scholarly journals Termites (Insecta: Isoptera) diversity in forest conseccion areas of PT Inhutani I, Indonesia

2021 ◽  
Vol 886 (1) ◽  
pp. 012129
Author(s):  
A Arif ◽  
M Muin ◽  
G Putri ◽  
MT Hidayah
Keyword(s):  
Morphological Characteristics ◽  
Morphological Characters ◽  
Head Width ◽  
Pine Plantation ◽  
Maximum Width ◽  
South Sulawesi ◽  
Transect Sampling ◽  
Sampling Protocols ◽  
Left Mandible ◽  
Mandible Length

Abstract Termites as wood biodeterioration agents have an important role in the ecosystem. This study aimed to observe termite diversity. A termites survey was conducted on Forest Concession Areas of PT. Inhutani I, South Sulawesi Indonesia. The termite specimens collected used the standardized transect sampling protocols at three different sites (forest with mixed vegetation, Pinus merkusii plantation, and logged-over area; and measurement of nine morphological characters of the soldier was conducted, i.e: head length without mandibles, head width at base of mandible, maximum width of head, left mandible length, pronotum length, maximum width of pronotum, postmentum length, postmentum width of postmentum, and the number of antenna segments. The results showed that there are four species found based on the morphological characteristics and morphometrical data, namely: Odontotermes javanicus., Nasutitermes sp., Schedorhinotermes sp. and Coptotermes curvignathus. The highest termite abundance was found in forest with mixed vegetation. The termite diversity in logged-over area and forest with mixed areas was moderate, while species diversity in pine plantation was low.

scholarly journals Short Communication: Morphological characteristics and morphometric of Stingless Bee (Apidae: Hymenoptera) from Banten Province, Indonesia

2019 ◽  
Vol 20 (6) ◽  
Author(s):  
ADE EFIN ◽  
TRI ATMOWIDI ◽  
TARUNI SRI PRAWASTI
Keyword(s):  
Male Genitalia ◽  
Stingless Bees ◽  
Short Communication ◽  
Morphological Characteristics ◽  
Morphological Characters ◽  
Stingless Bee ◽  
Morphometric Study ◽  
Head Width ◽  
Nest Entrance ◽  
Morphometric Measurements

Abstract. Efin A, Atmowidi T, Prawasti TS. 2019. Short Communication:  Morphological Characteristics and Morphometric of Stingless Bee (Apidae:  Hymenoptera) from Banten Province, Indonesia. Biodiversitas 20:  1693-1698. Tetragonula (Meliponini:  Apidae) belong to stingless bees that characterized by complex communication, permanent colonies with division of castes, i.e., queen, males, and workers. This paper described morphological characters and morphometric study of stingless bee from Pandeglang, Banten Province, Indonesia. Local people (Sundanese) known as the specimen examined is “teuweul omas” that have different in nest entrance characteristics compare to nest of Tetragonula laeviceps found commonly. In average, specimens examined were 4.445±0.072 mm body length, 1.911±0.019 mm head width, mesoscutum has distinct hair bands separated by glabrous interspaces area, with plumose frontal hairs, and black metasoma, legs, and hairs on the frontal. Male genitalia of stingless bee examined are long gonostylus and slender with sparse hairs at apex, penis valve is very robust, tapering at the apex and shorter than gonostylus. Based on morphological characteristics and morphometric measurements, we identified the specimen examined is Tetragonula cf. laeviceps.

Inheritance of Some Morphological Characteristics of Parental Lines in Mustard-Rape Hybrid

2020 ◽  
pp. 23-30
Keyword(s):  
First Generation ◽  
Agronomic Traits ◽  
Morphological Characteristics ◽  
Morphological Characters ◽  
Hybrid Plant ◽  
Distant Hybridization ◽  
Degree Of Dominance ◽  
Whole Plant ◽  
Row Width ◽  
The Difference

