Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Download Full-text

Molecular characterization of three enteroviral strains isolated in Kuwait from young children with serious conditions

The Journal of Infection in Developing Countries ◽

10.3855/jidc.9065 ◽

2017 ◽

Vol 11 (08) ◽

pp. 626-639

Author(s):

Wassim Chehadeh ◽

Sanaa Abdulkader Moalim Ali ◽

Syeda Mubeen Maimoona

Keyword(s):

Molecular Characterization ◽

Sequence Divergence ◽

Full Genome Sequencing ◽

Noncoding Regions ◽

Nonsynonymous Substitutions ◽

Coding Regions ◽

Amino Acid Levels ◽

Synonymous And Nonsynonymous Substitutions ◽

Sanger Method

Introduction: Human enteroviruses are single stranded RNA viruses associated with many serious diseases such as encephalitis and myocarditis. They consist of up to 100 immunologically and genetically distinct types. Three enteroviral isolates, 2104, 3936 and 3988, were previously isolated from patients with neurological disorders or sepsis-like illness. In this study, the molecular characterization of the three isolates was investigated. Methodology: A full genome sequencing was performed by Sanger method, followed by phylogenetic and bootscanning analyses. A detailed analysis of genetic differences between the clinical and prototype isolates were investigated by mapping polymorphisms at nucleotide and amino acid levels, and by comparing RNA secondary structure in the noncoding regions. Results: Based on the phylogenetic analysis of the VP1 gene and complete genome, 2104 was typed as coxsackievirus B1, 3936 as coxsackievirus B5, and 3988 as echovirus 7. Similarity and bootscan plots provided support for intra- and intertypic recombination crossover points occurring mainly along the nonstructural coding regions of the isolates. A sequence divergence of 12 to 14% was detected in the 5’-noncoding region between the clinical isolates and their corresponding prototype strains. Synonymous and nonsynonymous substitutions could be also mapped to different coding regions of the isolates, including those coding for the Puff, Knob and the hydrophobic pocket of the capsid. Examination of relative frequencies of synonymous and nonsynonymous substitutions in different coding regions of enteroviral isolates showed no evidence for selective pressure. Conclusion: The results provided a better understanding of the genetic variations, evolution and adaptation of enteroviruses in Kuwait.

Download Full-text

The Influence of Memory-Aware Computation on Distributed BLAST

Current Bioinformatics ◽

10.2174/1574893613666180601080811 ◽

2019 ◽

Vol 14 (2) ◽

pp. 157-163

Author(s):

Majid Hajibaba ◽

Mohsen Sharifi ◽

Saeid Gorgin

Keyword(s):

Search Time ◽

Genomic Research ◽

Local Alignment ◽

Negative Effects ◽

Sequencing Technologies ◽

Percent Improvement ◽

Fast Processing ◽

Search Tool ◽

Memory Awareness ◽

Generation Sequencing

Background: One of the pivotal challenges in nowadays genomic research domain is the fast processing of voluminous data such as the ones engendered by high-throughput Next-Generation Sequencing technologies. On the other hand, BLAST (Basic Local Alignment Search Tool), a longestablished and renowned tool in Bioinformatics, has shown to be incredibly slow in this regard. Objective: To improve the performance of BLAST in the processing of voluminous data, we have applied a novel memory-aware technique to BLAST for faster parallel processing of voluminous data. Method: We have used a master-worker model for the processing of voluminous data alongside a memory-aware technique in which the master partitions the whole data in equal chunks, one chunk for each worker, and consequently each worker further splits and formats its allocated data chunk according to the size of its memory. Each worker searches every split data one-by-one through a list of queries. Results: We have chosen a list of queries with different lengths to run insensitive searches in a huge database called UniProtKB/TrEMBL. Our experiments show 20 percent improvement in performance when workers used our proposed memory-aware technique compared to when they were not memory aware. Comparatively, experiments show even higher performance improvement, approximately 50 percent, when we applied our memory-aware technique to mpiBLAST. Conclusion: We have shown that memory-awareness in formatting bulky database, when running BLAST, can improve performance significantly, while preventing unexpected crashes in low-memory environments. Even though distributed computing attempts to mitigate search time by partitioning and distributing database portions, our memory-aware technique alleviates negative effects of page-faults on performance.

Download Full-text

Predicting bacteriophage hosts based on sequences of annotated receptor-binding proteins

Scientific Reports ◽

10.1038/s41598-021-81063-4 ◽

2021 ◽

Vol 11 (1) ◽

Author(s):

Dimitri Boeckaerts ◽

Michiel Stock ◽

Bjorn Criel ◽

Hans Gerstmans ◽

Bernard De Baets ◽

...

