Patterns of Structural Variation Define Prostate Cancer Across Disease States

The complex genomic landscape of prostate cancer evolves across disease states under therapeutic pressure directed toward inhibiting androgen receptor (AR) signaling. While significantly altered genes in prostate cancer have been extensively defined, there have been fewer systematic analyses of how structural variation reflects the genomic landscape of this disease. We comprehensively characterized structural alterations across 278 localized and 143 metastatic prostate cancers profiled by whole genome and transcriptome sequencing. We observed distinct significantly recurrent breakpoints in localized and metastatic castration-resistant prostate cancers (mCRPC), with pervasive alterations in noncoding regions flanking the AR, MYC, FOXA1, and LSAMP genes in mCRPC. We defined nine subclasses of mCRPC based on signatures of structural variation, each associated with distinct genetic features and clinical outcomes. Our results comprehensively define patterns of structural variation in prostate cancer and identify clinically actionable subgroups based on whole genome profiling.

Profile of Basal Cell Carcinoma Mutations and Copy Number Alterations - Focus on Gene-Associated Noncoding Variants

Basal cell carcinoma (BCC) of the skin is the most common cancer in humans, characterized by the highest mutation rate among cancers, and is mostly driven by mutations in genes involved in the hedgehog pathway. To date, almost all BCC genetic studies have focused exclusively on protein-coding sequences; therefore, the impact of noncoding variants on the BCC genome is unrecognized. In this study, with the use of whole-exome sequencing of 27 tumor/normal pairs of BCC samples, we performed an analysis of somatic mutations in both protein-coding sequences and gene-associated noncoding regions, including 5’UTRs, 3’UTRs, and exon-adjacent intron sequences. Separately, in each region, we performed hotspot identification, mutation enrichment analysis, and cancer driver identification with OncodriveFML. Additionally, we performed a whole-genome copy number alteration analysis with GISTIC2. Of the >80,000 identified mutations, ~50% were localized in noncoding regions. The results of the analysis generally corroborated the previous findings regarding genes mutated in coding sequences, including PTCH1, TP53, and MYCN, but more importantly showed that mutations were also clustered in specific noncoding regions, including hotspots. Some of the genes specifically mutated in noncoding regions were identified as highly potent cancer drivers, of which BAD had a mutation hotspot in the 3’UTR, DHODH had a mutation hotspot in the Kozak sequence in the 5’UTR, and CHCHD2 frequently showed mutations in the 5’UTR. All of these genes are functionally implicated in cancer-related processes (e.g., apoptosis, mitochondrial metabolism, and de novo pyrimidine synthesis) or the pathogenesis of UV radiation-induced cancers. We also found that the identified BAD and CHCHD2 mutations frequently occur in melanoma but not in other cancers via The Cancer Genome Atlas analysis. Finally, we identified a frequent deletion of chr9q, encompassing PTCH1, and unreported frequent copy number gain of chr9p, encompassing the genes encoding the immune checkpoint ligands PD-L1 and PD-L2. In conclusion, this study is the first systematic analysis of coding and noncoding mutations in BCC and provides a strong basis for further analyses of the variants in BCC and cancer in general.

Proteogenomic discovery of sORF-encoded peptides associated with bacterial virulence in Yersinia pestis

Plague caused by Yersinia pestis is one of the deadliest diseases. However, many molecular mechanisms of bacterial virulence remain unclear. This study engaged in the discovery of small open reading frame (sORF)-encoded peptides (SEPs) in Y. pestis. An integrated proteogenomic pipeline was established, and an atlas containing 76 SEPs was described. Bioinformatic analysis indicated that 20% of these SEPs were secreted or localized to the transmembrane and that 33% contained functional domains. Two SEPs, named SEPs-yp1 and -yp2 and encoded in noncoding regions, were selected by comparative peptidomics analysis under host-specific environments and high-salinity stress. They displayed important roles in the regulation of antiphagocytic capability in a thorough functional assay. Remarkable attenuation of virulence in mice was observed in the SEP-deleted mutants. Further global proteomic analysis indicated that SEPs-yp1 and -yp2 affected the bacterial metabolic pathways, and SEP-yp1 was associated with the bacterial virulence by modulating the expression of key virulence factors of the Yersinia type III secretion system. Our study provides a rich resource for research on Y. pestis and plague, and the findings on SEP-yp1 and SEP-yp2 shed light on the molecular mechanism of bacterial virulence.