Distant hybridization is known to play an important role in expanding the gene pool of any crop. It is believed that the combination of different genomes in one nucleus, as a rule, is accompanied by the phenomenon of “genomic shock”, resulting in a variety of genetic and epigenetic changes. This provides a wealth of material for the selection of genotypes adapted to different environmental conditions. Interspecific hybrids in different combinations were obtained in the genus Brassica, however, until now, interest in distant hybridization in this genus has not died out, since such important crops as rapeseed and mustard demand an improvement of many important agronomic traits. The aim of this work was to study the degree of manifestation of morphological characters of a leaf, flower, and plant as a whole in the hybrid obtained by crossing of brown mustard of the variety Slavyanka and a collection specimen of spring rape. Seeds were sown in the spring of 2019 in a field with 30 cm row width. During the flowering period a number of morphological characters of a flower, leaf, and the whole plant were analyzed. Each parameter was evaluated with 10 plants. The degree of dominance in first-generation hybrid was calculated by the formula of Beil, Atkins (1965). The dominance coefficients were not determined in the case when the difference between the parental samples was insignificant. Differences between parental samples were determined by Student t-test. The level of heterosis was calculated according to the formula of Rasul et al (2002). In a mustard-rapeseed hybrid, the size of the leaves of the lower row was inherited by the type of rapeseed, which had larger leaves than mustard. The height of the hybrid plant was inherited by the type of mustard (hp = 1.32, Ht = 4.89%), and intermediate inheritance was observed for the length of the internodes (hp = -0.48). The size of the flower petals and sepals was inherited by the type of rapeseed, and significant heterosis was observed for the length of the pistil (Ht = 33.57%). The data obtained are of interest for understanding the interaction of genes of different genomes in the genus Brassica.

scholarly journals Morphometry and Phylogeny of the Different Populations of Selaginella tamariscina (P. Beauv.) Spring and S. pulvinata (Hook. & Grev.) Maxim. in Northern Thailand

2021 ◽  
Vol 20 (4) ◽  
Author(s):  
Udon Pongkawong ◽  
◽  
Jatupol Kampuansai ◽  
Rossarin Pollawatn ◽  
Arunothai Jampeetong ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Southern China ◽  
Phylogenetic Analyses ◽  
Dna Barcode ◽  
Morphological Characteristics ◽  
Taxonomic Status ◽  
Morphological Characters ◽  
The Philippines ◽  
Northern Thailand ◽  
Selaginella Tamariscina

Abstract “Dok Hin” is the Thai local name for Selaginella species that form rosettes. They commonly distributes in Siberia, Manchuria, southern China, Japan, the Philippines and Thailand. Morphology of Dok Hin is very resemble leading to misidentification. So, exactly number of species of Dok Hin in Thailand and their differences in morphological characteristics is not well understood. Thus, revision of morphological characters and phylogenetic confirmation of the taxonomic identification are needed. This study aims to examine morphological charateristics and phylogenetic patterns in eight populations of the Dok Hin in Northern Thailand. Morphology of Dok Hin from each populations was quantitatively examined using 15 vegetative and 6 reproductive characters meanwhile phylogenetic analyses was explored by DNA barcode ITS2. The results of the phylogenetic analysis revealed the existence of two species of Dok Hin, S. tamariscina and S. pulvinata. Selaginella tamariscina can be distinguished from S. pulvinata by its presence of a pseudotrunk above ground and ridges of dorsal leaves. On the other hand, the results of phylogenetic analysis indicated the differences among populations of S. pulvinata as well. Chiang Mai populations of S. pulvinata was characterized by peculiar set of characters long leaves and leaf apices look like caudate, while the rest of their populations have shorter leaves and leaf apices look like aristate. It indicates that S. pulvinata has genetic and phenotypic divergence among populations. However, additional studies of Dok Hin populations in other parts of Thailand and studies on different genetic markers are necessary to confirm the taxonomic status of S. pulvinata. Keywords: Dok Hin, Morphometric, Phylogeny, Pseudotrunk, Resurrection plant

scholarly journals Gübrelemenin Kayacık (Ostrya carpinifolia Scop.) Fidanlarının Morfolojik Gelişimine Etkisi

2016 ◽  
Vol 4 (10) ◽  
pp. 813 ◽  
Author(s):  
Şemsettin Kulaç ◽  
Özge Yıldız
Keyword(s):  
Morphological Characteristics ◽  
Vegetation Period ◽  
Morphological Characters ◽  
Morphological Development ◽  
Compound Fertilizer ◽  
Seedling Length ◽  
Collar Diameter ◽  
Root Collar ◽  
Ostrya Carpinifolia ◽  
Made In