Keyword(s):

Machine Learning ◽

Predictive Model ◽

Receptor Binding ◽

Bacterial Infections ◽

Sequence Data ◽

Sequence Similarity ◽

Area Under The Curve ◽

Local Alignment ◽

Search Tool ◽

Different Levels

AbstractNowadays, bacteriophages are increasingly considered as an alternative treatment for a variety of bacterial infections in cases where classical antibiotics have become ineffective. However, characterizing the host specificity of phages remains a labor- and time-intensive process. In order to alleviate this burden, we have developed a new machine-learning-based pipeline to predict bacteriophage hosts based on annotated receptor-binding protein (RBP) sequence data. We focus on predicting bacterial hosts from the ESKAPE group, Escherichia coli, Salmonella enterica and Clostridium difficile. We compare the performance of our predictive model with that of the widely used Basic Local Alignment Search Tool (BLAST). Our best-performing predictive model reaches Precision-Recall Area Under the Curve (PR-AUC) scores between 73.6 and 93.8% for different levels of sequence similarity in the collected data. Our model reaches a performance comparable to that of BLASTp when sequence similarity in the data is high and starts outperforming BLASTp when sequence similarity drops below 75%. Therefore, our machine learning methods can be especially useful in settings in which sequence similarity to other known sequences is low. Predicting the hosts of novel metagenomic RBP sequences could extend our toolbox to tune the host spectrum of phages or phage tail-like bacteriocins by swapping RBPs.

Download Full-text

Kelch 13-propeller polymorphisms in Plasmodium falciparum from Jazan region, southwest Saudi Arabia

Malaria Journal ◽

10.1186/s12936-020-03467-3 ◽

2020 ◽

Vol 19 (1) ◽

Author(s):

Ommer Mohammed Dafalla ◽

Mohammed Alzahrani ◽

Ahmed Sahli ◽

Mohammed Abdulla Al Helal ◽

Mohammad Mohammad Alhazmi ◽

...

Keyword(s):

Plasmodium Falciparum ◽

Saudi Arabia ◽

Parasite Clearance ◽

Sub Saharan Africa ◽

Local Alignment ◽

Nucleotide Polymorphisms ◽

Gene Encoding ◽

Synonymous Mutations ◽

Search Tool ◽

Sub Saharan

Abstract Background Artemisinin-based combination therapy (ACT) is recommended at the initial phase for treatment of Plasmodium falciparum, to reduce morbidity and mortality in all countries where malaria is endemic. Polymorphism in portions of P. falciparum gene encoding kelch (K13)-propeller domains is associated with delayed parasite clearance after ACT. Of about 124 different non-synonymous mutations, 46 have been identified in Southeast Asia (SEA), 62 in sub-Saharan Africa (SSA) and 16 in both the regions. This is the first study designed to analyse the prevalence of polymorphism in the P. falciparum k13-propeller domain in the Jazan region of southwest Saudi Arabia, where malaria is endemic. Methods One-hundred and forty P. falciparum samples were collected from Jazan region of southwest Saudi Arabia at three different times: 20 samples in 2011, 40 samples in 2016 and 80 samples in 2020 after the implementation of ACT. Plasmodium falciparum kelch13 (k13) gene DNA was extracted, amplified, sequenced, and analysed using a basic local alignment search tool (BLAST). Results This study obtained 51 non-synonymous (NS) mutations in three time groups, divided as follows: 6 single nucleotide polymorphisms (SNPs) ‘11.8%’ in samples collected in 2011 only, 3 (5.9%) in 2011and 2016, 5 (9.8%) in 2011 and 2020, 5 (9.8%) in 2016 only, 8 (15.7%) in 2016 and 2020, 14 (27.5%) in 2020 and 10 (19.6%) in all the groups. The BLAST revealed that the 2011 isolates were genetically closer to African isolates (53.3%) than Asian ones (46.7%). Interestingly, this proportion changed completely in 2020, to become closer to Asian isolates (81.6%) than to African ones (18.4%). Conclusions Despite the diversity of the identified mutations in the k13-propeller gene, these data did not report widespread artemisinin-resistant polymorphisms in the Jazan region where these samples were collected. Such a process would be expected to increase frequencies of mutations associated with the resistance of ACT.

