scholarly journals First Report of Enterobacter cloacae Causing Bulb Decay on Garlic in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Erfeng Li ◽  
Xueliang Tian ◽  
Ruibian Zhao ◽  
Yuanhong Wang ◽  
Gang Wang
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Enterobacter Cloacae ◽  
Chili Pepper ◽  
Rrna Gene ◽  
Gyra Gene ◽  
First Report ◽  
Brown Discoloration ◽  
Pathogenicity Tests ◽  
And Control

Enterobacter cloacae is a symbiotic bacterium, which is one of the species in intestinal microbiota in many humans and animals. In some cases, it causes harmful diseases in humans. More and more studies showed that E. cloacae caused disease on plants, such as macadamia, ginger, mulberry, onion, chili pepper and rice. Garlic (Allium sativum L.) is one of crops with economic importance in the world. It is also widely grown in China. During 2018 to 2020, the naturally infected garlic bulbs from garlic fields in Kaifeng of Henan Province (34.55° N; 114.78° E) showed dry brown discoloration and rot symptoms. The diseased garlic seriously affected its edible value. Voucher specimens collected on June, 2019 were deposited in Plant Disease Laboratory of Tianjin Agricultural University under accession no. PATAU190620. To identify the causal agent of this disease, the bulb tissues of infected garlic were surface-disinfested in 0.6% sodium hypochlorite, dipped in75% ethanol, and then dipped in sterile distilled water. These bulbs were plated on LB medium and incubated at 37℃. A number of white colonies grew on the medium after plating for 16 h. All colonies were round, white, opaque, smooth, and gram-negative, which is a typical characteristic of Enterobacter. To confirm the initial identification of the isolated bacterium, the fragments of 16S rRNA gene and gyrA gene of 6 colonies were amplified, respectively. The PCR products were purified and sequenced. All 16S rRNA and gyrA sequences were identical to each other. The sequences of 16S rRNA gene and gyrA gene were deposited in GenBank with accession numbers MW730711 and MW768876, respectively. BLAST searches were conducted using the sequences of 16S rRNA and gyrA. The results showed 99.72%, and 96.91% identity with the corresponding sequences of E. cloacae strain CBG15936 (CP046116.1), respectively. Phylogenetic trees were performed using the neighbor-joining (NJ) method of MAGA X based on the sequences of 16S rRNA gene and gyrA gene. Phylogenetic tree indicated that isolates are most likely E. cloacae. Pathogenicity tests were performed by puncturing garlic bulbs with a hypodermic needle, followed by dipping in bacterial suspension with the concentration of 2×108 CFU for 5 minutes. As control, the garlic bulbs were treated with sterile water. The inoculated and control were incubated at 30°C. 7 days after inoculation, brown discoloration and rot were developed on all inoculated garlic bulbs. No symptoms were observed in the control group.The symptoms were similar to that observed on the original diseased garlic bulbs. The garlic bulbs in inoculated and control were ten replicates in each independent biological experiments. The pathogenicity tests were conducted three times with similar results. The bacteria were re-isolated from the symptomatic diseased garlics and confirmed as E. cloacae by morphological and sequence analyses as above. The re-isolated bacteria were identified by biochemical and physiological characteristics using API 20E strips. The results of the identification were identical to those of the edible ginger strains and the chili pepper strains. As far as we know, this is the first report of bulb decay on garlic caused by E. cloacae. The results are of great significance not only for the management of garlic bulbs during postharvest handling and storage, but also for the further research of opportunistic human pathogens E. cloacae.

scholarly journals The First Report of Stolbur Phytoplasma Associated with Phyllody of Calendula officinalis in Serbia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1152-1152 ◽  
Author(s):  
S. Pavlovic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
G. Aleksic ◽  
S. Kojic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Natural Infection ◽  
Cytotoxic Activities ◽  
Rrna Gene ◽  
Calendula Officinalis ◽  
Aster Yellows ◽  
First Report ◽  
Pot Marigold ◽  
Stolbur Phytoplasma

