First report of Sida leaf curl virus and associated betasatellite in tobacco

Tobacco (Nicotiana tabacum L.) is an economic crop and an important model plant for scientific research in the world. Cigar tobacco, a variety of tobacco, has been planted for industrial production in China since its introduction into the country in 2018 (Wang et al., 2021). In March 2020, symptoms like leaf curling, vein thickening and enation were frequently observed in cigar tobacco in several plantation areas of 100 hectares in Danzhou, Hainan Province, China (Fig. 1A). It was speculated that a geminivirus was the possible causing agent of the disease since the symptoms resembled those caused by geminiviruses besides the presence of their insect vectors - whiteflies. Five tobacco leaf samples were collected for DNA extraction, and pooled DNA was subjected to viral metagenomics analysis with Illumina Sequencing Technology (Illumina) at Tiangen Biotech, Beijing. A total of 67,774,552 filtered reads (99.84%) were matched to tobacco genome, and the remaining 110,908 reads (0.16%) were analyzed by BLASTn against GenBank virus Refseq Database with E-value smaller than 1e-6. Among the virus-matching sequencing data obtained, 65 and 2,058 reads were annotated as genomes of sida leaf curl virus (SiLCV, reference sequence: NC_007638) and its associated betasatellite (SiLCB, reference sequence: NC_007639), accounting for 3% and 95%, respectively. Thirty six reads matched to sweet potato vein clearing virus (reference sequence: NC_015228), and 7 reads matched to Emiliania huxleyi virus (reference sequence: JF429838). We speculated the causing pathogen of this disease might be SiLCV and its associated betasatellite. We next designed primers SiLCV-DNA-A-F/SiLCV-DNA-A-R (SiLCV-DNA-A-F: GAATTCTTTTCCTCGTCCAGG; SiLCV-DNA-A-R: CGCTTTAAAGACTTGGGCTTT) and SiLCV-β-F/SiLCV-β-R (SiLCV-β-F: ACCGGTGGCGAGCTGGTGTCT; SiLCV-β-R: AATATTAGAACGGTGGCGAGC) to amplify the complete genome of SiLCV and its associated betasatellite, respectively (Table S1). As expected, all five tobacco DNA samples were PCR-positive for the two sets of primers. Thereafter, the amplicons from one sample (Fig. 1B) were fully sequenced by Sanger sequencing at Tiangen Biotech, Beijing. The anticipated SiLCV genome with a length 2,760 nucleotides (accession no. MW465952) and its associated betasatellite with a length of 1,369 nucleotides (accession no. MW465953) exhibited the highest sequence identity of 93.5% and 95.6% with that of SiLCV isolate 61 (DQ641706; Ha et al., 2008) and isolate Hn57 (AM050732.1; Guo and Zhou 2006), respectively. This SiLCV isolate identified in Hainan province is named as SiLCV-HN, and its associated betasatellite is named as SiLCB-HN. Infectious clones of SiLCV-HN and SiLCB-HN were constructed by ligating two complete genomes of each SiLCV-HN and SiLCB-HN to a binary expression vector pCAMBIA1300 as previously described (Wang et al. 2019). Next, SiLCV-HN alone or co-infiltrated SiLCV-HN and SiLCB-HN were infiltrated into Nicotiana benthamiana. At 5 days post inoculation (5 dpi), typical begomovirus symptoms such as severe down-curl on newly emerging leaves displayed in SiLCV-HN and SiLCB-HN co-infiltrated N. benthamiana plants. Agroinoculation of N. benthamiana plants with SiLCV-HN alone showed severe leaf up-curl symptom at 12 dpi (Fig. 1C). Quantitative PCR results showed that the virus titer was higher in SiLCV-HN/SiLCB-HN co-infected plants in comparison to plants infected with SiLCV-HN individually (Fig. 1D). Typical virus symptoms and SiLCV DNA could also be detected in a wild tobacco species Nicotiana glutinosa when agroinfiltration-based infection was done, even though at a low infection efficacy (Fig. 1E and 1F). We could not make successful agroinfiltration-based infection of SiLCV in cigar tobacco due to unknown reasons. Nevertheless our data suggest that SiLCV-HN could infect species from Nicotiana genus and therefore poses severe threats to tobacco industry. References: Guo, X. J., & Zhou, X. P., 2006. Virus Genes. 10.1007/s11262-006-0066-8. Ha C., et al., 2008, The Journal of general virology. 10.1099/vir.0.83236-0. Wang, D., et al., 2019. Molecular plant-microbe interactions. 10.1094/MPMI-06-19-0163-FI. Wang, Y. Y., et al., 2021. Frontiers in plant science. 10.3389/fpls.2021.618133.

Genome-Wide Analysis of the G2-Like Transcription Factor Genes and Their Expression in Different Senescence Stages of Tobacco (Nicotiana tabacum L.)