In this study, in order to help the mass production of seedlings, the effect of fertilization on the morphological development of hornbeam leafy European hophornbeam (Ostry carpinifolia Scop) seedlings were investigated. For this, seedlings, which were obtained from the seeds coming from different European hophornbeam populations (Düzce-Yığılca, Antalya-Finike, Antalya-Akseki, Kastamonu-Şehdağ ve Adana-Saimbeyli) from various parts of Turkey, were used. European hophornbeam seedlings were treated with different fertilizers, including urea, ammonium sulphate, compound fertilizer 15-15-15 and 20-20-0, and 6-9 months Osmocote release fertilizer, and effects of these fertilizers on the morphological characters were investigated. Fertilization contained the same amount of nitrogen, and was made in three different ways; (1) mixing with habitat, (2) topical application and (3) liquid application. The development of germinated European hophornbeam seeds, which were spring-sowed in the same medium were monitored during the vegetation period. At the end of vegetation period, seedlings were removed from the soil and morphological characteristics of root (seedling length, root collar diameter, root length, fresh root and stem weight of the seedlings, dried root and stem weight of the seedlings and bud number) were measured. As a result, it was observed that fertilization positively affects the development of seedlings and depending on the fertilization type the seedlings of European hophornbeam populations were found to exhibit different improvements/growing. In addition, 6-9 months Osmocote release fertilizers were determined to be the best fertilizers affecting the morphological (diameter and height) development of European hophornbeam populations effectively, and among the populations, Düzce and Kastamonu populations showed the best improvement/growing.

scholarly journals Study morphology of loquat plants (Eriobotrya Japonica Lindl.) from Karo, Dairi, and Simalungun Districts, North Sumatra

2021 ◽  
Vol 912 (1) ◽  
pp. 012103
Author(s):  
Elimasni ◽  
R A Nasution
Keyword(s):  
Binary Data ◽  
Morphological Characteristics ◽  
Morphological Characters ◽  
Seed Morphology ◽  
Flowering Plant ◽  
Morphological Data ◽  
Eriobotrya Japonica ◽  
Morphological Observation ◽  
Limited Information ◽  
The Public

Abstract Abstrak. Loquat (Eriobotrya japonica Lindl.) is a flowering plant that belongs to the Rosacea family. The loquat has many health benefits. Cultivation and information about loquat plants in Indonesia are still limited, so they are rarely found and known by the public. Limited information and data regarding loquat plants is also an obstacle to the development of loquat plants. Research on loquat plants aims to analyze the morphological characters in three districts, namely, Karo, Dairi, and Simalungun districts. This research was conducted using a descriptive method. The analysis of the morphological characteristics of loquat plants using morphological data scoring into binary data. The similarity between individuals was analyzed using clusters with the NTSYS program version 2.0 with the UPGMA method of the SimQual function. Morphological Observation Results Loquat plants (Eriobotrya japonica Lindl.) in Karo, Dairi, and Simalungun Districts have uniform characters in the morphology of stems, leaves, and flowers. However, the observed fruit and seed morphology showed different characters. Different characters exist in the shape of the fruit and seeds. The morphological similarity level of loquat plants was grouped at a similarity coefficient value of 95%. Clusters I and II have the highest similarity with a coefficient value of 100%. Cluster III has the lowest similarity with a coefficient value of 97%.

New species reveal unexpected interspecific microhabitat diversity in the genus Uthina Simon, 1893 (Araneae : Pholcidae)

2019 ◽  
Author(s):  
Bernhard A. Huber ◽  
Kai R. Caspar ◽  
Jonas Eberle
Keyword(s):  
New Species ◽  
Natural History ◽  
New Records ◽  
Morphological Diversity ◽  
Morphological Characters ◽  
Molecular Data ◽  
South Sulawesi ◽  
Species Pairs ◽  
Three New Species ◽  
Colour Dimorphism

Representatives of the Southeast Asian pholcid spider genus Uthina Simon, 1893 have been thought to be very homogeneous in their ecology and morphology. The 14 previously known species all inhabit near-ground microhabitats and cave entrances, and range from pale to dark brown in colour. Even their genitalia are partly very similar, with some species pairs being barely distinguishable based on morphological characters. Here we describe three new species from Bali, Java and Sulawesi that represent three further microhabitats and demonstrate considerable ecological and morphological diversity within the genus: U. maya, sp. nov. from Bali is a large dark species on tree trunks; U. hylobatea, sp. nov. from Bali and eastern Java is a pale leaf-dwelling species that exhibits colour dimorphism; and U. mimpi, sp. nov. is a pale troglomorphic species collected in the aphotic zones of two South Sulawesi caves. In addition, we present new data for five previously described species, including ultrastructure, natural history, new records, taxonomic notes and a description of the previously unknown female of Uthina khaosokensis Yao, Li & Jäger, 2014. Molecular data suggest that all previously described species are very closely related to each other (constituting the monophyletic luzonica-group), and that the three new species represent separate clades within the genus. However, the basal trichotomy could not be resolved: U. maya + (U. hylobatea + U. mimpi) + luzonica-group.