Positive selection in noncoding genomic regions of vocal learning birds is associated with genes implicated in vocal learning and speech functions in humans

Vocal learning, the ability to imitate sounds from conspecifics and the environment, is a key component of human spoken language and learned song in three independently evolved avian groups—oscine songbirds, parrots, and hummingbirds. Humans and each of these three bird clades exhibit specialized behavioral, neuroanatomical, and brain gene expression convergence related to vocal learning, speech, and song. To understand the evolutionary basis of vocal learning gene specializations and convergence, we searched for and identified accelerated genomic regions (ARs), a marker of positive selection, specific to vocal learning birds. We found avian vocal learner-specific ARs, and they were enriched in noncoding regions near genes with known speech functions or brain gene expression specializations in humans and vocal learning birds, including FOXP2, NEUROD6, ZEB2, and MEF2C, and near genes with major neurodevelopmental functions, including NR2F1, NRP2, and BCL11B. We also found enrichment near the SFARI class S genes associated with syndromic vocal communication forms of autism spectrum disorders. These findings reveal strong candidate noncoding regions near genes for the evolutionary adaptations that distinguish vocal learning species from their close vocal nonlearning relatives and provide further evidence of molecular convergence between birdsong and human spoken language.

Selection on Accessible Chromatin Regions in Capsella grandiflora

Accurate estimates of genome-wide rates and fitness effects of new mutations are essential for an improved understanding of molecular evolutionary processes. Although eukaryotic genomes generally contain a large noncoding fraction, functional noncoding regions and fitness effects of mutations in such regions are still incompletely characterized. A promising approach to characterize functional noncoding regions relies on identifying accessible chromatin regions (ACRs) tightly associated with regulatory DNA. Here, we applied this approach to identify and estimate selection on ACRs in Capsella grandiflora, a crucifer species ideal for population genomic quantification of selection due to its favorable population demography. We describe a population-wide ACR distribution based on ATAC-seq data for leaf samples of 16 individuals from a natural population. We use population genomic methods to estimate fitness effects and proportions of positively selected fixations (α) in ACRs and find that intergenic ACRs harbor a considerable fraction of weakly deleterious new mutations, as well as a significantly higher proportion of strongly deleterious mutations than comparable inaccessible intergenic regions. ACRs are enriched for expression quantitative trait loci (eQTL) and depleted of transposable element insertions, as expected if intergenic ACRs are under selection because they harbor regulatory regions. By integrating empirical identification of intergenic ACRs with analyses of eQTL and population genomic analyses of selection, we demonstrate that intergenic regulatory regions are an important source of nearly neutral mutations. These results improve our understanding of selection on noncoding regions and the role of nearly neutral mutations for evolutionary processes in outcrossing Brassicaceae species.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

LincRNA-Cox2 functions to regulate inflammation in alveolar macrophages during acute lung injury.

The respiratory system exists at the interface between our body and the surrounding non-sterile environment; therefore, it is critical for a state of homeostasis to be maintained through a balance of pro- and anti- inflammatory cues. An appropriate inflammatory response is vital for combating pathogens, while an excessive or uncontrolled inflammatory response can lead to the development of chronic diseases. Recent studies show that actively transcribed noncoding regions of the genome are emerging as key regulators of biological processes, including inflammation. LincRNA-Cox2 is one such example of an inflammatory inducible long noncoding RNA functioning to control immune response genes. Here using bulk and single cell RNA-seq, in addition to florescence activated cell sorting, we show that lincRNA-Cox2 is most highly expressed in the lung, particularly in alveolar macrophages where it functions to control immune gene expression following acute lung injury. Utilizing a newly generated lincRNA-Cox2 transgenic overexpressing mouse, we show that it can function in trans to control genes including Ccl3, 4 and 5. This work greatly expands our understanding of the role for lincRNA-Cox2 in host defense and sets in place a new layer of regulation in RNA-immune-regulation of genes within the lung.

A synergistic effect between 3′ terminal noncoding and adjacent coding regions of influenza A virus HA segment on template preference

