Can an Investigation of a Single Gene be Effective in Differentiating Certain Features of the Bipolar Disorder Profile?

Bipolar disorder (BD) is amongst the most common heritable mental disorders, but the clarification of its genetic roots has proven to be very challenging. Many single nucleotide polymorphisms (SNPs) have been identified to be associated with BD. SNPs in the CACNA1C gene have emerged as the most significantly associated with the disease. The aim of the present study is to provide a concise description of SNP 1006737 variants identified by Real Time PCR and confirm sequencing analysis with the Sanger method in order to estimate the association with BD. The molecular method was tested on 47 Sardinian subjects of whom 23 were found to not be mutated, 1 was found to be a carrier of the homozygous A allele and 23 were found to be carriers of the heterozygous G allele. Moreover, the positive results of the preliminary application suggest that the development of the screener could be extended to the other 5 genetic variables identified as associated with BD.

Ecological surveillance of bat coronaviruses in Sarawak, Malaysian Borneo

Objective Coronaviruses (CoVs) are natural commensals of bats. Two subgenera, namely Sarbecoviruses and Merbecoviruses have a high zoonotic potential and have been associated with three separate spillover events in the past 2 decades, making surveillance of bat-CoVs crucial for the prevention of the next epidemic. The study was aimed to elucidate the presence of coronavirus in fresh bat guano sampled from Wind Cave Nature Reserve (WCNR) in Sarawak, Malaysian Borneo. Samples collected were placed into viral transport medium, transported on ice within the collection day, and preserved at − 80 °C. Nucleic acid was extracted using the column method and screened using consensus PCR primers targeting the RNA-dependent RNA polymerase (RdRp) gene. Amplicons were sequenced bidirectionally using the Sanger method. Phylogenetic tree with maximum-likelihood bootstrap and Bayesian posterior probability were constructed. Results CoV-RNA was detected in ten specimens (47.6%, n = 21). Six alphacoronavirus and four betacoronaviruses were identified. The bat-CoVs can be phylogenetically grouped into four novel clades which are closely related to Decacovirus-1 and Decacovirus-2, Sarbecovirus, and an unclassified CoV. CoVs lineages unique to the Island of Borneo were discovered in Sarawak, Malaysia, with one of them closely related to Sarbecovirus. All of them are distant from currently known human coronaviruses.

Using DNA testing for the precise, definite, and low-cost diagnosis of sickle cell disease and other Haemoglobinopathies: findings from Tanzania

Background Sickle cell disease (SCD) is an important cause of under-five mortality. Tanzania is the 5th country in the world with the highest births prevalence of SCD individuals. Significant advances in the neonatal diagnosis of SCD using rapid point-of-care testing have been made. However genetic confirmation is still required for positive cases, in uncertain cases, in multiply transfused patients, to resolve compound heterozygosity (Hb S/ β0 Thal or Hb S/ β+ thal) not uncommon in the coastal regions of East Africa and increasingly also for pre-marital counselling and potentially for future curative approaches such as gene therapy. The currently available DNA tests are prohibitively expensive. Here, we describe an easy-to-use, affordable and accurate β-globin sequencing approach that can be easily integrated within existing NBS for SCD and other haemoglobinopathies especially in Low- and Middle-income Countries. Aim To evaluate an affordable DNA technology for the diagnosis of Sickle cell disease and other haemoglobinopathies in a resource-limited setting. Methods Laboratory-based validation study was conducted by Muhimbili University of Health and Allied Sciences and the University of Oxford involving sequencing of the entire β -haemoglobin locus using the Oxford Nanopore MinION platform. A total number of 36 Dried blood spots and whole blood samples were subjected to conventional protein-based methods (isoelectric focusing, HPLC), and/or sequenced by the Sanger method as comparators. Results Sequencing results for SCD using the MinION were 100% concordant with those from the Sanger method. In addition, the long-read DNA sequencing method enabled the resolution of cases with unusual phenotypes which make up 1% of all children in Tanzania. The cost is £11/ sample for consumables, which is cheaper compared to other sequencing platforms. Conclusions This is the first report of a comprehensive single DNA assay as a definitive diagnostic test for SCD and other haemoglobinopathies. The test is fast, precise, accurate and affordable.