scholarly journals Morphological variability of acorns and its taxonomic significance in Quercus. from Turkey

2015 ◽  
Vol 43 (3) ◽  
pp. 293-299 ◽  
Author(s):  
Y Bakis ◽  
MT Babaç
Keyword(s):  
Principal Component Analysis ◽  
Morphological Variability ◽  
Morphological Characteristics ◽  
Principal Component ◽  
Component Analysis ◽  
Morphological Characters ◽  
Taxonomic Significance ◽  
Morphological Variations ◽  
Quercus Species ◽  
Different Populations

Morphological variations of acorn among and within the groups of Quercus species were studied. A total of 617 acorns belonging to 14 species representing all 3 sections of Quercus L. (Fagaceae) in Turkey were examined in this study. Specimens were collected from 47 different populations over both Anatolian and Thrace part of Turkey. Principal component analysis was used to analyze the morphological characteristics of acorns. Results obtained from this study demonstrate the use of morphological characters in differentiating the taxa of Quercus and Cerris sections studied. Another important finding is the introgression among the acorns of species within Quercus section DOI: http://dx.doi.org/10.3329/bjb.v43i3.21601 Bangladesh J. Bot. 43(3): 293-299, 2014 (December)

On-farm characterization and present status of North Bengal Grey (NBG) cattle in Bangladesh

2007 ◽  
Vol 40 ◽  
pp. 55-64 ◽  
Author(s):  
M. Al-Amin ◽  
A. Nahar ◽  
A.K.F.H. Bhuiyan ◽  
M.O. Faruque
Keyword(s):  
Morphological Characteristics ◽  
Live Weight ◽  
Coat Colour ◽  
The Body ◽  
Head Width ◽  
Gestation Length ◽  
Indigenous Cattle ◽  
Average Birth Weight ◽  
Improvement Programs ◽  
North Bengal

SummaryNorth Bengal Grey (NBG) cattle are an important indigenous cattle genetic resource found mainly in the northern part of Bangladesh. The study was undertaken at Bogra Sadar, Shibgonj and Kahalu Upazila (sub-district) in the Bogra district. The physical and morphological characteristics, and the productive and reproductive performances of NBG cattle were studied. The coat colour of these animals is deep grey to white. The coat colour of the neck region in adult bulls was found to be generally ashy with a range of shades.The body is small, compact and less fleshy. Ear length and ear width were 18.0±0.17 and 11.0±0.21 cm, respectively. The head length average was 38.0±0.56 cm, the head width 16.0±0.17 cm, the foreleg length average 65.0±0.64 cm, the hind leg length 71.0±0.64 cm, the tail length average 71.0±0.67 cm, the horn length average 9.0±0.39 cm, the horn diameter 10.0±0.37 cm, the average teat length 5.0±0.18 cm, the teat diameter 6.0±0.22 cm, the distance betweenthe front teats 7.0±0.13 cm and the distance between the rear teats 7.0±0.13 cm. Body length, height at wither and heart girth in adult cows were 105.0il.20, 94.0+1.12 and 127.0±1.52 cm, respectively.The recorded highest peak milk production per day was 3.5±0.18 kg, lactation length was 219±6.1 days, and the dry period was 180±6.8 days. The average birth weight of calves was 18.4±0.52 kg and mature live weight of cows 241.0±4.0 kg. The age at first heat was 869±29.6 days, age at first calving 1191±19.7 days, gestation length 281±1.3 days, calving interval 442±7.4 days, postpartum heat period 110±4.2 days and the number of services per conception 1.4±0.6. About 54% of total cattle population was NBG cattle in the surveyed area of Bangladesh. The results indicated that the productive and reproductive performance of NBG cattle was better than other non-descript indigenous cattle of Bangladesh. The study further revealed an obvious need for more in-depth and objective information on wider samples of this type of indigenous cattle in order to assess the future need for conservation and improvement programs to be undertaken.

scholarly journals First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona
Keyword(s):  
Rhizoctonia Solani ◽  
Morphological Characteristics ◽  
Its Region ◽  
Morphological Characters ◽  
Anastomosis Group ◽  
Staining Procedure ◽  
Nuclear Staining ◽  
Tobacco Plants ◽  
First Report ◽  
Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Sign in / Sign up

Export Citation Format

Share Document