The influenza A virus genome is comprised of eight single-stranded negative-sense viral RNA (vRNA) segments. Each of the eight vRNA segments contains segment-specific nonconserved noncoding regions (NCRs) of similar sequence and length in different influenza A virus strains. However, in the subtype-determinant segments, encoding haemagglutinin (HA) and neuraminidase (NA), the segment-specific noncoding regions are subtype-specific, varying significantly in sequence and length at both the 3´ and 5´ termini among different subtypes. The significance of these subtype-specific noncoding regions (ssNCR) in the influenza virus replication cycle is not fully understood. In this study, we show that truncations of the 3´-end H1-subtype-specific noncoding region (H1-ssNCR) resulted in recombinant viruses with decreased HA vRNA replication and attenuated growth phenotype, although the vRNA replication was not affected in single-template RNP reconstitution assays. The attenuated viruses were unstable and point mutations at nucleotide position 76 or 56 in the adjacent coding region of HA vRNA were found after serial passage. The mutations restored the HA vRNA replication and reversed the attenuated virus growth phenotype. We propose that the terminal noncoding and adjacent coding regions act synergistically to ensure optimal levels of HA vRNA replication in a multi-segment environment. These results, provide novel insights into the role of the 3´-end nonconserved noncoding regions and adjacent coding regions on template preference in multiple-segmented negative-strand RNA viruses. IMPORTANCE While most influenza A virus vRNA segments contain segment-specific nonconserved noncoding regions of similar length and sequence, these regions vary considerably both in length and sequence in the segments encoding HA and NA, the two major antigenic determinants of influenza A viruses. In this study, we investigated the function of the 3´-end H1-ssNCR and observed a synergistic effect between the 3´-end H1-ssNCR nucleotides and adjacent coding nucleotide(s) of HA segment on template preference in a multi-segment environment. The results unravel an additional level of complexity in the regulation of RNA replication in multiple-segmented negative-strand RNA viruses.

Profile of basal cell carcinoma mutations and copy number alterations - focus on gene-associated noncoding variants

Basal cell carcinoma (BCC) of the skin is the most common cancer in humans, characterized by the highest mutation rate among cancers, and is mostly driven by mutations in genes involved in the hedgehog pathway. To date, almost all BCC genetic studies have focused exclusively on protein-coding sequences; therefore, the impact of noncoding variants on the BCC genome is unrecognized. In this study, with the use of whole-exome sequencing of 27 tumor/normal pairs of BCC samples, we performed an analysis of somatic mutations in both protein-coding sequences and gene-associated noncoding regions, including 5UTRs, 3UTRs, and exon-adjacent intron sequences. Separately, in each region, we performed hotspot identification, mutation enrichment analysis, and cancer driver identification with OncodriveFML. Additionally, we performed a whole-genome copy number alteration analysis with GISTIC2. Of the >80,000 identified mutations, ~50% were localized in noncoding regions. The results of the analysis generally corroborated the previous findings regarding genes mutated in coding sequences, including PTCH1, TP53, and MYCN, but more importantly showed that mutations were also clustered in specific noncoding regions, including hotspots. Some of the genes specifically mutated in noncoding regions were identified as highly potent cancer drivers, of which BAD had a mutation hotspot in the 3UTR, DHODH had a mutation hotspot in the Kozak sequence in the 5UTR, and CHCHD2 frequently showed mutations in the 5UTR. All of these genes are functionally implicated in cancer-related processes (e.g., apoptosis, mitochondrial metabolism, and de novo pyrimidine synthesis) or the pathogenesis of UV radiation-induced cancers. We also found that the identified BAD and CHCHD2 mutations frequently occur in melanoma but not in other cancers via The Cancer Genome Atlas analysis. Finally, we identified frequent deletion of chr9q, encompassing PTCH1, and unreported frequent copy number gain of chr9p, encompassing the genes encoding the immune checkpoint ligands PD-L1 and PD-L2. In conclusion, this study is the first systematic analysis of coding and noncoding mutations in BCC and provides a strong basis for further analyses of the variants in BCC and cancer in general.

Not all lncMIRHGs are "junk transcripts,". LncM IRHG loci may make both functional miRNAs and lncRNAs, which can work together or separately

The human genome has various genomic regions that can create a large number of transcripts. RNAs that can function as both mRNA and noncoding RNA (lncRNA/snoRNA/miRNA) are known as bifunctional RNAs, or bifRNAs. BifRNAs have been detected in everything from microorganisms to humans. Cells may accurately modify the functions of the coding and noncoding regions of bifRNAs to satisfy relevant regulatory needs. However, it has not been thoroughly investigated whether the same gene locus may produce two types of functional nc transcripts, such as lncRNAs and miRNAs. These "bifunctional nc RNAs" are the topic of this review. This evaluation contained all the current information regarding LncMIRHGs. Some LINC MONOMER transcripts have not been proven to be "junk" according to this functional and mechanistic research. It is possible that the lncMIRHG locus makes both functional miRNAs and lncRNAs, some of which can act together and others of which may act independently. The data gathered via research by the NEAT1 organization also indicates that miRNA may function as a "pseudoRNA," with lncRNA produced from the lncMIRHG gene locus serving as the lead. A significant amount of focus on this class of lncRNAs must be given since the beauty of the lncMIRHG loci, which control these putative dual functions as lncRNA and miRNA, strongly recommends that we should do so. LincMIRHGs are utilized in a broad number of tasks, including those seen in disorders like cancer. It will be useful for medicine creation and development to have a full understanding of this lncRNA repertoire's mechanisms.