Download Full-text

Identification of NURR1 (Exon 4) and FOXA1 (Exon 3) Haplotypes Associated with mRNA Expression Levels in Peripheral Blood Lymphocytes of Parkinson’s Patients in Small Indian Population

Parkinson s Disease ◽

10.1155/2017/6025358 ◽

2017 ◽

Vol 2017 ◽

pp. 1-8 ◽

Cited By ~ 3

Author(s):

Jayakrishna Tippabathani ◽

Jayshree Nellore ◽

Vaishnavie Radhakrishnan ◽

Somashree Banik ◽

Sonia Kapoor

Keyword(s):

Mrna Expression ◽

Peripheral Blood ◽

Peripheral Blood Lymphocytes ◽

Coding Region ◽

Male And Female ◽

Blood Lymphocytes ◽

Coding Regions ◽

Significant Difference ◽

Exon 4 ◽

Foxa1 Expression

Here, we study the expression of NURR1 and FOXA1 mRNA in peripheral blood lymphocytes and its haplotypes in coding region in a small Chennai population of India. Thirty cases of Parkinson’s patients (PD) with anti-PD medications (20 males aged65.85±1.19and 10 females aged65.7±1.202) and 30 age matched healthy people (20 males aged68.45±1.282and 10 females aged65.8±1.133) were included. The expression of NURR1 and FOXA1 in PBL was detected by Q-PCR and haplotypes were identified by PCR-SSCP. In the 30 PD cases examined, NURR1 and FOXA1 expression was significantly reduced in both male and female PD patients. However, NURR1 (57.631% reduced in males; 28.93% in females) and FOXA1 (64.42% in males; 55.76% in females) mRNA expression did differ greatly between male and female PD patients. Polymorphisms were identified at exon 4 of the NURR1 and at exon 3 of the FOXA1, respectively, in both male and female patients. A near significant difference in SSCP patterns between genders of control and PD population was analyzed suggesting that further investigations of more patients, more molecular markers, and coding regions should be performed. Such studies could potentially reveal peripheral molecular marker of early PD and different significance to the respective genders.

Download Full-text

Regulation, linkage, and sequence of mouse metallothionein I and II genes

Molecular and Cellular Biology ◽

10.1128/mcb.4.7.1221-1230.1984 ◽

1984 ◽

Vol 4 (7) ◽

pp. 1221-1230

Author(s):

P F Searle ◽

B L Davison ◽

G W Stuart ◽

T M Wilkie ◽

G Norstedt ◽

...

Keyword(s):

Heavy Metals ◽

Hela Cells ◽

Conserved Sequences ◽

Noncoding Regions ◽

Coding Regions ◽

Four Blocks ◽

I Gene

The mouse metallothionein II (MT-II) gene is located approximately 6 kilobases upstream of the MT-I gene. A comparison of the sequences of mouse MT-I and MT-II genes (as well as those of other mammals) reveals that the coding regions are highly conserved even at "silent" positions but that the noncoding regions and introns are extremely divergent between primates and rodents. There are four blocks of conserved sequences in the promoters of mouse MT-I, mouse MT-II, and human MT-IIA genes; one includes the TATAAA sequence, and another has been implicated in regulation by heavy metals. Mouse MT-I and MT-II mRNAs are induced to approximately the same extent in vivo in response to cadmium, dexamethasone, or lipopolysaccharide. Mouse MT-I and MT-II genes are regulated by metals but not by glucocorticoids after transfection into HeLa cells.

Download Full-text

A strand bias occurs in point mutations associated with variant surface glycoprotein gene conversion in Trypanosoma rhodesiense

Molecular and Cellular Biology ◽

10.1128/mcb.14.6.3971-3980.1994 ◽

1994 ◽

Vol 14 (6) ◽

pp. 3971-3980

Author(s):

Y Lu ◽

C M Alarcon ◽

T Hall ◽

L V Reddy ◽

J E Donelson

Keyword(s):

Point Mutations ◽

Cross Reactivity ◽

Surface Glycoprotein ◽

Variant Surface Glycoprotein ◽

Strand Bias ◽

Glycoprotein Gene ◽

Coding Regions ◽

Crossover Site ◽

Sense Strand ◽

Duplication Events

We previously described a bloodstream Trypansoma rhodesiense clone, MVAT5-Rx2, whose isolation was based on its cross-reactivity with a monoclonal antibody (MAb) directed against a metacyclic variant surface glycoprotein (VSG). When the duplicated, expressed VSG gene in MVAT5-Rx2 was compared with its donor (basic copy) gene, 11 nucleotide differences were found in the respective 1.5-kb coding regions (Y. Lu, T. Hall, L. S. Gay, and J. E. Donelson, Cell 72:397-406, 1993). Here we describe a characterization of two additional bloodstream trypanosome clones, MVAT5-Rx1 and MVAT5-Rx3, whose VSGs are expressed from duplicated copies of the same donor VSG gene. The three trypanosome clones each react with the MVAT5-specific MAb, but they have different cross-reactivities with a panel of other MAbs, suggesting that their surface epitopes are similar but nonidentical. Each of the three gene duplication events occurs at a different 5' crossover site within a 76-bp repeat and is associated with a different set of point mutations. The 35, 11, and 28 point mutations in the duplicated VSG coding regions of Rx1, Rx2, and Rx3, respectively, exhibit a strand bias. In the sense strand, of the 74 total mutations generated in the three duplications, 54% are A-to-G or G-to-A (A:G) transitions and 7% are C:T transitions, while 26% are C:A transversions and 13% are C:G transversions. No T:G or T:A transversions occurred. Possible models for the generation of these point mutations are discussed.