The Golden2-like (GLK) transcription factors play important roles in regulating chloroplast growth, development, and senescence in plants. In this study, a total of 89 NtGLK genes (NtGLK1–NtGLK89) were identified in the tobacco genome and were classified into 10 subfamilies with variable numbers of exons and similar structural organizations based on the gene structure and protein motif analyses. Twelve segmental duplication pairs of NtGLK genes were identified in the genome. These NtGLK genes contain two conserved helix regions related to the HLH structure, and the sequences of the first helix region are less conserved than that of the second helix motif. Cis-regulatory elements of the NtGLK promoters were widely involved in light responsiveness, hormone treatment, and physiological stress. Moreover, a total of 206 GLK genes from tomato, tobacco, maize, rice, and Arabidopsis were retrieved and clustered into eight subgroups. Our gene expression analysis indicated that NtGLK genes showed differential expression patterns in tobacco leaves at five senescence stages. The expression levels of six NtGLK genes in group C were reduced, coinciding precisely with the increment of the degree of senescence, which might be associated with the function of leaf senescence of tobacco. Our results have revealed valuable information for further functional characterization of the GLK gene family in tobacco.

Bioinformatics and Expression Analysis of IDA-Like Genes Reveal Their Potential Functions in Flower Abscission and Stress Response in Tobacco (Nicotiana tabacum L.)

The inflorescence deficient in abscission-like (IDL) genes have been shown to play critical roles in floral organ abscission, lateral root formation and various stress responses in Arabidopsis. The IDL gene family has been characterized in a number of plant species, while limited information is available about IDL genes of tobacco. In the current study, 15 NtIDL members were identified in the tobacco genome, and were classified into six groups together with IDL members from other species. Evolution analysis suggested that the NtIDL members form group VI might have originated from duplication events. Notably, NtIDL06 shared high similarities with AtIDA in the EPIP sequence, and its encoding gene was highly expressed in the abscission zone of flowers at late developmental stages, implying that NtIDL06 might regulate tobacco flower abscission. In addition, the results from cis-elements analysis of promoters and expression after stress treatments suggested that NtIDL members might be involved in various stress responses of tobacco. The results from this study provide information for further functional analysis related to flower abscission and stress responses of NtIDL genes.

Optimizing the CRISPR/Cas9 system for genome editing in grape by using grape promoters

The efficacy of the CRISPR/Cas9 system in grapevine (Vitis vinifera L.) has been documented, but the optimization of this system, as well as CRISPR/Cas9-mediated multiplex genome editing, has not been explored in this species. Herein, we identified four VvU3 and VvU6 promoters and two ubiquitin (UBQ) promoters in grapevine and demonstrated that the use of the identified VvU3/U6 and UBQ2 promoters could significantly increase the editing efficiency in grape by improving the expression of sgRNA and Cas9, respectively. Furthermore, we conducted multiplex genome editing using the optimized CRISPR/Cas9 vector that contained the conventional multiple sgRNA expression cassettes or the polycistronic tRNA-sgRNA cassette (PTG) by targeting the sugar-related tonoplastic monosaccharide transporter (TMT) family members TMT1 and TMT2, and the overall editing efficiencies were higher than 10%. The simultaneous editing of TMT1 and TMT2 resulted in reduced sugar levels, which indicated the role of these two genes in sugar accumulation in grapes. Moreover, the activities of the VvU3, VvU6, and UBQ2 promoters in tobacco genome editing were demonstrated by editing the phytoene desaturase (PDS) gene in Nicotiana benthamiana leaves. Our study provides materials for the optimization of the CRISPR/Cas9 system. To our knowledge, our simultaneous editing of the grape TMT family genes TMT1 and TMT2 constitutes the first example of multiplex genome editing in grape. The multiplex editing systems described in this manuscript expand the toolbox of grape genome editing, which would facilitate basic research and molecular breeding in grapevine.

A Paraquat-Inducible Protein B-like (pqiB) Gene From Chromobacterium Violaceum Confers Tolerance to Paraquat in Transgenic Tobacco

Paraquat (1,1'-dimethyl-4,4'-bipyridinium dichloride) is a contact non-selective herbicide, widely used in agriculture in several countries. Proteins induced by paraquat have been the subject of great interest because of the possibility of conferring herbicide resistance when introduced into crops. In this work, we analyzed a paraquat-inducible protein B-like ( cvpqiB ) gene, isolated from Chromobacterium violaceum, in conferring tolerance to paraquat in transgenic tobacco. A DNA fragment containing the pqiB coding sequence was isolated from the C. violaceum ATCC12472 genome, inserted into the pCAMBIA1390 vector, under the control of the cauliflower mosaic virus (CaMV) 35S promoter, and used in Agrobacterium -mediated transformation of Nicotiana tabacum cv. Havana. Analysis of the regenerants revealed the incorporation of cvpqiB into the tobacco genome and its transmission in a Mendelian fashion to the progeny of transgenic plants. Sensitivity assays using tobacco leaves demonstrated that the transgenic plants were tolerant to concentrations up to 50 µM paraquat, whereas the wild-type (WT) plants exhibited intolerance to concentrations higher than 1 μM of the herbicide. Paraquat-treated leaves of the transgenic plants also exhibited significantly reduced electrolyte leakage and their chlorophyll content was not impacted as observed in the WT plants. Besides, in contrast to the WT, negligible amounts of hydrogen peroxide (H 2 O 2 ) were detected in paraquat-treated seedlings of the transgenic plants, as revealed by 3,3’-diaminobenzidine (DAB) staining. Collectively, these results indicate that the cvpqiB gene is functional in plants and may be further used in the genetic engineering of crop plants aiming paraquat tolerance.