Pot marigold (Calendula officinalis L.) is native to southern Europe. Compounds of marigold flowers exhibit anti-inflammatory, anti-tumor-promoting, and cytotoxic activities (4). In Serbia, pot marigold is cultivated as an important medicinal and ornamental plant. Typical phyllody, virescence, proliferation of axillary buds, and witches' broom symptoms were sporadically observed in 2011 in Pancevo plantation, Serbia (44°51′49″ N, 20°39′33″ E, 80 m above sea level). Until 2013, the number of uniformly distributed affected pot marigold plants reached 20% in the field. Due to the lack of seed production, profitability of the cultivation was seriously affected. Leaf samples from 10 symptomatic and 4 symptomless marigold plants were collected and total nucleic acid was extracted from midrib tissue (3). Direct PCR and nested PCR were carried out with primer pairs P1/16S-SR and R16F2n/R16R2n, respectively (3). Amplicons 1.5 and 1.2 kb in length, specific for the 16S rRNA gene, were amplified in all symptomatic plants. No PCR products were obtained when DNA isolated from symptomless plants was used. Restriction fragment length polymorphism (RFLP) patterns of the 1.2-kb fragments of 16S rDNA were determined by digestion with four endonucleases separately (TruI1, AluI, HpaII, and HhaI) and compared with those of Stolbur (Stol), Aster Yellows (AY), Flavescence dorée-C (FD-C), Poinsettia Branch-Inducing (PoiBI), and Clover Yellow Edge (CYE) phytoplasmas (2). RFLP patterns from all symptomatic pot marigold plants were identical to the Stol pattern, indicating Stolbur phytoplasma presence in affected plants. The 1.2-kb amplicon of representative Nv8 strain was sequenced and the data were submitted to GenBank (accession no. KJ174507). BLASTn analysis of the sequence was compared with sequences available in GenBank, showing 100% identity with 16S rRNA gene of strains from Paeonia tenuifolia (KF614623) and corn (JQ730750) from Serbia, and peach (KF263684) from Iran. All of these are members of the 16SrXII ‘Candidatus Phytoplasma solani’ group, subgroup A (Stolbur). Phytoplasmas belonging to aster yellows (16SrI) (Italy and Canada) and peanut witches' broom related phytoplasma (16SrII) group (Iran) have been identified in diseased pot marigold plants (1). To our knowledge, this is the first report of natural infection of pot marigold by Stolbur phytoplasma in Serbia. References: (1) S. A. Esmailzadeh-Hosseini et al. Bull. Insectol. 64:S109, 2011. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) J. P. Prince. Phytopathology 83:1130, 1993. (4) M. Ukiya et al. J. Nat. Prod. 69:1692, 2006.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1267-1267 ◽  
Author(s):  
B. A. Martinez-Cisneros ◽  
G. Juarez-Lopez ◽  
N. Valencia-Torres ◽  
E. Duran-Peralta ◽  
M. Mezzalama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
The State ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Sterile Water ◽  
First Report ◽  
Stalk Rot ◽  
Positive Controls

A bacterial disease of maize, bacterial stalk and top rot, was found in the state of Morelos in February 2011, and in the state of Puebla in July 2013, Mexico. In both cases, the incidence of diseased plants was lower than 0.5%. The typical symptoms were a soft rot and darkening of the tissues affecting the stalk and the top of the plant, causing breaking of the stalk. The lesions progressed from the top to below nodes, leaf sheaths and blades, and rotten tissues emitted an unpleasant odor. Eleven diseased plants were collected, and bacterial colonies were isolated from fragments detached from the edges of symptomatic tissues after sterilization with a 0.5% solution of NaClO for 30 s, rinsing three times in sterile water. The sterilized fragments were macerated in drops of distilled sterile water for 10 min and the extract was streaked on King's medium B (agar 15 g, distilled water 1,000 ml, proteose peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, glycerol 10 ml). Eight representative strains from Morelos and five from Puebla were selected for identification. All strains were gram-negative, grew at 37°C, showed pectynolitic activity on potato tubers, were positive for indole production, utilized arabinose, galactose, glucose, glycerol, lactose, mannose, melibiose, rafinose, ribose, and sucrose but did not produce acid from arabitol, adonitol, and keto-methyl-glucoside (3,4). Pathogenicity tests were conducted with each strain by inoculating with a syringe four 25-day-old maize seedlings with 107 CFU ml–1 bacterial cells in the leaf collar. Plants were incubated in the greenhouse at 30°C during the day and 24°C during the night with a 12-h photoperiod, and relative humidity of 93%. The reference strains Erwinia chrysanthemi pv zeae ATTC29942 and Dickeya zeae CFBP 2052 were used as positive controls in laboratory and greenhouses tests. Sterile water was used as negative control. Two days after inoculation, soft stalk rot symptoms developed that were identical to those observed in the field. No symptoms were observed on the negative controls. Diagnostic amplification of DNA by conventional PCR was carried out and yielded the expected amplicon size of 420 bp of the Dickeya-specific pel gene with the ADE primers set (2). PCR was used to amplify the 16S rRNA gene with the universal primers 27f and 1495r (5) for molecular identification of the 13 strains (GenBank Accession Nos. KJ438941, KJ438942, KJ438943, KJ438944, KJ438945, KJ438946, KJ438947, KJ438948, KJ438949, KJ438950, KJ438951, KJ438952, and KJ438953). The strains D. zeae CFBP 2052 and E. chrysanthemi pv. zeae ATCC 29942 were sequenced as positive controls. A BLAST search with the 13 16S rRNA gene sequences of 1.4 kb were 99% identical to the sequence of D. zeae CFBP 2052 (NR_041923). D. zeae can be a major disease of maize in tropical and subtropical countries. It is particularly severe under conditions of high temperature and high humidity, but it occurs sporadically. Control of the vector, Chilo partellus, can aid disease management (1). To our knowledge, this is the first report of D. zeae causing maize stalk rot in Mexico. References: (1) CABI. Crop Prot. Compend. CAB International, Wallingford, UK, 2014. (2) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (3) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (4) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, St. Paul, MN, 2001. (5) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

