scholarly journals First report of clover yellow vein virus on orchid (Dendrobium sp.) in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Ju-Yeon Yoon ◽  
In Sook Cho ◽  
Bong Nam Chung ◽  
Seung-Kook Choi
Keyword(s):  
South Korea ◽  
Complete Genome ◽  
High Throughput Sequencing ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Virus Species ◽  
Total Rna ◽  
First Report ◽  
Three Samples ◽  
Clover Yellow Vein Virus

Orchid is one of the most popular and commercially important cultivated flowers in the world. Among many orchid species, Dendrobium species are popular cut flowers and potted plants in South Korea. In March 2019, 10 Dendrobium orchid plants in a greenhouse in Daegu, South Korea showed large chlorotic blotches, mosaic and mottle symptoms. One leaf each from the 10 symptomatic orchid plants by leaf dip-preparations and transmission electron microscopy (JEM-1400; JEOL Inc., Tokyo, Japan) after leaf dip-preparations (Brenner and Horne 1959; Richert-Pöggeler et al. 2019). Typical potyvirus-like particles of flexuous and filamentous shape and ∼ 760 × 15 nm length/width were observed in all tested samples. The presence of potyvirus was confirmed by serological detection with a commercially available ImmunoStrip® for potyvirus group (Agdia, Elkhart, USA). In contrast, a negative result was obtained for a virus-free Dendrobium plant by the serological test. The two most common viruses in orchids, namely odontoglossum ringspot virus (ORSV) and cymbidium mosaic virus (CymMV) in all Dendrobium samples were not detected in any samples by an ImmunoStrip® for ORSV and CymMV (Agdia, Elkhart, USA). To determine the species of the virus, total RNA was extracted from all 10 ImmunoStrip®-positive samples using the RNeasy plant mini kit (Qiagen, Hilden, Germany). Subsequently, reverse transcription-PCR (RT-PCR) products (~1,625 bp) were amplified using potyvirus- specific primer pair (Gibbs and Mackenzie, 1997) and sequenced by the Sanger method at Macrogen (Seoul, South Korea). Sequencing results showed 100% nucleotide identity among 10 samples. Thus, one sequence was chosen for identification of virus species using sequence comparison. BLASTn analysis showed that the nucleotide sequence and its deduced amino acid sequence of the amplicon shared 95.4-98.7% and 96.2-99.6% identity to multiple clover yellow vein virus (ClYVV) sequences (e.g., accession no. AB011819) in GenBank. To further confirm the presence of ClYVV and determine if other viral agents were present in the samples, total RNA from three of the 10 symptomatic plants was depleted of ribosomal RNAs and subjected to high-throughput sequencing (HTS) analysis on a HiSeq 4000 platform (Macrogen Inc., Seoul, South Korea). A total of 3,764,432, 4,203,881, and 4,139,775 of 150-bp paired-end clean reads were obtained for the three samples. After de novo assembly of the reads with Trinity (Haas et al. 2013), 5, 6 and 7 contigs were obtained and searched with BLASTn against NCBI viral refseq database. Eighteen contigs from all three samples sized at 2,176-9,432 nt exhibited 94.0-97.9% nucleotide identity with the complete genome sequences of other ClYVV isolates (e.g., accession no. AB011819) deposited in Genbank; no other viruses were identified by HTS. The complete genome sequence (9,585 nucleotides in length) of ClYVV Dendrobium isolate (ClYVV-Den) was determined using ClYVV-specific primers (Takahashi et al., 1997) and the sequence of CIYVV-Den was deposited to GenBank (Accession no. LC506604). Together, these results support that symptomatic Dendrobium orchids were infected with ClYVV-Den in this study. ClYVV has been previously reported affecting Calanthe orchids in Japan (Inouye et al., 1988; Ikegami et al., 1995). Our results suggest that ClYVV may be detrimental to the production of Dendrobium orchids or commercial ornamental crops in South Korea. To our knowledge, this is the first report of ClYVV in Dendrobium sp. in South Korea.