Download Full-text

Binding of coenzymes to yeast alcohol dehydrogenase

Journal of the Serbian Chemical Society ◽

10.2298/jsc1002185l ◽

2010 ◽

Vol 75 (2) ◽

pp. 185-194 ◽

Cited By ~ 5

Author(s):

Vladimir Leskovac ◽

Svetlana Trivic ◽

Draginja Pericin ◽

Mira Popovic ◽

Julijan Kandrac

Keyword(s):

Alcohol Dehydrogenase ◽

Equilibrium Constants ◽

Point Mutations ◽

Free Energies ◽

Wild Type ◽

Wild Type Enzyme ◽

Mutant Type ◽

Yeast Alcohol Dehydrogenase ◽

Internal Equilibrium ◽

Individual Reaction

In this work, the binding of coenzymes to yeast alcohol dehydrogenase (EC 1.1.1.1) were investigated. The main criterions were the change in the standard free energies for individual reaction steps, the internal equilibrium constants and the overall changes in the reaction free energies. The calculations were performed for the wild type enzyme at pH 6-9 and for 15 different mutant type enzymes, with single or double point mutations, at pH 7.3. The abundance of theoretical and experimental data enabled the binding of coenzymes to enzyme to be assessed in depth.

Download Full-text

Distinctive functional regime of endogenous lncRNAs in dark regions of human genome

10.1101/2020.12.06.413880 ◽

2020 ◽

Author(s):

Anyou Wang ◽

Rong Hai

Keyword(s):

Human Genome ◽

Rna Processing ◽

Self Regulation ◽

Post Translational Modification ◽

Protein Coding ◽

Noncoding Regions ◽

Coding Regions ◽

Rnaseq Data ◽

Response To Stress ◽

Eukaryotic Genomes

AbstractEukaryotic genomes gradually gain noncoding regions when advancing evolution and human genome actively transcribes >90% of its noncoding regions1, suggesting their criticality in evolutionary human genome. Yet <1% of them have been functionally characterized2, leaving most human genome in dark. Here we systematically decode endogenous lncRNAs located in unannotated regions of human genome and decipher a distinctive functional regime of lncRNAs hidden in massive RNAseq data. LncRNAs divergently distribute across chromosomes, independent of protein-coding regions. Their transcriptions barely initiate on promoters through polymerase II, but mostly on enhancers. Yet conventional enhancer activators(e.g. H3K4me1) only account for a small proportion of lncRNA activation, suggesting alternatively unknown mechanisms initiating the majority of lncRNAs. Meanwhile, lncRNA-self regulation also notably contributes to lncRNA activation. LncRNAs trans-regulate broad bioprocesses, including transcription and RNA processing, cell cycle, respiration, response to stress, chromatin organization, post-translational modification, and development. Overall lncRNAs govern their owned regime distinctive from protein’s.

Download Full-text

Fish Identification based on Partial Fragments of The Mitochondrial COI Subunit I Gene

E3S Web of Conferences ◽

10.1051/e3sconf/202132201038 ◽

2021 ◽

Vol 322 ◽

pp. 01038

Author(s):

Tuah N. M. Wulandari

Keyword(s):

Phylogenetic Tree ◽

Coi Gene ◽

Local Alignment ◽

Mtdna Sequences ◽

Mitochondrial Coi ◽

Search Tool ◽

Very High ◽

I Gene

The mtDNA sequences revealed that several of the fish studied were Hampala macrolepidota and Barbonymus gonionotus. The objective of this research was to learn the pattern of COI gene in mtDNA and establish a phylogenetic tree. Basic Local Alignment Search Tool-nucleotide (BLASTn) confirmed that Barbonymus gonionotus froma the Ranau Lake, South Sumatera has 100% matching ranges to the species from Memberamo River (Indonesia), India, Bangladesh, Thailand (Mae Khlong), Indo-Myanmar, and Malaysia_1. The lowest closeness (98.76%) is related to species from Thailand (Lower Ing). The Blast investigation appears us that the level of familiarity was very high, it is coming to 98-100% in Barbonymus gonionotus. Hampala macrolepidota had 100% matching ranges to the species from Indonesia (SouthaSumatera_1) and Vietnam. They had 99.05%-99.84% closeness from Malaysia_1,2&3, Indonesia (South Sumatera_2&3, Java and Bali_1,2&3).

Download Full-text