scholarly journals Discovery of a glowing millipede in California and the gradual evolution of bioluminescence in Diplopoda

2015 ◽  
Vol 112 (20) ◽  
pp. 6419-6424 ◽  
Author(s):  
Paul E. Marek ◽  
Wendy Moore
Keyword(s):  
Molecular Phylogenetics ◽  
Light Emission ◽  
Sister Group ◽  
High Elevation ◽  
Recent Common Ancestor ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Gradual Evolution ◽  
Directional Change ◽  
Repeated Evolution

The rediscovery of the Californian millipede Xystocheir bistipita surprisingly reveals that the species is bioluminescent. Using molecular phylogenetics, we show that X. bistipita is the evolutionary sister group of Motyxia, the only genus of New World bioluminescent millipedes. We demonstrate that bioluminescence originated in the group’s most recent common ancestor and evolved by gradual, directional change through diversification. Because bioluminescence in Motyxia has been experimentally demonstrated to be aposematic, forewarning of the animal’s cyanide-based toxins, these results are contrary to aposematic theory and empirical evidence that a warning pattern cannot evolve gradually in unpalatable prey. However, gradual evolution of a warning pattern is plausible if faint light emission served another function and was co-opted as an aposematic signal later in the diversification of the genus. Luminescence in Motyxia stem-group taxa may have initially evolved to cope with reactive oxygen stress triggered by a hot, dry environment and was repurposed for aposematism by high-elevation crown-group taxa colonizing new habitats with varying levels of predation. The discovery of bioluminescence in X. bistipita and its pivotal phylogenetic location provides insight into the independent and repeated evolution of bioluminescence across the tree of life.

Early-diverging bumblebees from across the roof of the world: the high-mountain subgenus Mendacibombus revised from species’ gene coalescents and morphology (Hymenoptera, Apidae)

Zootaxa ◽  
2016 ◽  
Vol 4204 (1) ◽  
pp. 1 ◽  
Author(s):  
PAUL H. WILLIAMS ◽  
JIAXING HUANG ◽  
PIERRE RASMONT ◽  
JIANDONG AN
Keyword(s):  
Incomplete Lineage Sorting ◽  
Sister Group ◽  
Process Models ◽  
Coi Gene ◽  
Colour Pattern ◽  
Recent Common Ancestor ◽  
High Mountain ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Colour Patterns

The bumblebees of the subgenus Mendacibombus of the genus Bombus are the sister group to all other extant bumblebees and are unusual among bees for specialising in some of the highest elevation habitats with entomophilous plants on Earth. Most named taxa in this group (24 available names, from a total of 49 published names) were described originally from small differences in the colour pattern of the hair, many as parts (e.g. subspecies) of just one species. Subsequent taxonomic treatments recognised multiple species, but have described very few morphological characters, most of which are in the male genitalia. We examined 4413 specimens representing all of the named taxa from throughout the group’s global range to describe variation in DNA, in skeletal morphology, and in the colour patterns of the hair. Using Bayesian inference of the phylogeny from an evolutionary model for the fast-evolving COI gene, and fitting either general mixed Yule/coalescent models or Poisson tree process models, we identify COI gene coalescents, which are expected to characterise species as evolutionarily independent lineages. None of the conditions most likely to compromise this interpretation (biased sampling, paralogy, introgression, heteroplasmy, incomplete lineage sorting) appears to be a substantial problem in this case. In an integrative analysis, we show that colour patterns are often variable within these groups and do not diagnose the same groups as we recognise from genes; in contrast, the groups recognised from gene coalescents can also be diagnosed from differences we identify in morphology. We infer that the 12 groups with coalescents in the COI gene that are corroborated by morphology constitute species, whereas many of these species are polymorphic in colour pattern. Lectotypes are designated for 15 taxa in order to reduce uncertainty in the identity and application of the names. We provide new morphological keys and distribution maps for the species. Then we use four genes (fast-evolving mitochondrial COI and 16S; and slower nuclear PEPCK and opsin) to obtain an absolute chronogram of phylogenetic relationships among the species. From published estimates that the most recent common ancestor of the subgenus Mendacibombus diverged from the other bumblebees at the beginning of the Oligocene, our results support the crown group of Mendacibombus as having diversified in the late Miocene, events that both appear to have been associated with periods of climate cooling. Relative conservatism in the alpine/subalpine climate niche of Mendacibombus, as compared with the much more diversified climate niches in the sister group of all other bumblebees, may have contributed to constraining the number of Mendacibombus species to just one twentieth of the total number of extant bumblebee species. 