scholarly journals First Report of Grapevine Kizil Sapak Virus in Grapevine in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Fang Ren ◽  
Zunping Zhang ◽  
Xudong Fan ◽  
Guojun Hu ◽  
Yafeng Dong
Keyword(s):  
Complete Genome ◽  
High Throughput Sequencing ◽  
Pairwise Comparison ◽  
Bioinformatic Analysis ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Pcr Products ◽  
Rapid Amplification

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. ‘Crimson Seedless’ (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5’-TAGTCTGGATTTCCCTACCT/5’-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5’-GCCACTGGTGAATGAAAAGA/5’-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5’/3’ Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a ‘Black Monukka’ grape (native to India) also sampled from Xinjiang. Both PCR products of ‘Black Monukka’ were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

scholarly journals First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hae-Ryun Kwak ◽  
Hui-Seong Byun ◽  
Hong-Soo Choi ◽  
Jong-Woo Han ◽  
Chang-Seok Kim ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
East Asia ◽  
Rna Extraction ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

scholarly journals First report of grapevine virus L infecting grapevine in southeast France

Plant Disease ◽  
2022 ◽  
Author(s):  
Laurence Svanella ◽  
Armelle Marais ◽  
Thierry Candresse ◽  
Marie Lefebvre ◽  
Jerome Lluch ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Protein Gene ◽  
The United States ◽  
Read Length ◽  
Nucleic Acid Binding ◽  
Grapevine Virus ◽  
Total Rna ◽  
First Report ◽  
Grapevine Virus A ◽  
Hop Stunt Viroid

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l’Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3’ end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the “Plan National Dépérissement du Vignoble” (Mycovir project) for the financial support

scholarly journals First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum)

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 701-701 ◽  
Author(s):  
W. S. Tsai ◽  
S. L. Shih ◽  
L. M. Lee ◽  
L. M. Dolores ◽  
L. Kenyon
Keyword(s):  
Dna Sequences ◽  
Disease Incidence ◽  
The Philippines ◽  
Open Reading Frames ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Plant Sample ◽  
First Report ◽  
Conserved Sequence ◽  
Vein Disease

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)—two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)—and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

scholarly journals First report of grapevine virus H (GVH) in grapevine in Greece

Plant Disease ◽  
2021 ◽  
Author(s):  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Chrysoula-Lyto Sassalou ◽  
E. Gagiano ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Virus Genome ◽  
Composite Sample ◽  
Grapevine Virus ◽  
Northern Greece ◽  
Total Rna ◽  
First Report ◽  
The Usa

Grapevine virus H (GVH) is a member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae, order Tymovirales) that infects grapevine (Candresse et al., 2018). GVH was first identified in a symptomless grapevine of an unknown cultivar from Portugal in 2018 (Candresse et al. 2018), and since then the virus has been reported only from California (Diaz‑Lara et al. 2019). Several vitiviruses have been detected in Greek vineyards (Avgelis and Roubos 2000; Dovas and Katis 2003a; 2003b; Panailidou et al. 2019; Lotos et al. 2020), but no information was available on the presence of GVH. In the fall of 2020, in order to investigate the virome of a commercial vineyard of the cultivar Assyrtiko in northern Greece, a composite sample was made of leaves and petioles from nine vines exhibiting leafroll disease symptoms. Total RNA was extracted from the composite sample according to the protocol of White et al. (2008) and subjected to rRNA depletion, library construction (TruSeq Stranded Total RNA kit), and high-throughput sequencing (HTS) in a NovaSeq6000 platform (Illumina Inc.) at Macrogen (Korea). The resulting ~42 million 101-nt paired-end reads were analyzed in Geneious Prime 2020, and the assembled de novo contigs were subjected to a local BLASTn search, which revealed the presence of 18 grapevine infecting viruses and viroids, among which also a GVH-like contig (GeA-9). GeA-9 was 7,404 nucleotides (nt) long, covering 99.4% of the full virus genome and shared 98.2 % nt identity with a GVH isolate from the USA (MN716768). To confirm the presence of GVH, the nine samples of the cultivar Assyrtiko, used initially to produce the composite sample for HTS analysis, were tested individually by RT-PCR, using the primers GVH_F_2504 (5’-CTGCTTCGCTGAACATATGC-3’) and GVH_R_2835 (5’-ATCATTRTGATCGAGAGAGTAGTG-3’) that amplify a 331-nt segment of ORF1. GVH was detected in five out of the nine tested samples and one of these was reamplified and subjected to Sanger sequencing. The fragment of ORF1 obtained by Sanger sequencing (MW460005) was 97.5% identical to the nucleotide sequence of the corresponding GVH-like de novo contig (GeA-9) from HTS analysis and it shared 97.2% nt identity with GVH sequences reported from Portugal and USA, respectively (NC_040545 and MN716768), confirming the presence of GVH in the tested samples. This is the first report of GVH in grapevine in Greece, thus further increasing the number of vitiviruses known to infect Greek vineyards and also expanding the number of geographic locations in which GVH is recorded so far.