Down into the Earth: microbial diversity of the deepest cave of the world

Biologia ◽  
2015 ◽  
Vol 70 (8) ◽  
Author(s):  
Ieva Kieraite-Aleksandrova ◽  
Vilius Aleksandrovas ◽  
Nomeda Kuisiene
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Microbial Diversity ◽  
Bacterial Diversity ◽  
Independent Method ◽  
Rrna Gene ◽  
Sampling Depth ◽  
First Report ◽  
The Earth ◽  
The World

AbstractIn our work, microbial diversity of Krubera-Voronja cave was evaluated in the view of the frequency of human visits in different locations as well as the sampling depth. Sampling in this cave was performed at depths of 220 m to 1640 m. Cultivation-independent method, namely barcoded pyrosequencing of 16S rRNA gene, was used for this analysis. Our results demonstrated high bacterial diversity at the phylum and genus levels. We have shown that the bacterial diversity at the phylum level depends on both the sampling depth and the frequency of human visits in Krubera-Voronja cave. Frequently visited locations were more diverse at the phylum level than the rarely visited branches. The total number of bacterial genera both per phylum and per sample correlated with the frequency of human visits but not with the sampling depth. Some genera, found in Krubera-Voronja cave, seem to be absent or very rare in other caves. The present study represents the first report on the microbial diversity in Krubera-Voronja cave

scholarly journals First Report of Rhodococcus fascians Causing Fasciation of Lilies (Lilium longiflorum Thunb.) in South Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Lim Yeon-Jeong ◽  
Hyun Gi Kong ◽  
Yong Hwan Lee ◽  
Hyun Ran Kim ◽  
Duck Hwan Park
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
South Korea ◽  
Rrna Gene ◽  
Post Inoculation ◽  
Pathogenicity Genes ◽  
First Report ◽  
Colony Pcr ◽  
Height Reduction ◽  
Rhodococcus Fascians

