Associations between Lactoferrin (LTF) gene polymorphism exon 4 and milk compositions in Senduro goat

This research aimed to analyze the polymorphism of Lactoferrin (LTF) gene exon 4 associated with milk compositions in Senduro goats. A total of 42 DNA samples and milk compositions from Senduro goats were used in this study. The DNA sequence was amplified using Polymerase Chain Reaction (PCR) with a pair of primers. Genotyping was carried out using DNA sequencing and analyzed using FinchTV 1.4.0 and MEGA 6.0. In this research, the results showed that there were three genotypes (CC, CT, and TT) and two alleles (C and T). The frequencies of CC, CT, and TT genotypes were 0.381; 0.452; and 0.167, respectively. Furthermore, the frequencies of C and T alleles were 0.607 and 0.393, respectively. The genotype polymorphism did not affect on milk compositions. In conclusion, there was no association between polymorphism of LTF gene exon 4 and milk compositions in Senduro goats.

Mutations of p53 gene in canine sweat gland carcinomas probably associated with UV radiation

Introduction Apocrine sweat gland carcinomas (ASGCs) are rare malignant skin tumours in dogs and humans. The literature published so far focuses mostly on the clinico-epidemiological aspect of these tumours, but little is known about their pathogenesis. In this study we aimed to determine whether the p53 gene is involved in the carcinogenesis of the apocrine sweat gland in dogs and whether ultraviolet radiation (UV) is related to it. Material and Methods Forty canine ASGCs were submitted to laser capture microdissection to isolate neoplastic cells, from which DNA was subsequently extracted. PCR amplification and sequencing of p53 exons 2–8 was then performed, followed by computer analysis of the obtained sequences. Results Sixteen mutations within the p53 gene were found in 13 tumours. The mutations involved C → T, T → C, G → A, and CC → TT transitions, C → G transversion and adenine deletion, which are gene alteration types known to be related to UV radiation in the process of skin carcinogenesis in humans. Six of the thirteen tumour cases displayed the C → T transitions in the same location in exon 4 and three of the thirteen cases displayed T → C in the same location in exon 5. Conclusion The results of the present study indicate both the participation of the p53 gene and the influence of UV radiation in the formation of ASGCs in dogs.

Preclinical Activity of the Clinical Stage Protein Arginine Methyltransferase 5 (PRMT5) Inhibitor PRT543 in Splicing Mutant Myelodysplastic Syndrome (MDS) and Acute Myeloid Leukemia (AML)

MDS and AML are generally incurable malignancies that need newer therapeutic options, as the disease-initiating stem cells are not eliminated by conventional therapies. Splicing factor mutations account for approximately 50% of mutations in MDS. Among those are SF3B1 and U2AF1 mutations, which are related to pathogenesis of disease by overactivation of oncogenic pathways, such as Interleukin-1 Receptor-Associated Kinase 4 (IRAK4) signaling. Via activation of IRAK4 and other pathways, spliceosome mutations can lead to a block in differentiation and malignant proliferation. PRMT5 is an enzyme involved in spliceosome complex formation and fidelity and is over-expressed in patients with MDS/AML. The inhibition of PRMT5 may contribute to stem/progenitor cell differentiation rather than aberrant proliferation in an undifferentiated immature state. The objective of this study is to determine the activity of a clinical stage PRMT5 inhibitor, PRT543, in subtypes of MDS/AML using cell lines and primary samples. In preclinical studies PRT543 showed broad antitumor activity in vitro and in vivo (Bhagwat AACR 2020) and is currently under investigation in a Phase I clinical trial in patients with myeloid malignancies. We used a K562 cell line with CRISPR-introduced SF3B1 K700E mutation and isogenic control (K700K) in proliferation and myeloid differentiation assays with PRT543. The SF3B1 K700E mutant cells showed myeloid differentiation after treatment with the PRT543 PRMT5 inhibitor, as assessed by single cell colony assays and flow cytometry, while no substantial effects were observed in controls (K700K). We next evaluated PRMT5 expression in a large set of MDS CD34+ cells and observed substantial overexpression in SF3B1 mutant samples. Primary MDS/AML progenitors were cultured in methylcellulose colony forming unit (CFU) assays and treated with PRT543 at multiple concentrations versus vehicle controls. A majority of the SF3B1 patient samples showed a substantial increase in erythroid differentiation as assessed by colony formation and flow cytometry in the presence of 1nM and 5nM PRT543. In non-SF3B1 mutated patient samples, there was no clear difference in differentiation in the presence of PRT543. We next evaluated whether PRMT5 inhibition led to inhibition of oncogenic IRAK4 pathways. Retention of exon 4 of IRAK4 occurs in splicing mutant MDS and leads to production of an active long IRAK4 isoform. As measured by RNA-seq, PRMT5 inhibition led to decreased retention of exon 4 in IRAK4 transcripts. This decrease in the IRAK4 long form in response to PRT543 treatment was confirmed by immunoblotting, demonstrating reduction of this oncogenic signaling pathway. In summary, PRMT5 inhibition with PRT543 can release a differentiation block in MDS/AML, specifically in splicing mutant samples. PRMT5 inhibition decreases IRAK4-long isoform expression providing a potential mechanism for its activity in splicing factor mutant cases. Disclosures Ruggeri: Prelude Therapeutics: Current Employment, Current equity holder in publicly-traded company. Heiser: Prelude Therapeutics: Current Employment, Current equity holder in publicly-traded company. Scherle: Prelude Therapeutics: Current Employment, Current equity holder in publicly-traded company. Starczynowski: kurome Inc: Consultancy. Verma: Throws Exception: Current equity holder in publicly-traded company; Stelexis: Current equity holder in publicly-traded company; Celgene: Consultancy; Acceleron: Consultancy; Novartis: Consultancy; Stelexis: Consultancy, Current equity holder in publicly-traded company; Eli Lilly: Research Funding; Curis: Research Funding; Medpacto: Research Funding; Incyte: Research Funding; GSK: Research Funding; BMS: Research Funding.

