NPC-Exosome Carry Wild and Mutant-type p53 among Nasopharyngeal Cancer Patients

BACKGROUND: Nasopharyngeal cancer (NPC) is known to release a specific exosome. NPC-derived exosome (NPC-Exo) could carry p53. However, information regarding the type of p53 carrier on NPC-Exo remains limited. This study aims to introduce our important findings regarding the type of p53 NPC-Exo cargo.METHODS: Serum from patients with NPC were prepared for exosome isolation with Seramir Exoquick by following the manual instructions. RT-PCR was conducted to determine the expression levels of latent membrane protein 1 (LMP-1) and p53 in the exosome isolate. Partial sequencing of p53 amplicon was conducted to determine mutation type of p53.RESULTS: There were 8 patients enrolled in this study. According to RT-PCR results, the expression levels of LMP-1 and p53 varied in the NPC-Exo isolate. Based on sequencing analysis, 1 case of p53 mutation was noticeable.CONCLUSION: According to current results, the NPC-derived exosome potentially carries not only wild type but also mutant type p53. Further research is needed to explore deeper the effect of the mutant type p53 as an exosome carrier in the clinical application.KEYWORDS: Nasopharyngeal cancer, exosome, p53, mutation

STMO-6 Impact of the extent of resection on the survival of patients with lower grade gliomas using awake brain mapping

Purpose: The aim of this study was to assess the effect of the extent of resection (EOR) of tumors on survival in a series of patients with lower-grade gliomas (LGGs) who underwent awake brain mapping. Methods: We retrospectively analyzed 126 patients with LGGs in the dominant and non-dominant hemisphere who underwent awake brain surgery at the same institution between December 2012 and May 2020. Results: The median progression-free survival (PFS) rate of patients with LGGs in the group with an EOR >100 %, including supratotal resection (n = 47; median survival [MS], not reached), was significantly higher than that in the group with an EOR <100% (n = 79; MS, 43.1 months; 95% CI: 37.8–48.4 months; p = 0.04). In patients with diffuse astrocytomas and anaplastic astrocytomas, the group with EOR >100 %, including supratotal resection (n = 25; MS, not reached), demonstrated a significantly better PFS rate than did the group with an EOR <100% (n = 45; MS, 35.8 months; 95% CI: 19.9–51.6 months; p = 0.03). Supratotal or gross total resection was correlated with better PFS in IDH-mutant type of diffuse astrocytomas and anaplastic astrocytomas (n = 19; MS, not reached vs. n = 35; MS, 40.6 months; 95% CI: 22.3–59.0 months; p = 0.02). By contrast, supratotal or gross total resection was not associated with longer PFS rates in patients with IDH-wild type of diffuse astrocytomas and anaplastic astrocytomas. Conclusions: It is noteworthy that supratotal or gross total resection significantly correlated with better PFS in IDH-mutant type of WHO grade II and III astrocytic tumors. In light of our finding that EOR did not correlate with PFS in patients with aggressive IDH-wild type of diffuse astrocytomas and anaplastic astrocytomas, we suggest treatments that are more intensive will be needed for the control of these tumors.

A 3D-Printed Microfluidic Device for qPCR Detection of Macrolide-Resistant Mutations of Mycoplasma pneumoniae

Mycoplasma pneumonia (MP) is a common respiratory infection generally treated with macrolides, but resistance mutations against macrolides are often detected in mycoplasma pneumoniae in China. Rapid and accurate identification of mycoplasma pneumoniae and its mutant type is necessary for precise medication. This paper presents a 3D-printed microfluidic device to achieve this. By 3D printing, the stereoscopic structures such as microvalves, reservoirs, drainage tubes, and connectors were fabricated in one step. The device integrated commercial polymerase chain reaction (PCR) tubes as PCR chambers. The detection was a sample-to-answer procedure. First, the sample, a PCR mix, and mineral oil were respectively added to the reservoirs on the device. Next, the device automatically mixed the sample with the PCR mix and evenly dispensed the mixed solution and mineral oil into the PCR chambers, which were preloaded with the specified primers and probes. Subsequently, quantitative real-time PCR (qPCR) was carried out with the homemade instrument. Within 80 min, mycoplasma pneumoniae and its mutation type in the clinical samples were determined, which was verified by DNA sequencing. The easy-to-make and easy-to-use device provides a rapid and integrated detection approach for pathogens and antibiotic resistance mutations, which is urgently needed on the infection scene and in hospital emergency departments.

