Double heterozygous familial hypercholesterolaemia: Case series, genetics and Cascade screening of families

Background: Familial hypercholesterolemia (FH) is an autosomal dominant disorder of lipoprotein metabolism characterized by high levels of LDL-cholesterol (LDL-C) in the blood. Studies identified more than 1,000 mutations of the LDLR gene in FH patients with incidence rates between 1: 500 and 1: 300. The mutation that occurs primarily in: LDLR, apoB, PCSK9, LDLRAP1 genes, 80% of which were detected the LDLR gene mutation. Nowaday, FH disease has not been paid much attention, leading to a delay in treatment. Objectives: identify mutations in other family members of the patient FH. Subjects and Methods: 14 family members of FH patients were gene analyzed, identified mutations on exons 4, 9 LDLR genes. Results: 11/15 family members carrying heterozygous mutations on exon 4 and exon 9 of LDLR gene. Patient and 1 family member detected and treated late, leading to complications of myocardial infarction. Conclusion: Therefore, Cascade screening of patient's family members has an important role in early detection, genetic counseling and treatment, even in cases where pedigree members do not have xanthomas and no increase or slight increase in blood lipids. This is the basis for early counseling and treatment for members with mutations, reducing the risk of coronary artery diseases in the future.

Niemann–Pick type C disease with a novel intronic mutation: three Turkish cases from the same family

Objectives Niemann–Pick type C (NPC) disease is a rare progressive neurodegenerative condition that is characterized by the accumulation of cholesterol, glycosphingolipids, and sphingosine in lysosomes. Patients have various systemic and neurological findings depending on their age at onset. This disease is caused by the autosomal recessive transmission of mutations in the NPC1 and NPC2 genes; patients have mutations mainly in the NPC1 gene (95%) and the majority of them are point mutations located in the exonic regions. Case presentation Here, we presented three cousins with hepatosplenomegaly and progressive neurodegeneration who were diagnosed with visceral-neurodegenerative NPC disease. Their parents were relatives, and they had a history of sibling death with similar complaints. Bone marrow smear showed foamy cells in patient 1. Vertical supranuclear gaze palsy was not present in all cases. Sphingomyelinase (SM) activities were almost normal to exclude NPA or NPB. Filipin staining was performed in patient 2 and showed a massive accumulation of unesterified cholesterol The NPC1 gene analysis of the three patients showed a novel homozygous c.1553+5G>A intronic mutation. cDNA analysis was performed from the patient 3 and both parents. It was observed that exon 9 was completely skipped in the homozygous mutant baby. Both the normal and the exon 9-skipped transcripts have been detected in the parents. Conclusions When combined with the filipin staining and the patients’ clinical outcomes, this mutation is likely to be deleterious. Moreover, cDNA sequencing supports the pathogenicity of this novel variant.

Implication of ARID1A Undercurrents and PDL1, TP53 Overexpression in Advanced Gastric Cancer

AT-rich interactive domain-containing protein 1A (ARID1A), TP53 and programmed cell death-ligand 1 (PDL1) are involved in several protein interactions that regulate the expression of various cancer-related genes involved in the progression of the cell cycle, cell proliferation, DNA repair, and apoptosis. In addition, gene expression analysis identified some common downstream targets of ARID1A and TP53. It has been established that tumors formed by ARID1A-deficient cancer cells exhibited elevated PDL1 expression. However, the aberrations in these molecules have not been studied in this population especially in Gastric Cancer (GC). In this backdrop we aimed to investigate the role of the ARID1A mutation and expression of ARID1A, TP53 and PDL1 genes in the etiopathogenesis of Gastric Cancer (GC) in the ethnic Kashmiri population (North India). The study included 103 histologically confirmed GC cases. The mutations, if any, in exon-9 of ARID1A gene was analysed by Polymerase Chain Reaction (PCR) followed by Sanger sequencing. The mRNA expression of the ARID1A, TP53 and PDL1 genes was analysed by Quantitative real time-PCR (qRT-PCR). We identified a nonsense mutation (c.3219; C > T) in exon-9 among two GC patients (∼2.0%), which introduces a premature stop codon at protein position 1073. The mRNA expression of the ARID1A, TP53 and PDL1 gene was significantly reduced in 25.3% and elevated in 47.6 and 39.8% of GC cases respectively with a mean fold change of 0.63, 2.93 and 2.43. The data revealed that reduced mRNA expression of ARID1A and elevated mRNA expression of TP53 and PDL1 was significantly associated with the high-grade and advanced stage of cancer. Our study proposes that ARAD1A under-expression and overexpression of TP53 and PDL1 might be crucial for tumor progression with TP53 and PDL1 acting synergistically.