Rhodococcus fascians is a bacterium that causes growth abnormalities such as leafy galls, fasciation, and shoot proliferation in many plants, including ornamental plants. In February 2020, the Animal and Plant Quarantine Agency of South Korea detected 492,000 contaminated lily bulbs using an in-house PCR test based on the R. fascians fasD gene, and subsequently 1.3 million imported bulbs were destroyed. Because no pathogen isolation was associated with this diagnosis, there has been great cultivator demanded for bacterial isolation evidence of lily bulb infection with pathogenic R. fascians. To isolate the causal bacterium of the PCR tests, we sampled leaf, stem, and bulb tissues from 130 lilies with growth abnormality symptoms, collected from 24 South Korean mass production lily farms from June to August 2020. Supernatants of the homogenized samples were spread on mD2 medium (Kado and Heskett 1970) and incubated at 28°C for 10 days. Yellow to orange colonies were isolated into pure culture on mD2. Total DNA was extracted from cultures grown in yeast extract broth (YEB) at 28°C for 24 hours with Wizard DNA prep kit (Promega, Madison, WI, USA). PCR was performed to test for pathogenicity genes fas (A,D, and R) and att (A and R) (Putnam and Miller 2007). Colonies that produced at least one amplicon from these pathogenicity genes were analyzed by partial 16s rRNA gene sequencing to determine the corresponding species. Three strains that were isolated from the bulbs of fasciated lilies from Wanju (35°56´22.1˝N; 127°08´52.0˝E), Gwacheon (37°26´51.6˝N; 127°00´11.8˝E), and Yeongwol (37°18´45.8˝N; 128°11´05.6˝E), or W1, G3, and Y5 strains, yielded PCR products of the expected size for fas and att genes with the primer sets published in Serdani et al. (2013) and developed in this study (attAF: 5'–CCCGGCTACACGCATTCGC-3', attAR: 5'-CGAACGCGGTGTGCAGGT-3' and attRF: 5'-AGTGTCCCGTCGGCGAG-3', attRR: 5'-CGCGGCAGATCGAAGTCCT-3'). Sequences of the three strains were deposited in Genbank for fasA (accession MW122940-942), fasD (G3:MW122935 and 936), and fasR (MW122937-939); all shared 98.3 - 100% nucleotide identity to corresponding sequences from phytopathogenic R. fascians A25f (CP049745.1 Protein_ID fasA:QII09280.1, fasD:QII09282.1, and fasR:QII09277.1). The attA and attR products were only present in G3 (attA: MW122943 and attR: MW122944) and resulted in 100% identity to those of A25f (CP049745.1 Protein_ID attA:QII09269.1, attR:QII09267.1). Partial 16s rRNA gene sequences were obtained (MW064131-133) and clustered with phytopathogenic R. fascians strains D188, A21d2, and A25f. Thus we concluded that strains (W1, G3, and Y5) corresponded to R. fascians. To test the pathogenicity of these three strains, 10 seeds of garden peas for each strain were inoculated at 108 CFU/ml according to Nikolaeva et al. (2009), and the length of the main stem of each seedling was calculated 22 days post-inoculation. Seedlings inoculated with G3 and Y5 resulted in a stunted phenotype with up to 40% height reduction (p ≤ 0.001) compared to non-inoculated seedlings. As for the seedlings inoculated with W1, they exhibited as much as 15% height reduction (p ≤ 0.001). Colonies were recovered from the inoculated seedlings, identity was confirmed through colony PCR for fas and att genes. To our knowledge, this is the first report of phytopathogenic R. fascians in lilies cultivated in South Korea.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Bacterial Blight of Pomegranate Caused by Xanthomonas axonopodis pv. punicae in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1427-1427 ◽  
Author(s):  
S. M. Icoz ◽  
I. Polat ◽  
G. Sulu ◽  
M. Yilmaz ◽  
A. Unlu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Blight ◽  
Acid Methyl Ester ◽  
Rrna Gene ◽  
Original Strain ◽  
Gene Sequences ◽  
Xanthomonas Axonopodis ◽  
First Report ◽  
The 16S Rrna Gene

Pomegranate (Punica granatum L.) is an increasingly important fruit crop that is widely cultivated in Turkey. Typical bacterial blight symptoms were observed since spring of 2011 in pomegranate orchards located in Antalya Province. Symptoms were characterized by dark brown, angular to irregularly shaped spots on leaves and fruit; cankers on stems, branches, and trunks; and split trunks. The pathogen was isolated from leaf spots on naturally infected plants showing typical symptoms onto yeast dextrose chalk agar. Bright yellow bacterial colonies were consistently isolated. Bacterial strains were characterized as gram negative, oxidase negative, catalase positive, tobacco hypersensitivity positive, and able to produce acid from L-arabinose, D-galactose, D-glucose, and D-mannitol but not from D-xylose. Pathogenicity of the representative bacterial strain Serik-4 was performed on 2-year-old pomegranate plants cv. Hicaz. Leaves were sprayed until runoff with bacterial cell suspensions containing 107 CFU/ml. Inoculated plants were covered with transparent plastic bags to maintain moisture for 48 h. Negative control plants were inoculated with sterile distilled water. Plants were then incubated in a greenhouse at 30°C for 14 days. Symptoms on leaves included dark brown, angular to irregularly shaped water soaked lesions along the veins of the inoculated plants 10 days after inoculation. No lesions developed on the control plants. The symptoms on inoculated plants were similar to those on naturally infected plants. Yellow bacterial colonies were re-isolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis, thus fulfilling Koch's postulates. Fatty acid methyl ester profiling of the representative strain Serik-4 using GC-MIDI (Microbial Identification Inc, Newark, DE) identified the genus of the bacterium as Xanthomonas. The identity of Serik-4 was further confirmed by amplifying the 16S rRNA gene with the universal primers 27F and 1492R (3) and sequence analysis (GenBank Accession No. KM007073). The 16S rRNA gene sequences of Serik-4 was 99% identical to the corresponding gene sequences of the Xanthomonas axonopodis pv. punicae strain present in the NCBI database (JQ067629.1). High incidence of bacterial blight caused by X. axonopodis pv. punicae on pomegranate has been previously reported in India (2), Pakistan (1), and South Africa (4). To our knowledge, this is the first report of bacterial blight on pomegranate caused by X. axonopodis pv. punicae in Turkey. References: (1) M. A. Akhtar and M. H. R. Bhatti. Pakistan J. Agric. Res. 13:95, 1992. (2) R. Chand and R. Kishun. Indian Phytopathol. 44:370, 1991. (3) D. J. Lane. Page 115 in: Nucleic Acid Techniques in Bacterial Systematics, 1991. (4) Y. Petersen et al. Australas. Plant Pathol. 39:544, 2010.