scholarly journals The evolutionary history of Stomatopoda (Crustacea: Malacostraca) inferred from molecular data

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3844 ◽  
Author(s):  
Cara Van Der Wal ◽  
Shane T. Ahyong ◽  
Simon Y.W. Ho ◽  
Nathan Lo
Keyword(s):  
Phylogenetic Analyses ◽  
Sister Group ◽  
Molecular Data ◽  
Recent Common Ancestor ◽  
Ancestral State ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
History Of ◽  
The Tropics ◽  
Age Constraints

The crustacean order Stomatopoda comprises seven superfamilies of mantis shrimps, found in coastal waters of the tropics and subtropics. These marine carnivores bear notable raptorial appendages for smashing or spearing prey. We investigated the evolutionary relationships among stomatopods using phylogenetic analyses of three mitochondrial and two nuclear markers. Our analyses recovered the superfamily Gonodactyloidea as polyphyletic, withHemisquillaas the sister group to all other extant stomatopods. A relaxed molecular clock, calibrated by seven fossil-based age constraints, was used to date the origin and major diversification events of stomatopods. Our estimates suggest that crown-group stomatopods (Unipeltata) diverged from their closest crustacean relatives about 340 Ma (95% CRI [401–313 Ma]). We found that the specialized smashing appendage arose after the spearing appendage ∼126 Ma (95% CRI [174–87 Ma]). Ancestral state reconstructions revealed that the most recent common ancestor of extant stomatopods had eyes with six midband rows of hexagonal ommatidia. Hexagonal ommatidia are interpreted as plesiomorphic in stomatopods, and this is consistent with the malacostracan ground-plan. Our study provides insight into the evolutionary timescale and systematics of Stomatopoda, although further work is required to resolve with confidence the phylogenetic relationships among its superfamilies.

scholarly journals Three Complete Mitochondrial Genomes of Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis (Insecta: Phasmatodea) and Their Phylogeny

Insects ◽  
2021 ◽  
Vol 12 (9) ◽  
pp. 779 ◽  
Author(s):  
Ke-Ke Xu ◽  
Qing-Ping Chen ◽  
Sam Pedro Galilee Ayivi ◽  
Jia-Yin Guan ◽  
Kenneth B. Storey ◽  
...  
Keyword(s):  
Sister Group ◽  
Recent Common Ancestor ◽  
Mitochondrial Genomes ◽  
Sister Group Relationship ◽  
Protein Coding ◽  
Most Recent Common Ancestor ◽  
Stick Insects ◽  
Long Time ◽  
Relationship Of ◽  
Complete Mitochondrial Genomes

Insects of the order Phasmatodea are mainly distributed in the tropics and subtropics and are best known for their remarkable camouflage as plants. In this study, we sequenced three complete mitochondrial genomes from three different families: Orestes guangxiensis, Peruphasma schultei, and Phryganistria guangxiensis. The lengths of the three mitochondrial genomes were 15,896 bp, 16,869 bp, and 17,005 bp, respectively, and the gene composition and structure of the three stick insects were identical to those of the most recent common ancestor of insects. The phylogenetic relationships among stick insects have been chaotic for a long time. In order to discuss the intra- and inter-ordinal relationship of Phasmatodea, we used the 13 protein-coding genes (PCGs) of 85 species for maximum likelihood (ML) and Bayesian inference (BI) analyses. Results showed that the internal topological structure of Phasmatodea had a few differences in both ML and BI trees and long-branch attraction (LBA) appeared between Embioptera and Zoraptera, which led to a non-monophyletic Phasmatodea. Consequently, after removal of the Embioptera and Zoraptera species, we re-performed ML and BI analyses with the remaining 81 species, which showed identical topology except for the position of Tectarchus ovobessus (Phasmatodea). We recovered the monophyly of Phasmatodea and the sister-group relationship between Phasmatodea and Mantophasmatodea. Our analyses also recovered the monophyly of Heteropterygidae and the paraphyly of Diapheromeridae, Phasmatidae, Lonchodidae, Lonchodinae, and Clitumninae. In this study, Peruphasma schultei (Pseudophasmatidae), Phraortes sp. YW-2014 (Lonchodidae), and species of Diapheromeridae clustered into the clade of Phasmatidae. Within Heteropterygidae, O. guangxiensis was the sister clade to O. mouhotii belonging to Dataminae, and the relationship of (Heteropteryginae + (Dataminae + Obriminae)) was recovered.