Chlorophyll biosynthesis and transcriptome profiles of chlorophyll b-deficient type 2b rice (Oryza sativa L.)

Photosynthetic and transcriptomic characteristics of a chlorophyll (Chl) b-deficient mutant type 2b rice (ch14) were investigated in this study. The ultrastructure of chloroplast in ch14 demonstrated irregular chloroplast enhancement (loss of starch granules, indistinct membranes, and thinner grana). Ch14 had significantly lower carotenoid, Chl a, Chl b, and total Chl contents, but a higher ratio of Chl a to Chl b than a wide-type rice. 3,594 genes were differentially expressed in ch14, among which 309 transcription factors were related to Chl degradation and biosynthesis, chloroplast formations, and the photosynthesis capacity. PsbR, GSA-AT, PBGD, PPOX, MgMT, and POR genes were down-regulated, reducing Chl content and photosynthetic capacity in the ch14. This study suggests that Chl degradation may be attributed to abnormal chloroplast development and down-regulation of gene expression in the common pathway and Mg branch and the rise in Chl a to Chl b ratio may be involved in the alternative Chl b degradation pathway.

Concurrent Metformin Use and Survival Among Finnish Non-Small Cell Lung Cancer Patients Treated With EGFR TKIs

Purpose Many studies have shown correlation between metformin use and lower incidence and improved outcomes of lung cancer. We investigated the potential association between metformin use and survival among Finnish non-small cell lung cancer (NSCLC) patients treated with EGFR TKIs. Methods Nationwide registries were utilized to identify all the patients with use of EGFR TKIs in NSCLC between 2011–2016, and 1242 patients were included in further analyses. Data related to cancer, survival, and drug purchases were combined with personal identity codes. Concurrent use of diabetes medications was defined as their purchase +/-120 days from the first purchase of EGFR TKI. The impact of diabetes medication use was investigated separately in the whole and in the EGFR mutant type cohort (n = 481). Results Concurrent metformin use was found in 10 % (n = 124) and use of other diabetes medication in 5 % (n = 60) of the patients. In the whole patient cohort, metformin use did not associate with survival but in the EGFR mutant type cohort a non-significant trend for higher mortality was found (HR 1.42, 95% CI 0.99–2.02). Metformin use associated also with a shorter EGFR TKI treatment duration (HR 1.26, 95 % CI 1.04–1.52). The use of other diabetes medication than metformin did not associate with survival or EGFR TKI treatment duration. Conclusion Concomitant metformin use associated with a shorter EGFR TKI treatment duration, however, no statistically significant correlation with survival was found. Ethnicity, comorbidities, and metformin dosage may influence on the associations found between metformin use and EGFR TKI treatment responses.

Cell-based and cell-free firefly luciferase complementation assay to quantify Human Immunodeficiency Virus type 1 Rev-Rev interaction

Rev is an essential regulatory protein of Human Immunodeficiency Virus type 1 (HIV) that is found in the nucleus of infected cells. Rev multimerizes on the Rev-response element (RRE) of HIV RNA to facilitate the export of intron-containing HIV mRNAs from the nucleus to the cytoplasm, and, as such, HIV cannot replicate in the absence of Rev. We have developed cell-intact and cell-free assays based upon a robust firefly split-luciferase complementation system, both of which quantify Rev-Rev interaction. Using the cell-based system we show that additional Crm1 did not impact the interaction whereas excess Rev reduced it. Furthermore, when a series of mutant Revs were tested, there was a strong correlation between the results of the cell-based assay and the results of a functional Rev trans-complementation infectivity assay. Of interest, a camelid nanobody (NB) that was known to inhibit Rev function enhanced Rev-Rev interaction in the cell-based system. We observed a similar increase in Rev-Rev interaction in a cell-free system, when cell lysates expressing NLUC-Rev or CLUC-Rev were simply mixed. In the cell-free system Rev-Rev interaction occurred within minutes and was inhibited by excess Rev. The levels of interaction between the mutant Revs tested varied by mutant type. Treatment of Rev lysates with RNAse minimally reduced the degree of interaction whereas addition of HIV RRE RNA enhanced the interaction. Purified GST-Rev protein inhibited the interaction. The Z-factor (Z') for the cell-free system was ~0.85 when tested in 96-well format, and anti-Rev NB enhanced the interaction in the cell-free system. Thus, we have developed both cell-intact and cell-free systems that can reliably, rapidly, and reproducibly quantify Rev-Rev interaction. These assays, particularly the cell-free one, may be useful in screening and identifying compounds that inhibit Rev function on a high throughput basis.