scholarly journals First Report of Pectobacterium punjabense Causing Blackleg and Soft Rot on Potato in Hebei and Fujian Province, China

Plant Disease ◽  
2022 ◽  
Author(s):  
Utpal Handique ◽  
Yaning Cao ◽  
Dekang Wang ◽  
Ruofang Zhang ◽  
Wensi Li ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Rrna Gene ◽  
Pectobacterium Carotovorum ◽  
Fujian Province ◽  
First Report ◽  
Potato Plants ◽  
Carotovorum Subsp

Pectobacterium spp. and Dickeya spp. cause blackleg and soft rot on potato worldwide (Charkowski, 2018). Potato plants (cv. Favorita or Jizhang 8#) with blackleg symptoms (vascular browning of crown stems, Fig. S1) were observed in the field in Zhangjiakou, Hebei province in 2018, and in Ningde, Fujian Province in 2019, in China. The disease incidence was around 50% and 10% in Zhangjiakou (5 ha) and Ningde (4 ha), respectively. Diseased plants (3 from each site) were collected to isolate the pathogen. Blackleg symptomatic stems were soaked in 75% ethanol for 2 min, rinsed and ground in sterile distilled water. Serial tenfold dilutions of the above solution were plated onto the crystal violet pectate agar (CVP) plate (Ge et al., 2018). Two to 3 days after incubation at 28°C, 4 bacterial colonies in total which digested pectin from the media and developed pit on CVP plates were purified and sequenced for identification using the universal 16S rRNA gene primer set 27F/1492R (Monciardini et al., 2002). Two colony sequences that showed more than 99% sequence identity to Pectobacterium punjabense type strain SS95 (MH249622) were submitted to the GenBank ( accession numbers: OK510280, MT242589). Additionally, six housekeeping genes proA (OK546205, OK546199), gyrA (OK546206, OK546200), icdA (OK546207, OK546201), mdh (OK546208, OK546202), gapA (OK546209, OK546203), and rpoS (OK546210, OK546204) of these two isolates were amplified and sequenced (Ma et al., 2007, Waleron et al., 2008). All strains show 99% to 100% identity with MH249622T . Phylogenetic trees based on 16S rRNA gene sequences (Fig. S2) and concatenated sequences of the housekeeping genes (Fig. S3) of the 2 isolates were constructed using MEGA 6.0 software (Tamura et al., 2013). Koch’s postulate was performed on potato seedlings and potato tubers (cv. Favorita) by injecting 100 μl bacterial suspension (105 CFU/ml) or sterile phosphate-buffered solution into the crown area of the stems or the tubers and kept at 100% humidity and 21°C for 1 day. Four days after inoculation, the infected area of the inoculated seedlings rotten and turned black, while the controls were symptomless (Fig. S4). Two days after inoculation, the infected tubers rotten and turned black, while the controls were symptomless (Fig. S4). Bacterial colonies were reisolated from these symptomatic tissues and identified using the same methods described above. Blackleg on potato plants or soft rot on potato has been reported to be caused by Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum, Pectobacterium carotovorum subsp. brasiliense, Pectobacterium parmentieri, Pectobacterium polaris in China (Zhao et al., 2018; Cao et al., 2021; Wang et al., 2021). To our knowledge, this is the first report of blackleg/soft rot of potato caused by Pectobacterium punjabense in China. We believe that this report will draw attention to the management of this pathogen in China.