Hunting the Snark: the flawed search for mythical Jurassic angiosperms

2019 ◽  
Vol 71 (1) ◽  
pp. 22-35 ◽  
Author(s):  
Richard M Bateman
Keyword(s):  
Molecular Phylogenetics ◽  
Common Ancestor ◽  
Explanatory Power ◽  
Sister Group ◽  
Current Evidence ◽  
Phylogeny Reconstruction ◽  
Crown Group ◽  
Companion Cells ◽  
Definition Of ◽  
Cretaceous Fossils

Abstract Several recent palaeobotanical studies claim to have found and described pre-Cretaceous angiosperm macrofossils. With rare exceptions, these papers fail to define a flower, do not acknowledge that fossils require character-based rather than group-based classification, do not explicitly state which morphological features would unambiguously identify a fossil as angiospermous, ignore the modern conceptual framework of phylogeny reconstruction, and infer features in the fossils in question that are interpreted differently by (or even invisible to) other researchers. This unfortunate situation is compounded by the relevant fossils being highly disarticulated two-dimensional compression-impressions lacking anatomical preservation. Given current evidence, all supposed pre-Cretaceous angiosperms are assignable to other major clades among the gymnosperms sensu lato. By any workable morphological definition, flowers are not confined to, and therefore cannot delimit, the angiosperm clade. More precisely defined character states that are potentially diagnostic of angiosperms must by definition originate on the phylogenetic branch that immediately precedes the angiosperm crown group. Although the most reliable candidates for diagnostic characters (triploid endosperm reflecting double fertilization, closed carpel, bitegmic ovule, and phloem companion cells) are rarely preserved and/or difficult to detect unambiguously, similar characters have occasionally been preserved in high-quality permineralized non-angiosperm fossils. The angiosperm radiation documented by Early Cretaceous fossils involves only lineages closely similar to extant taxonomic families, lacks obvious morphological gaps, and (as agreed by both the fossil record and molecular phylogenies) was relatively rapid—all features that suggest a primary radiation. It is unlikely that ancestors of the crown group common ancestor would have fulfilled a character-based definition of (and thereby required expansion of the concept of) an angiosperm; they would instead form a new element of the non-angiosperm members of the ‘anthophyte’ grade, competing with Caytonia to be viewed as morphologically determined sister group for angiosperms. Conclusions drawn from molecular phylogenetics should not be allowed to routinely constrain palaeobotanical inferences; reciprocal illumination between different categories of data offers greater explanatory power than immediately resorting to Grand Syntheses. The Jurassic angiosperm—essentially a product of molecular phylogenetics—may have become the holy grail of palaeobotany but it appears equally mythical.

Deep Divergences within Liolaemus nigroviridis (Squamata, Liolaemidae) Lineages Associated with Sky Islands in Central Chile

Zootaxa ◽  
2013 ◽  
Vol 3619 (1) ◽  
pp. 59-69 ◽  
Author(s):  
FRANCO CIANFERONI ◽  
ROMINA P. YÁÑEZ ◽  
R. EDUARDO PALMA ◽  
CARLOS F. GARIN ◽  
FERNANDO TORRES-PÉREZ
Keyword(s):  
Genetic Divergence ◽  
Common Ancestor ◽  
High Elevation ◽  
Recent Common Ancestor ◽  
Gene Exchange ◽  
Sky Islands ◽  
Central Chile ◽  
Allopatric Populations ◽  
Most Recent Common Ancestor ◽  
Mitochondrial Cytochrome B

Evolution of montane species may be strongly influenced by climate oscillations, particularly species distributed in isolated high-elevation areas (sky islands). Chilean topography is exemplified by montane environments including the Andesand CoastalMountains. To test hypotheses related to genetic divergence associated with sky islands, we explored population genetics and phylogenetic signatures in the montane lizard Liolaemus nigroviridis Müller and Hellmich 1932. We sequenced the mitochondrial cytochrome b for samples collected from six montane areas in central Chile. We found high genetic divergence among populations, congruent with well-supported clades from phylogeny reconstructions. The most recent common ancestor of all samples of L. nigroviridis was dated around the limit of Pliocene-Pleistocene (2.7 Mya), congruent with early vicariance of Andean and coastal populations. Deep lineage divergences suggest that allopatric populations accumulated high nucleotide differences and maintained long periods without gene exchange. We discuss potential taxonomic revisions considering relative genetic divergence.

scholarly journals Corrigendum to: Phylogeny and biogeography of the ant subfamily Myrmeciinae (Hymenoptera : Formicidae)