scholarly journals First report of Coguvirus eburi infecting pear (Pyrus communis) in South Africa

Plant Disease ◽  
2021 ◽  
Author(s):  
Kayleigh Bougard ◽  
Hans Jacob Maree ◽  
Gerhard Pietersen ◽  
Julia Christine Meitz-Hopkins ◽  
Rachelle Bester
Keyword(s):  
South Africa ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Pyrus Communis ◽  
Rt Pcr ◽  
Disease Symptoms ◽  
Total Rna ◽  
First Report ◽  
Pcr Assays

Coguvirus eburi is a member of the genus Coguvirus in the family Phenuviridae (Khun et al., 2020). The species Coguvirus eburi was established to include citrus virus A (CiVA), which is a negative-sense, single-stranded RNA virus that was first found infecting sweet orange in southern Italy via high-throughput sequencing (HTS) (Navarro et al., 2018). This virus was also found to infect pome fruits in France, such as pear (Svanella-Dumas et al., 2019). More recently CiVA infections have been associated with impietratura disease in citrus (Beris et al. 2021). In the summer of 2021, leaf samples were collected from a pear tree (Pyrus communis cv. Bosc, B175) in the Koue Bokkeveld, South Africa as part of a virus survey. Sample B175 displayed no visual disease symptoms. One gram of leaf petioles was used for total RNA extraction, using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA was prepared (Ribo-Zero Plant kit) and a sequencing library constructed (Illumina TruSeq Stranded Total RNA). The RNA library was paired-end (2 × 100 bp) sequenced on an Illumina HiSeqX instrument (Macrogen, South Korea). A total of 47,750,152 reads were obtained. Raw data was trimmed for quality with Trimmomatic (SLIDINGWINDOW:3:20, MINLEN:20) (Bolger et al. 2014). De novo assembly performed with CLC Genomics Workbench 11.0.1 (Qiagen) (Default parameters) using high quality reads yielded 75250 contigs. BLASTn analysis identified two viral contigs with high nucleotide (nt) identity to apple stem pitting virus (ASPV) and CiVA. The CiVA contig was 9400 nts and on closer examination, a concatemer of CiVA RNA1 and RNA2. The concatenation occurred due to the characteristic near-identical nucleotides shared at the 5’ and 3’ ends of RNA1 and RNA2 of these negative-stranded RNA viruses (Navarro et al., 2018). After splitting and curation, the RNA1 contig was 6664 nts and the RNA2 contig 2686 nts. A total of 51397 and 34820 reads were used to construct these contigs resulting in an average depth of coverage of 761 and 1281 for RNA1 and RNA2, respectively. The contigs had the highest nt identity to the complete CiVA GenBank accessions MT720885.1 (95.53%) and MW148460.1 (96.03%), spanning 99.6% and 98.1 % of the genomes of RNA1 and RNA2, respectively. These contigs were submitted as partial genomes to GenBank as accessions MZ463039 and MZ463040. Reverse transcription polymerase chain reaction (RT-PCR) was used to validate the presence of CiVA in sample B175. Two RT-PCR assays, directed at RNA1 and RNA2 respectively (Bester et al. (2021)) were used to generate amplicons. Amplicon sequences were confirmed with bi-directional Sanger sequencing. Twenty-one additional samples from the same orchard as B175 as well as other samples from the Koue Bokkeveld and Elgin areas, including cultivars Abate (10 samples), Forelle (10 samples), Early Bon Chretien (3 samples), Packham’s Triumph (12 samples) and Rosemarie (3 samples), were all surveyed for CiVA using the same RT-PCR assays as mentioned above. Thirty-six of the 59 samples tested were positive for CiVA, which further confirms the presence and wide-spread distribution of this virus in the limited survey conducted in pears in South Africa. However, no association with any disease symptoms or specific cultivar were identified. This is the first report of CiVA infecting pear in South Africa. This study therefore contributed to investigating the distribution of this virus and will assist the South African plant material certification scheme to assess the incidence of CiVA in South Africa.