Refinement of microbiota analysis of specimens from patients with respiratory infections using next-generation sequencing

Next-generation sequencing (NGS) technologies have been applied in bacterial flora analysis. However, there is no standardized protocol, and the optimal clustering threshold for estimating bacterial species in respiratory infection specimens is unknown. This study was conducted to investigate the optimal threshold for clustering 16S ribosomal RNA gene sequences into operational taxonomic units (OTUs) by comparing the results of NGS technology with those of the Sanger method, which has a higher accuracy of sequence per single read than NGS technology. This study included 45 patients with pneumonia with aspiration risks and 35 patients with lung abscess. Compared to Sanger method, the concordance rates of NGS technology (clustered at 100%, 99%, and 97% homology) with the predominant phylotype were 78.8%, 71.3%, and 65.0%, respectively. With respect to the specimens dominated by the Streptococcus mitis group, containing several important causative agents of pneumonia, Bray Curtis dissimilarity revealed that the OTUs obtained at 100% clustering threshold (versus those obtained at 99% and 97% thresholds; medians of 0.35, 0.69, and 0.71, respectively) were more similar to those obtained by the Sanger method, with statistical significance (p < 0.05). Clustering with 100% sequence identity is necessary when analyzing the microbiota of respiratory infections using NGS technology.

A Simple Method for Assessing Diversity and Dynamics of Microbial Community: Comparison of Dairy Phages from Industrial and Spontaneous Fermentation

Background: The dairy industry heavily relies on fermentation processes driven in high proportion by Lactococcus lactis. The fermentation process can be perturbed or even stopped by bacteriophage activity, leading to complete loss of fermentation batch or decreased quality product. The monitoring of the phage diversity and dynamics in the process allows implementing protective measures (e.g., starter rotation) to maintain unperturbed production. Methods: Universal primers were used to amplify sequences of the 936, c2, and P335 Lactococcus phage types. The amplicons were sequenced with the Sanger method and obtained degenerate sequences were analyzed using a simple bioinformatic pipeline in the R environment. Results: The most prevalent phage type is 936, followed by P335, whereas the c2 type is less frequent. Conclusions: Curd cheeses prepared on non-pasteurized milk based on native milk microbiota had a higher diversity of phages distinct from those found in dairy plants. Sanger sequencing of heterogenous amplicons generated on metagenome DNA can be used to assess low-complexity microbiota diversity.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Simple Method for Assessing Diversity and Dynamics of Microbial Community: Comparison of Dairy Phages from Industrial and Spontaneous Fermentation

Background: The dairy industry heavily relies on fermentation processes driven in high proportion by Lactococcus lactis. The fermentation process can be perturbed or even stopped by bacteriophage activity leading to complete loss of fermentation batch or decreased quality product. Monitoring of the phage diversity and dynamics in the process allows to implement protective measures (e.g. starter rotation) in order to maintain unperturbed production.; Methods: Universal primers were used to amplify sequences of the 936, c2, and P335 Lactococcus phage types. The amplicons were sequences with Sanger method and obtained degenerate sequences were analyzed using simple bioinformatic pipeline in R environment.; Results: The most prevalent phage type is 936, followed by P335, whereas c2 type is less frequent.; Conclusions: Curd cheeses prepared on non-pasteurized milk based on native milk microbiota had higher diversity of phages distinct of these found in dairy plants. Sanger sequencing of heterogenous amplicons generated on metagenome DNA can be used to asses low-complexity microbiota diversity.