2003 ◽  
Vol 17 (4) ◽  
pp. 605 ◽  
Author(s):  
Philip S. Ward ◽  
Seán G. Brady
Keyword(s):  
Sequence Data ◽  
Strong Support ◽  
Sister Group ◽  
Molecular Data ◽  
Morphological Data ◽  
Recent Common Ancestor ◽  
Bootstrap Support ◽  
Data Set ◽  
Molecular Sequence Data ◽  
Most Recent Common Ancestor

We investigated phylogenetic relationships among the 'primitive' Australian ant genera Myrmecia and Nothomyrmecia (stat. rev.) and the Baltic amber fossil genus Prionomyrmex, using a combination of morphological and molecular data. Outgroups for the analysis included representatives from a variety of potential sister-groups, including five extant subfamilies of ants and one extinct group (Sphecomyrminae). Parsimony analysis of the morphological data provides strong support (~95% bootstrap proportions) for the monophyly of (1) genus Myrmecia, (2) genus Prionomyrmex, and (3) a clade containing those two genera plus Nothomyrmecia. A group comprising Nothomyrmecia and Prionomyrmex is also upheld (85% bootstrap support). Molecular sequence data (~2200 base pairs from the 18S and 28S ribosomal RNA genes) corroborate these findings for extant taxa, with Myrmecia and Nothomyrmecia appearing as sister-groups with ~100% bootstrap support under parsimony, neighbour-joining and maximum-likelihood analyses. Neither the molecular nor the morphological data set allows us to identify unambiguously the sister-group of (Myrmecia + (Nothomyrmecia + Prionomyrmex)). Rather, Myrmecia and relatives are part of an unresolved polytomy that encompasses most of the ant subfamilies. Taken as a whole, our results support the contention that many of the major lineages of ants – including a clade that later came to contain Myrmecia, Nothomyrmecia and Prionomyrmex – arose at around the same time during a bout of diversification in the middle or late Cretaceous. On the basis of Bayesian dating analysis, the estimated age of the most recent common ancestor of Myrmecia and Nothomyrmecia is 74 million years (95% confidence limits, 53–101�million years), a result consistent with the origin of the myrmeciine stem lineage in the Cretaceous. The ant subfamily Myrmeciinae is redefined to contain two tribes, Myrmeciini (genus Myrmecia) and Prionomyrmecini (Nothomyrmecia and Prionomyrmex). Phylogenetic analysis of the enigmatic Argentine fossils Ameghinoia and Polanskiella demonstrates that they are also members of the Myrmeciinae, probably more closely related to Prionomyrmecini than to Myrmeciini. Thus, the myrmeciine ants appear to be a formerly widespread group that retained many ancestral formicid characteristics and that became extinct everywhere except in the Australian region.

scholarly journals An ancient adenosine receptor gains olfactory function in bony vertebrates

2021 ◽  
Author(s):  
Daniel Kowatschew ◽  
Sigrun I Korsching
Keyword(s):  
Adenosine Receptor ◽  
Olfactory Receptor ◽  
Receptor Gene ◽  
Sister Group ◽  
Olfactory Function ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Double Labeling ◽  
Most Recent Common Ancestor ◽  
Aquatic Vertebrates

Abstract Nucleotides are an important class of odorants for aquatic vertebrates such as frogs and fishes, but also have manifold signalling roles in other cellular processes. Recently, an adenosine receptor believed to belong to the adora2 clade has been identified as an olfactory receptor in zebrafish. Here we set out to elucidate the evolutionary history of both this gene and its olfactory function. We have performed a thorough phylogenetic study in vertebrates, chordates and their sister group, ambulacraria, and show that the origin of the zebrafish olfactory receptor gene can be traced back to the most recent common ancestor of all three groups as a segregate sister clade (adorb) to the adora gene family. Eel, carp, and clawed frog all express adorb in a sparse and distributed pattern within their olfactory epithelium very similar to the pattern observed for zebrafish, i.e. consistent with a function as olfactory receptor. In sharp contrast, lamprey adorb-expressing cells are absent from the sensory region of the lamprey nose, but form a contiguous domain directly adjacent to the sensory region. Double-labeling experiments confirmed the expression of lamprey adorb in nonneuronal cells and are consistent with an expression in neuronal progenitor cells. Thus, adorb may have undergone a switch of function in the jawed lineage of vertebrates towards a role as olfactory receptor.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

2021 ◽  
Author(s):  
Handong Wang ◽  
Ye Chen ◽  
Wei Shi ◽  
Yongyao Guo ◽  
Jinghong He ◽  
...  
Keyword(s):  
Tandem Repeats ◽  
Complete Mitochondrial Genome ◽  
Sister Group ◽  
Recent Common Ancestor ◽  
Phylogenetic Study ◽  
Mitochondrial Genomes ◽  
Evolutionary Analysis ◽  
Habitat Distribution ◽  
Remarkable Feature ◽  
Most Recent Common Ancestor

