document