Systematic Analysis of the bZIP Family in Tobacco and Functional Characterization of NtbZIP62 Involvement in Salt Stress

The basic leucine zipper (bZIP) transcription factors play important regulatory roles, influencing plant growth and responses to environmental stresses. In the present study, 132 bZIP genes identified in the tobacco genome were classified into 11 groups with Arabidopsis and tomato bZIP members, based on the results of a phylogenetic analysis. An examination of gene structures and conserved motifs revealed relatively conserved exon/intron structures and motif organization within each group. The results of an investigation of whole-genome duplication events indicated that segmental duplications were crucial for the expansion of the bZIP gene family in tobacco. Expression profiles confirmed that the NtbZIP genes are differentially expressed in various tissues, and several genes are responsive to diverse stresses. Notably, NtbZIP62, which was identified as an AtbZIP37/ABF3 homolog, was highly expressed in response to salinity. Subcellular localization analyses proved that NtbZIP62 is a nuclear protein. Furthermore, the overexpression of NtbZIP62 in tobacco significantly enhanced the salt stress tolerance of the transgenic plants. The results of this study may be relevant for future functional analyses of the bZIP genes in tobacco.

Intra- and inter-cultivar genetic variability in Bulgarian tobacco

PURPOSE: The genus Nicotiana is a well-defined group of species of which tobacco (Nicotiana tabacum L.) is the most important crop plant and plays a significant role in the economies of many countries. Recent advances in molecular genetics of the crop allowed the identification of many important genes and their location on chromosomes. However, the genetic analysis of this inbreeding, highly homozygous plant that serves as a model in many other studies is still very much work in progress. METHODS: A large proportion of the tobacco genome is represented by highly repeated DNA sequences, which makes molecular markers, based on them, an obvious first choice in diversity studies. Here we present an assessment with Inter-Simple Sequence Repeat (ISSR) markers of the intra- and inter-cultivar variability in a set of Bulgarian tobacco varieties. RESULTS: The screening of the 4 primers revealed a varying number of bands generated by different primers. The total number of bands varied between 4 and 13. No correlation between the total number of bands and the number of polymorphic bands was observed. Testing with ISSR primers revealed that plants with different DNA profiles can be found in varieties used. The highly similar profiles when E7 primer was used in two of the tested varieties from different production types indicate that the DNA fingerprinting technique may present a particular challenge in this crop. CONCLUSIONS: The present study demonstrates the power of the ISSR technique as a tool for diversity identification in tobacco.

Genome-Wide Identification, Gene Structure and Expression Analysis of the MADS-Box Gene Family Indicate Their Function in the Development of Tobacco (Nicotiana tabacum L.)

MADS-box genes play a pivotal role in various processes, including floral and seed development, controlling flowering time, regulation of fruits ripening, and respond to abiotic and biotic stressors in planta. Tobacco (Nicotiana tabacum) has been widely used as a model plant for analyzing the gene function, however, there has been less information on the regulation of flowering, and the associated genes. In the present study, a total of 168 NtMADS-box genes were identified from tobacco, and their phylogenetic relationship, chromosome locations, and gene structures were further analyzed. NtMADS-box genes can be clustered into four sub-families of Mα, Mγ, MIKC*, and MIKCC. A total of 111 NtMADS-box genes were distributed on 20 chromosomes, and 57 NtMADS-box genes were located on the unanchored scaffolds due to the complex and incomplete assembly of the tobacco genome. Expression profiles of NtMADS-box genes by microarray from 23 different tissues indicated that members in different NtMADS-box gene subfamilies might play specific roles in the growth and flower development, and the transcript levels of 24 NtMADS-box genes were confirmed by quantitative real-time PCR. Importantly, overexpressed NtSOC1/NtMADS133 could promote early flowering and dwarfism in transgenic tobacco plants. Therefore, our findings provide insights on the characterization of NtMADS-box genes to further study their functions in plant development.

Genome-wide analysis of the HAK potassium transporter gene family reveals asymmetrical evolution in tobacco (Nicotiana tabacum)

Being an essential mineral nutrient, potassium (K+) plays numerous important roles in plant growth and development and determines the yield and quality of crop products. The cellular level of K+ is controlled to a large extent by the K+ transporter, which belongs to the KT/HAK/KUP (HAK) family. However, little is known about these genes in tobacco. In this study, we surveyed the tobacco genome and identified 41 putative NtHAK genes (NtHAKS1–NtHAKS21 and NtHAKT1–NtHAKT20). Investigation of the cis-elements in upstream regions of these NtHAK genes suggests that members of this family respond to environmental cues and phytohormones. Expression data mining reveals that NtHAK genes showed clear sub-genome dominance. In all, these results will provide molecular insights into K+ transporter research in tobacco.