Heterozygous FMN2 Missense Variant Found in A Family Case of Premature Ovarian Insufficiency

Background Premature Ovarian Insufficiency plagues 1% of women under 40, while quite a few remain an unknown cause. The development of sequencing has helped find pathogenic genes and reveal the relationship between DNA repair and ovarian reserve. Through the exome sequencing, our study targets screening out the possible POI pathogenic gene and variants in a Chinese family and 20 sporadic POI patients, preliminarily exploring the functional impact and finding out potential linkages between the gene and POI. Results The whole exome sequencing suggested a novel FMN2 heterozygous variant c.1949C > T (p.Ser650Leu) carried by all three patients in a Chinese family and another c.1967G > A(p.Arg656His) variant in a sporadic case. Since no FMN2 missense mutation is reported for causing human POI, we preliminarily assessed p.Ser650Leu variant via cross-species alignment and 3D modeling and found it possibly deleterious. A series of functional evidence was consistent with our hypothesis. We proved the expression of FMN2 in different stages of oocytes and observed a statistical difference of chromosomal breakages between the POI patient carrying p.Arg656His variant and the health control (p = 0.0013). Western Blot also suggested a decrease in FMN2 and P21 in the mutant type and an associated increase in H2AX. The p.Arg656His variant with an extremely low frequency also indicated that the gene FMN2 might play an essential role in the genetic etiology of POI. To the best of our knowledge, this is the first POI report on missense variants of FMN2. Conclusion This finding indicates a novel gene possibly related to POI and sheds lights on the study of FMN2.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Outcomes of 27 Non-Small Cell Lung Cancer Patients Receiving Resections of Paired Primary Pulmonary and Brain Metastatic Tumours: Is EGFR Negative Mutation of Brain Metastasis Bring More Benefit?

Background: To analyze the heterogeneity and clinical outcomes of epidermal growth factor receptor (EGFR) gene mutation in primary tumour and corresponding brain metastasis(BM) in non-small cell lung cancer (NSCLC).Methods: Primary pulmonary tumours and paired metastatic brain tumours were surgically removed from twenty-seven NSCLC patients from July 1999 to November 2013 in our hospital. All brain lesions were confirmed as metastases stemming from NSCLC by pathological examination. EGFR gene (exons 18-21) mutant status was detected in matched tumour by using amplification refraction mutation system (ARMS). If inconsistency was detected, the paired tumour was evaluated again. The McNemar test was performed to compare the consistency of the paired tumour, and the Kappa test was used to quantify the agreement of both methods.Progression free survival(PFS) and overall survival(OS) were exhibited by the Kaplan-Meier.Results: In this study, of the 27 patients, nine (33.3%) cases were found to have EGFR mutations in BMs, and ten (37.0%) patients were detected positive EGFR status in primary lung tumour tissue. The rate of consistency of the matched tumour was 24/27 (88.9%, P≤0.001), and the Kappa coefficient was 0.757. Among the three cases presenting EGFR mutational heterogeneity, two patients harbored EGFR mutation in primary tumors but was negative in BMs, meanwhile, the other patient had the opposite pattern. Comparing to patients with consistent EGFR mutations(both mutant or wild),patients with inconsistent EGFR mutations tended to have better outcomes, including PFS(37.2months vs 25.0months vs 16.5months,P=0.159) and OS(53.6months vs 27.5months vs 26.8months,P=0.380), further analysis showed that two patients whose EGFR mutant-type primary tumor progressing to wild-type cerebral metastastic tumor might have longer overall survival(53.6months,37.8months) than one patient harboring reverse mutant difference(EGFR wild-type primary tumor progressing to mutant-type brain metastastic tumor) (16.7months). Also we found that patients with wild type in brain metastatic tumour had longer overall survival (OS)(mOS, 36.3 months vs 29.1months, P = 0.944).Conclusions: EGFR mutation status in NSCLC patients between primary lung tumour and paired BM was heterogeneous, patients harbored wild type EGFR mutation in BM might have better outcomes, especially for positive status transferred to wild.