Comparison of bacterial communities in roots of selected trees with and without summer truffle (Tuber aestivum) ectomycorrhiza

In this study, we examined the effect of the presence of mycorrhiza and ascomata of summer truffle (Tuber aestivum) on the bacterial composition of roots from small trees growing in selected sites of the Nida Basin. Qualitative DNA sequencing methods such as Sanger and next-generation sequencing (NGS) were used. The Sanger method revealed different bacterial species compositions between the samples where summer truffle ascomata was recorded and control samples. Five genera of bacteria could be distinguished: Bacillus, Erwinia, Pseudomonas, Rahnella and Serratia, among which the most numerous were Pseudomonas (Gammmaproteobacteria class) at 32.9%. The results obtained by the NGS method also showed differences in species composition of the bacteria depending on the study sample. Seven genera of bacteria were distinguished: Rhizorhabdus, Methylotenera, Sphingomonas, Nitrosospira, Streptomyces, Methyloceanibacter and Niastella, which dominated in roots from the truffle sites. Telmatobacter, Roseiarcus, Granulicella, Paludibaculum, Acidipila, Acidisphaera and Aliidongia dominated in roots from the control sites. With the NGS method, it is possible to identify the microbiome of a whole root, while only a root fragment can be analysed by the Sanger method. These results extend the scope of knowledge on the preferences of certain groups of bacteria associated with truffles and their influence on the formation of ascomata in summer truffles. Our results may also be useful in selecting and monitoring sites that promote ascomata of Tuber aestivum.

Mitochondrial nicotinamide adenine dinucleotide hydride dehydrogenase (NADH) subunit 4 (MTND4) polymorphisms and their association with male infertility

Purpose The purpose of the present study was to determine the relationship between infertility and the polymorphisms of mitochondrial NADH dehydrogenase subunit 4 (MTND4) by spermatozoa analysis in fertile and subfertile men. Methods Samples were divided into 68 subfertile men (case group) and 44 fertile men (control group). After semen analysis, samples were purified. The whole genome was extracted using a QIAamp DNA Mini Kit and the mitochondrial DNA was amplified by using the REPLI-g Mitochondrial DNA Kit. Polymerase chain reaction (PCR) was used to amplify the MT-ND4 gene. Then, samples were purified and sequenced using the Sanger method. Results Twenty-five single-nucleotide polymorphisms (SNPs) were identified in the MTND4 gene. The genotype frequencies of the study population showed a statistically significant association between rs2853495 G>A (Gly320Gly) and male infertility (P = 0.0351). Similarly, the allele frequency test showed that rs2853495 G>A (Gly320Gly) and rs869096886 A>G (Leu164Leu) were significantly associated with male infertility (adjusted OR = 2.616, 95% CI = 1.374–4.983, P = 0.002; adjusted OR = 2.237, 95% CI = 1.245–4.017, P = 0.007, respectively). Conclusion In conclusion, our findings suggested that male infertility was correlated with rs2853495 and rs869096886 SNPs in MTND4.

First report of tilapia lake virus emergence in fish farms in the department of Córdoba, Colombia

Background and Aim: In 2016, the tilapia-producing farms in the department of Córdoba, Colombia, had witnessed outbreaks of disease with clinical signs compatible with those caused by the tilapia lake virus (TiLV). This study was conducted to confirm the presence of TiLV in some fish farms in the department of Córdoba. Materials and Methods: A descriptive cross-sectional study was conducted in seven farms using a non-random sampling method from July 2016 to December 2017. A total of 66 fish, including 33 healthy fish and 33 fish with clinical signs, were caught, from which 178 tissue samples of spleen, liver, and brain were collected. RNA was extracted from each organ using TRIzol®. cDNA was synthesized using a retrotranscriptase and a universal amplification primer. The polymerase chain reaction was performed using primers specific to TiLV, in which the primers were amplified in a 491 bp region in segment 3 of TiLV, and the amplicons were sequenced using the Sanger method. Results: Of the seven farms surveyed, 3 (42.85%) had TiLV in the collected fish. Of the 66 collected fish, 18 (27.27%) were infected with TiLV. The virus was detected in the brain (64.3%, 18/28), spleen (61.9%, 13/21), and liver (35.7%, 10/28). The sequences were recorded in GenBank with the codes MH338228, MH350845, and MH350846 . Nucleotide homology analyses revealed that this study's circulating strains exhibited 97% identity with the Israeli strain (GenBank KU751816.1). Conclusion: This is the first official report of TiLV in the department of Córdoba, Colombia. The circulating strains detected in this study exhibited 97% identity with the Israeli strain.