scholarly journals First report of Tobacco ringspot virus in highbush blueberry in Washington State

Plant Disease ◽  
2021 ◽  
Author(s):  
Arunabha Mitra ◽  
Sridhar Jarugula ◽  
Gwen Hoheisel ◽  
Naidu Rayapati
Keyword(s):  
South Korea ◽  
Vaccinium Corymbosum ◽  
Washington State ◽  
Ringspot Virus ◽  
Highbush Blueberry ◽  
Korean Isolate ◽  
Total Rna ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Cherry Leaf Roll Virus

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

scholarly journals First Report of Sweet potato leaf curl virus on Blue Morning Glory in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 700-700 ◽  
Author(s):  
E. Fiallo-Olivé ◽  
N. I. Katis ◽  
J. Navas-Castillo
Keyword(s):  
Sweet Potato ◽  
Rolling Circle Amplification ◽  
Morning Glory ◽  
Yellow Vein ◽  
Nucleotide Identity ◽  
Potato Leaf ◽  
First Report ◽  
Crete Island ◽  
Leaf Curl Virus ◽  
Leaf Curl

Blue morning glory (Ipomoea indica, Convolvulaceae) plants are widespread along the Greek coast, where they grow as weeds in addition to being cultivated as ornamentals. Yellow vein symptoms are frequently observed on these plants. These symptoms are similar to those reported for isolates of Sweet potato leaf curl virus (SPLCV) infecting I. indica in Italy and Spain (1,3). SPLCV belongs to the sweepoviruses, a unique group within the genus Begomovirus in the family Geniminiviridae that infects sweet potato (I. batatas) crops around the world. In May 2013, three leaf samples of I. indica showing yellow vein symptoms were collected in Kolymbari (Crete Island), where ~50% of the observed plants were symptomatic, and five asymptomatic leaf samples were collected in Kremasti and Mandriko (Rhodes Island). Total DNA, isolated from all samples, was used as a template in rolling-circle amplification (RCA) using ϕ29 DNA polymerase (TempliPhi kit, GE Healthcare, Little Chalfont, UK) and the product was digested with a set of restriction endonucleases. The samples from Kolymbari and one sample from Kremasti yielded amplification products that were shown to contain a single BamHI site. The DNA fragments of ~2.8 kbp obtained from one sample from each island were cloned into pBluescript II SK(+) (Stratagene, La Jolla, CA). Inserts of two clones from the Kolymbari sample and one clone from the Kremasti sample were completely sequenced (Macrogen, Seoul, South Korea). Sequences were aligned with available sequences of sweepoviruses using MUSCLE and pairwise identity scores were calculated with SDT as described (4). The sequences obtained from Kolymbari (2,830 nt, GenBank Accession Nos. KF697069 and KF697070) were 98.8% similar between them and showed the highest nucleotide identity (97.7%) with a SPLCV isolate obtained from an I. indica plant in Sicily Island (Italy) (AJ586885) (1). The sequence obtained from Kremasti (2,804 nt, KF697071) showed the highest nucleotide identity (92.4%) with a SPLCV isolate (previously named as Ipomoea yellow vein virus, which is currently a synonym of SPLCV [2]) obtained from an I. indica plant from southern Spain (EU839578) (3). Nucleotide sequence identities were above the 91% threshold for begomovirus species demarcation (2), thus confirming that the begomoviruses found infecting I. indica in Greece are isolates of SPLCV. It is worth to note that the infected I. indica plant from Kremasti did not show any conspicuous symptoms, thus highlighting the importance of this species as an alternative host for SPLCV, which could thus affect the sweet potato crop that is grown in Greece in familiar plots. To our knowledge, this is the first report of SPLCV in Greece. References: (1) R. W. Briddon et al. Plant Pathol. 55:286, 2006. (2) ICTV Geminiviridae Study Group. New species and revised taxonomy proposal for the genus Begomovirus (Geminiviridae). ICTV. Retrieved from http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/ m/plant04/4720.aspx , 20 November 2013. (3) G. Lozano et al. J. Gen. Virol. 90:2550, 2009. (4) B. Muhire et al. Arch. Virol. 158:1411, 2013.