Case Report: Identification of Polygenic Mutations by Exome Sequencing

The discovery of rare genetic variation through different gene sequencing methods is a very challenging subject in the field of human genetics. A case of a 1-year-old boy with metabolic acidosis and hypokalemia, a small penis, growth retardation, and G-6PD deficiency was reported. Since the clinical symptoms are complex and seem uncorrelated, the authors hypothesized that the child had chromosome or gene problems, and exome sequencing (ES) was applied to samples from him and his parents. Three main locus mutations in three genes were found in the proband, including SLC4A1, FGFR1, and G6PD genes. A missense mutation (c.1766G>T, p.R589 L) was found in exon 14 of SLC4A1 gene, which was a de novo mutation. Another missense mutation (c.1028 A>G, p.H343R) was found in exon 9 of FGFR1 gene, which was also a de novo mutation. These findings further demonstrate the utility of ES in the diagnosis of rare diseases.

Waardenburg syndrome type 2A in a large Iranian family with a novel MITF gene mutation

Background The characteristics of Waardenburg syndrome (WS) as a scarce heritable disorder are sensorineural hearing loss and deficits of pigmentation in the skin, hair, and eye. Here, clinical features and detection of the mutation in the MITF gene of WS2 patients are reported in a sizable Iranian family. Methods A man aged 28-years represented with symptoms of mild unilateral hearing loss (right ear), complete heterochromia iridis, premature graying prior to 30 years of age, and synophrys. In this research, there was a sizable family in Iran comprising three generations with seven WS patients and two healthy members. Whole exome sequencing was applied for proband for the identification of the candidate genetic mutations associated with the disease. The detected mutation in proband and investigated family members was validated by PCR-Sanger sequencing. Results A novel heterozygous mutation, NM_198159.3:c.1026dup p.(Asn343Glufs*27), in exon 9 of the MITF gene co-segregated with WS2 in the affected family members. The variant was forecasted as a disease-causing variant by the Mutation Taster. According to the UniProt database, this variant has been located in basic helix-loop-helix (bHLH) domain of the protein with critical role in DNA binding. Conclusions A frameshift was caused by a nucleotide insertion, c.1026dup, in exon 9 of the MITF gene. This mutation is able to induce an early termination, resulting in forming a truncated protein capable of affecting the normal function of the MITF protein. Helpful information is provided through an exactly described mutations involved in WS to clarify the molecular cause of clinical characteristics of WS and have a contribution to better genetic counseling of WS patients.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Mutational Analysis of EXT1in a Chinese Family Affected by Hereditary Multiple Osteochondroma

Objectives. To discuss the mutational features and their relationships with disease in a family with hereditary multiple osteochondroma (HMO) from Guangxi Province (GXBB-1 family), China. Methods. Genomic DNA and total mRNA were extracted from peripheral blood cells of GXBB-1 family members. Whole elements of the EXT1gene and its transcript, including exons, introns, exon-intron boundaries, and coding sequence (CDS) clones, were amplified and sequenced. Allele-specific PCR was used to confirm the position and type of mutation. Results. All patients from the GXBB-1 family harbored the cosegregating heterozygous c.1056+1G>A mutation located in EXT1at an exon-intron boundary. Another three single-nucleotide polymorphisms (SNPs) were also detected in the patients, including IVS2+1G>A in intron 2, c.1844 T>C [p.Pro (CCT) 614Pro (CCC)] in exon 3, and c.2534G>A [p.Glu (GAG) 844Glu (GAA)] in exon 9. The latter two SNPs were synonymous variations. Conclusions. The heterozygous c.1056+1G>A mutation cosegregated with the phenotype, indicating that it is a pathogenic mutation in the GXBB-1 family. This mutation is reported for the first time in Chinese HMO patients. IVS2+1G>A and c.2534G>A have no relationship with the occurrence of disease. However, c.1844 T>C and c.1056+1G>A are linked, and their interaction needs to be further studied. c.1844T>C is a new SNP that has not been reported internationally.

Unraveling the Connections between Calreticulin and Myeloproliferative Neoplasms via Calcium Signalling

Mutations in the form of insertions and deletions (INDEL) in the calreticulin gene lead to essential thrombocythemia which is characterized by the formation of thrombosis. However, the connection between calreticulin INDEL and essential thrombocythemia remains largely elusive. Through combined molecular dynamics simulation and in-vitro studies on the wild type and mutated isoforms of calreticulin, the mechanism underlying the calreticulin INDEL induced essential thrombocythemia was investigated at the molecular level. Our results demonstrate that mutations in exon-9 could lead to significant conformational variations of calreticulin structure and thereby reducing its interaction with calcium ions due to decreased electrostatic contributions. The consequence of mutations on calreticulins structural integrity was revealed by identifying the key residues and their roles in calcium binding. Furthermore, mutations implemented by CRISPR-Cas9 in exon-9 showed diminished calcium signaling in HEK-293T cells, which agree well with our in-silico findings. The current study might help in understanding of the interactions between calreticulin exon-9 INDEL and calcium ions mediated by the structural variations of calreticulin. The results provide useful information for designing novel therapeutic approaches targeting essential thrombocythemia.