scholarly journals First Report of Pseudomonas oryzihabitans Causing Stem and Leaf Rot on Muskmelon in China

Plant Disease ◽  
2021 ◽  
Author(s):  
JuFen Li ◽  
Ganghan Zhou ◽  
Tan Wang ◽  
Tao Lin ◽  
yiwen wang ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Distilled Water ◽  
Phylogenetic Tree Analysis ◽  
First Report ◽  
Rot Disease ◽  
The 16S Rrna Gene ◽  
Leaf Rot

Muskmelon (Cucumis melo L.) is an important economic crop in China, which is planted on more than 376, 000 hectares with over 13 million tons of annual fruit production. In February 2020, a serious bacterial stem and leaf rot disease on muskmelon plants was observed in greenhouses in Liguo Town, Ledong County, Hainan Province, China (18.54° N, 108.87° E), with disease incidences being approximately 10 to 12%. Initially, soft rot symptoms appeared on petioles and stems, showing yellow bacterial ooze signs, which was different from the milky white ooze produced by Erwinia tracheiphila infection. The infected tissues of petioles, stems, and leaves eventually developed into browning and withering symptoms. To isolate and identify the causal agent, the lesion tissues were sterilized by immersion in 75% ethanol for 30 s, washed three times with sterile water, and then cut and soaked in 1 ml of distilled water for 10 min. The suspension was serially diluted and spread on Luria-Bertani agar (LB) medium. After incubation at 28°C for 24 to 36 h, the resulted bacterial colonies were tiny and were streaked on LB plate for further culture. After purification, the colonies were yellow, circular, smooth-margined, and two independent representative isolates CM-11 and CM-12 were used for further validation experiments. The electron microscope analysis showed that the pathogen was rod-shaped, with a length of 1.34 ± 0.22 μm and a width of 0.54 ± 0.06 μm (N=50), and had a single terminal flagellum. The gram staining of the two isolates was negative. Moreover, the tested strains were positive for catalase but negative for oxidase and were able to utilize D-glucose, L-arabinose, and D-mannitol. Morphological, physiological, and biochemical characteristics of both isolates were consistent with those of Pseudomonas spp. To verify the species identity of the bacterial pathogens, genomic DNA of isolates CM-11 and CM-12 was extracted and several conserved genes were amplified and sequenced, including the 16S rRNA gene with primers 27F/1492R (GenBank MW187499 and MW187500), rpoB gene with primers V4/LAPS27 (MW201910 and MW446819), and gyrB gene with primers gyrBBAUP2/APrU (MW187501 and MW187502) (Mulet et al. 2010). In the BLAST analysis, the 16S rRNA sequences showed a 99% similarity to that of Pseudomonas oryzihabitans strains TH19 (LC026009), AA21 (MG571765). The rpoB and gyrB sequences showed high similarity (> 98%) to P. oryzihabitans strains FDAARGOS_657. The phylogenetic tree analysis of rpoB and gyrB genes further verified that the two isolates CM-11 and CM-12 were most closely related to P. oryzihabitans species. Consequently, the two pathogenic isolates CM-11 and CM-12 were identified as P. oryzihabitans. Both strains of CM-11 and CM-12 were tested to accomplish Koch's postulates. Young branches of muskmelons (cultivar Yugu, 10 days after pollination) were chosen as the material for inoculation. Ten healthy detached branches were placed in 15 ml tubes by submerging the cutting wound in 5 ml of the bacterial suspension (108 CFU/ml). Ten additional branches were implemented with sterilized distilled water as a negative control. The inoculated branches were placed in a plastic box containing moistened paper at 28°C. Rotting symptoms appeared within 5 days after infection, while the control samples remained healthy. Bacteria were re-isolated from diseased tissues, and the 16S rRNA gene sequences of the isolates showed the same as those from the original pathogen. Panicle blight and grain discoloration disease caused by P. oryzihabitans on rice has been described in China (Hou et al. 2020). It’s also recently found that P. oryzihabitans caused center blackening disease on muskmelon fruit in Korea (Choi et al. 2019). This study indicated that it was a causative agent of stem and leaf rot disease during the field growth period. To the best of our knowledge, this is the first report of P. oryzihabitans causing muskmelon stem rot in China.

Sign in / Sign up

Export Citation Format

Share Document