scholarly journals Two Divergent Isolates of Turnip Yellows Virus from Pea and Rapeseed and First Report of Turnip Yellows Virus-Associated RNA in Germany

2019 ◽  
Vol 8 (17) ◽  
Author(s):  
Yahya Z. A. Gaafar ◽  
Heiko Ziebell
Keyword(s):  
South Africa ◽  
Complete Genome ◽  
Nucleotide Identity ◽  
Genome Sequences ◽  
First Report ◽  
Turnip Yellows Virus ◽  
Virus Isolates

Two divergent isolates of turnip yellows virus (TuYV) were identified in pea and rapeseed. The nearly complete genome sequences of the virus isolates share 93.3% nucleotide identity with each other and 89.7% and 92.9% with their closest isolate from South Africa.

scholarly journals Use of High-Throughput Sequencing and Two RNA Input Methods to Identify Viruses Infecting Tomato Crops

2021 ◽  
Vol 9 (5) ◽  
pp. 1043
Author(s):  
Ayoub Maachi ◽  
Covadonga Torre ◽  
Raquel N. Sempere ◽  
Yolanda Hernando ◽  
Miguel A. Aranda ◽  
...  
Keyword(s):  
High Throughput ◽  
High Throughput Sequencing ◽  
Tomato Fruit ◽  
Virus Detection ◽  
Read Depth ◽  
Cdna Libraries ◽  
Virus Species ◽  
Total Rna ◽  
Viral Genomes ◽  
First Time

We used high-throughput sequencing to identify viruses on tomato samples showing virus-like symptoms. Samples were collected from crops in the Iberian Peninsula. Either total RNA or double-stranded RNA (dsRNA) were used as starting material to build the cDNA libraries. In total, seven virus species were identified, with pepino mosaic virus being the most abundant one. The dsRNA input provided better coverage and read depth but missed one virus species compared with the total RNA input. By performing in silico analyses, we determined a minimum sequencing depth per sample of 0.2 and 1.5 million reads for dsRNA and rRNA-depleted total RNA inputs, respectively, to detect even the less abundant viruses. Primers and TaqMan probes targeting conserved regions in the viral genomes were designed and/or used for virus detection; all viruses were detected by qRT-PCR/RT-PCR in individual samples, with all except one sample showing mixed infections. Three virus species (Olive latent virus 1, Lettuce ring necrosis virus and Tomato fruit blotch virus) are herein reported for the first time in tomato crops in Spain.

Sign in / Sign up

Export Citation Format

Share Document