Case Report: Prenatal Diagnosis for a Rett Syndrome Family Caused by a Novel MECP2 Deletion With Heteroduplexes of PCR Product

Rett syndrome is an X-linked dominant, postnatal neurological disorder. Approximately 80–90% of classic Rett syndrome patients harbor mutations in the coding region of MECP2. Somatic or germline MECP2 mosaicism is not rare, and paternal germline MECP2 mosaicism occurs in especially high proportions. Here, we report the case of a Chinese girl with Rett syndrome in whom a heterozygous deletion was found in exon 4 of MECP2 using multiplex ligation-dependent probe amplification. To obtain an accurate region of deletion, we narrowed down the deletion region using real-time quantitative PCR, and subsequent long-range PCR was performed to detect the deletion breakpoints. Surprisingly, three DNA bands from long-range PCR products were observed after gel electrophoresis. To exclude somatic mosaicism, we performed T-A cloning and DNA sequencing, the middle DNA band was proved to be a heteroduplex of the PCR product in vitro. Meanwhile, a prenatal diagnosis was performed for the pregnant mother of the patient. Our study showed that the patient was heterozygous for the deletion of 713-base pairs in exon 4 of MECP2 (MECP2: c.441_1153del713), resulting in a frameshift and premature termination of the 487 amino acid protein at the 154th codon. In summary, we reported a novel heterozygous deletion in the MECP2 gene with heteroduplexes of the PCR product in vitro, which can help in the genetic counseling and prenatal diagnosis of disorders of MECP2 defects.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Haplotype Variations and Evolutionary Analysis of the Granule-Bound Starch Synthase I Gene in the Korean World Rice Collection

Granule-bound starch synthase I (GBSSI) is responsible for Waxy gene encoding the, which is involved in the amylose synthesis step of starch biosynthesis. We investigated the genotypic and haplotypic variations of GBSSI (Os06g0133000) gene, including its evolutionary relatedness in the nucleotide sequence level using single-nucleotide polymorphisms (SNPs), indels, and structural variations (SVs) from 475 Korean World Rice Collection (KRICE_CORE), which comprised 54 wild rice and 421 cultivated represented by 6 ecotypes (temperate japonica, indica, tropical japonica, aus, aromatic, and admixture) or in another way by 3 varietal types (landrace, weedy, and bred). The results revealed that 27 of 59 haplotypes indicated a total of 12 functional SNPs (fSNPs), identifying 9 novel fSNPs. According to the identified novel fSNPs, we classified the entire rice collection into three groups: cultivated, wild, and mixed (cultivated and wild) rice. Five novel fSNPs were localized in wild rice: four G/A fSNPs in exons 2, 9, and 12 and one T/C fSNP in exon 13. We also identified the three previously reported fSNPs, namely, a G/A fSNP (exon 4), an A/C fSNP (exon 6), and a C/T fSNP (exon 10), which were observed only in cultivated rice, whereas an A/G fSNP (exon 4) was observed exclusively in wild rice. All-against-all comparison of four varietal types or six ecotypes of cultivated rice with wild rice showed that the GBSSI diversity was higher only in wild rice (π = 0.0056). The diversity reduction in cultivated rice can be useful to encompass the origin of this gene GBSSI during its evolution. Significant deviations of positive (wild and indica under balancing selection) and negative (temperate and tropical japonica under purifying selection) Tajima's D values from a neutral model can be informative about the selective sweeps of GBSSI genome insights. Despite the estimation of the differences in population structure and principal component analysis (PCA) between wild and subdivided cultivated subgroups, an inbreeding effect was quantified by FST statistic, signifying the genetic relatedness of GBSSI. Our findings of a novel wild fSNPS can be applicable for future breeding of waxy rice varieties. Furthermore, the signatures of selective sweep can also be of informative into further deeper insights during domestication.

In Silico identification of a common mobile element insertion in exon 4 of RP1

Mobile element insertions (MEIs) typically exceed the read lengths of short-read sequencing technologies and are therefore frequently missed. Recently, a founder Alu insertion in exon 4 of RP1 has been detected in Japanese patients with macular dystrophy by PCR and gel electrophoresis. We aimed to develop a grep search program for the detection of the Alu insertion in exon 4 of RP1 using unprocessed short reads. Among 494 unrelated Korean patients with inherited eye diseases, 273 patients with specific retinal phenotypes who were previously genotyped by targeted panel or whole exome sequencing were selected. Five probands had a single heterozygous truncating RP1 variant, and one of their unaffected parents also carry this variant. To find a hidden genetic variant, whole genome sequencing was performed in two patients, and it revealed AluY c.4052_4053ins328/p.(Tyr1352Alafs*9) insertion in RP1 exon 4. This AluY insertion was additionally identified in other 3 families, which was confirmed by PCR and gel electrophoresis. We developed simplified grep search program to detect this AluY insertion in RP1 exon 4. The simple grep search revealed a median variant allele frequency of 0.282 (interquartile range, 0.232–0.383), with no false-positive results using 120 control samples. The MEI in RP1 exon 4 was a common founder mutation in Korean, occurring in 1.8% of our cohort. The RP1-Alu grep program efficiently detected the AluY insertion, without the preprocessing of raw data or complex installation processes.