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

scholarly journals THE USE OF STATISTICAL PHYLOGENETICS IN VIROLOGY

2019 ◽  
Author(s):  
Y. Vakulenko ◽  
A. Lukashev ◽  
A. Deviatkin
Keyword(s):  
Phylogenetic Analysis ◽  
Bayesian Analysis ◽  
Molecular Phylogenetics ◽  
Evolutionary Model ◽  
Amino Acid Sequences ◽  
Recent Common Ancestor ◽  
Virus Infections ◽  
H9n2 Influenza Virus ◽  
Most Recent Common Ancestor ◽  
Phylogenetic Methods

Molecular phylogenetics, and, in particular, statistical phylogenetics is widely used to solve the fundamental and applied problems of virology. Bayesian, or statistical, phylogenetic methods, which came into practice 10-15 years ago, significantly expanded the range of questions that can be answered based on the analysis of nucleotide and amino acid sequences. The ability to use different evolution models allows infering the chronology, geography and dynamics of the infection spreading. For example, analysis of a globally distributed HIV group M by Bayesian methods demonstrated with a probability of 99% that the most recent common ancestor of these viruses existed in the surroundings of the city of Kinshasa (Democratic Republic of the Congo) in the early 1920s. Another study showed that H9N2 influenza virus most likely passed on to humans from wild ducks in Hong Kong in the late 1960s. In addition, using the Bayesian analysis allows evaluating the effect of measures taken on the development of the epidemic process. For example, it was retrospectively shown that the number of hepatitis C virus infections in Egypt increased by several orders of magnitude in the middle of the twentieth century. A sharp increase is associated with the treatment for schistosomiasis using non-sterile repeatedly used syringes. A set of Bayesian analysis methods has been used in tens of thousands of publications describing various aspects of the occurrence and spread of infectious diseases in humans and animals. This was facilitated by the development and accessibility of software that implements these methods. The complexity of Bayesian phylogenetic methods imposes strict requirements on the data being analyzed. The correctness of the phylogenetic analysis results depends on various factors. For example, it is necessary to choose an evolutionary model that most adequately describes the studied objects. A mandatory step in formulating the results is the justification of the selected model. For viruses, the acquisition of genetic elements from other organisms is typical, therefore, the genomes of even closely related viruses may have non-homologous regions unsuitable for phylogenetic analysis. Another aspect is the creation of a representative dataset. All stages of the analysis sometimes are not indicated in publications, which is why obtained results can be interpreted ambiguously. The correct use of statistical phylogenetics methods in virology is possible only with an understanding of their principles, proper methods of data preparation and evolutionary models selection criteria.

scholarly journals The age of flowering plants is unknown

2021 ◽  
Author(s):  
Hervé Sauquet ◽  
Santiago Ramírez-Barahona ◽  
Susana Magallón
Keyword(s):  
Molecular Data ◽  
Flowering Plants ◽  
Molecular Dating ◽  
Flowering Plant ◽  
Recent Common Ancestor ◽  
Crown Group ◽  
Most Recent Common Ancestor ◽  
Research Fields ◽  
History Of ◽  
Future Work

The origin of flowering plants (angiosperms) was one of the most transformative events in the history of our planet. Despite considerable interest from multiple research fields, numerous questions remain, including the age of the group as a whole. Recent studies have reported a perplexing range of estimates for the crown-group age of angiosperms, from ca. 140 Ma (Early Cretaceous) to 270 Ma (Permian). Both ends of the spectrum are now supported by both quantitative analyses of the fossil record and fossil-calibrated molecular dating analyses. Here, we first clarify and distinguish among the three ages of angiosperms: the age of their divergence with acrogymnosperms (stem age), the age(s) of emergence of their unique, distinctive features including flowers (morphological age), and the age of the most recent common ancestor of all their living species (crown age). We then demonstrate, based on recent studies, that fossil-calibrated molecular dating estimates of the crown-group age of angiosperms have little to do with either the amount of molecular data or the number of internal fossil calibrations included. Instead, we argue that this age is almost entirely conditioned by its own prior. Lastly, we discuss which future discoveries or novel types of analyses are most likely to bring more definitive answers. In the meantime, we propose that the age of angiosperms is best described as unknown (140–270 Ma) and that future work that depends on the time scale of flowering plant diversification be designed to integrate over this vexing uncertainty.

Sign in / Sign up

Export Citation Format

Share Document