Effect of Homeopathic Preparations on Lettuce, Parasitized or Not by Meloidogyne enterolobii

Homeopathy ◽  
2020 ◽  
Author(s):  
Thais Moraes Ferreira ◽  
Mariana Zandomênico Mangeiro ◽  
Alexandre Macedo Almeida ◽  
Ricardo Moreira Souza
Keyword(s):  
Plant Pathogens ◽  
Nematode Control ◽  
Plant Tolerance ◽  
Nematode Reproduction ◽  
Meloidogyne Enterolobii ◽  
Negative Effect ◽  
Meloidogyne Spp ◽  
Constant Dose ◽  
Lettuce Growth ◽  
Complementary Strategy

Abstract Background There are relatively few scientific works on the use of homeopathy to manage plant pathogens, particularly nematodes. A handful of studies focused on Meloidogyne spp. parasitizing vegetables have brought contradictory results on nematode control and enhancement of plant tolerance to parasitism. Objective Our goal was to assess the effect of Cina—a well-known anti-nematode ingredient—on Meloidogyne enterolobii parasitizing lettuce. Methods Cina was applied daily on nematode-inoculated plants, from the seedling stage until harvest. We tested an evenly spaced range of Hahnemannian concentrations (c), which were applied though irrigation with a constant dose of the ingredient. Several absolute and relative controls were employed to allow the assessment of the effect of Cina on nematode reproduction and lettuce growth. Results Cina affected growth of non-parasitized plants, both positively and negatively; this effect was modulated by the c applied and the thermal stress suffered by the plants in one of the assays. The effect of Cina on the growth of nematode-parasitized plants was neutral or negative. Cina reduced nematode reproduction by 25–36%. Conclusion Based on the moderate negative effect of Cina on M. enterolobii reproduction, it seems this ingredient may be useful as a complementary strategy for Meloidogyne control. But Cina did not enhance the tolerance of lettuce to Meloidogyne spp.

scholarly journals Immunity of sugarcane cultivars to Meloidogyne enterolobii

2020 ◽  
Vol 36 (6) ◽  
Author(s):  
Gabriela Silva Thomazelli ◽  
Roberta Luiza Vidal ◽  
Lúcio Roberto Vizentini ◽  
Daniel Dalvan Do Nascimento ◽  
Renato Silva Soares ◽  
...  
Keyword(s):  
Genetic Resistance ◽  
Limiting Factors ◽  
Experimental Unit ◽  
Damage Potential ◽  
Nematode Reproduction ◽  
Randomized Design ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Wide Geographic Distribution ◽  
Reproduction Factor

Brazil is currently the world’s largest producer and exporter of sugarcane, and the crop has high socioeconomic importance in the country. Root-knot nematodes (Meloidogyne spp.) are one of the major limiting factors in sugarcane production. These plant parasites have wide geographic distribution, high damage potential, and are difficult to control. Recently, the species Meloidogyne enterolobii was identified in sugarcane crops in the state of Pernambuco, Brazil. Given the importance of genetic resistance for integrated nematode management and the lack of research on the M. enterolobii–sugarcane pathosystem, this study aimed to assess the response of sugarcane cultivars to M. enterolobii. Thirteen cultivars were evaluated for their resistance to M. enterolobii based on the nematode reproduction factor. The experiment was conducted in a greenhouse, in a completely randomized design, with 14 replicates. Pre-sprouted sugarcane seedlings were transplanted to 5 L pots, and each pot was considered an experimental unit. At 15 days after transplanting, the seedlings were inoculated with 5,000 eggs and second-stage juveniles of M. enterolobii. Tomato and okra plants were also inoculated to test the viability of the inoculum. At 240 days after inoculation, plant roots were processed and evaluated for nematode number. This parameter was used to calculate the nematode reproduction factor on each cultivar. All sugarcane cultivars were found to be immune to M. enterolobii, with a reproduction factor of 0.

Genetic diversity of Meloidogyne spp. parasitising potato in Brazil and aggressiveness of M. javanica populations on susceptible cultivars

Nematology ◽  
2017 ◽  
Vol 19 (1) ◽  
pp. 69-80 ◽  
Author(s):  
Israel L. Medina ◽  
Cesar B. Gomes ◽  
Valdir R. Correa ◽  
Vanessa S. Mattos ◽  
Philippe Castagnone-Sereno ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Rapd Markers ◽  
Potato Production ◽  
Potato Cultivars ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
Nematode Reproduction ◽  
Meloidogyne Spp ◽  
Prevalent Species ◽  
Reproduction Factor

Root-knot nematodes (Meloidogyne spp.) significantly impact potato production worldwide and in Brazil they are considered one of the most important group of nematodes affecting potatoes. The objectives of this study were to survey Meloidogyne spp. associated with potatoes in Brazil, determine their genetic diversity and assess the aggressiveness of M. javanica on two susceptible potato cultivars. Fifty-seven root-knot nematode populations were identified using esterase phenotyping, including Meloidogyne javanica, M. incognita, M. arenaria and M. ethiopica. Overall, root-knot nematodes were present in ca 43% of sampled sites, in which M. javanica was the most prevalent species, and the phenotypes Est J3, J2a and J2 occurred in 91.2, 6.7 and 2.1% of the positive samples, respectively. Other species, such as M. incognita, M. arenaria and M. ethiopica, were found less frequently and occurred at rates of 6.4, 4.3 and 2.1% of the samples, respectively. Sometimes, M. javanica was found in mixtures with other root-knot nematodes in ca 10.6% of sites containing Meloidogyne. After confirming the identification of 17 isolates of M. javanica and one isolate each of M. incognita, M. arenaria and M. ethiopica by SCAR markers, the populations were used to infer their genetic diversity using RAPD markers. Results revealed low intraspecifc genetic diversity among isolates (13.9%) for M. javanica. Similarly, M. javanica sub-populations (J2a) clustered together (81% of bootstrap), indicating subtle variation from typical J3 populations. The aggressiveness of four populations of M. javanica from different Brazilian states on two susceptible potato cultivars was tested under glasshouse conditions. Results indicated differences in aggressiveness among these populations and showed that potato disease was proportional to nematode reproduction factor.

scholarly journals Screening of some Leguminosae seeds for nematicidal activity

2004 ◽  
Vol 22 (1) ◽  
pp. 51 ◽  
Author(s):  
Uma R Khurma ◽  
Anupama Mangotra
Keyword(s):  
Seed Extract ◽  
Sesbania Sesban ◽  
Nematode Control ◽  
Recent Past ◽  
Cassia Fistula ◽  
Pongamia Glabra ◽  
Meloidogyne Spp ◽  
Alternative Sources ◽  
Seed Extracts

Root-knot nematodes, Meloidogyne spp., are the major nematode pests of economic crops worldwide. Use of conventional nematicides has been one of the most effective methods to reduce their populations. However, the ban on many effective nematicides in recent past has necessitated the search for alternative sources of effective and ecofriendly chemicals for nematode control. The nematicidal potential of fifteen Leguminosae seeds (wild and cultivated) was assessed, in vitro, against juveniles of Meloidogyne incognita (Kofoid & White) Chitwood. Each standard aqueous seed extract, 25g/100ml (w/v), was evaluated at dilutions, 1:10, 1:20, and 1:40 at 27+1�C for 24 hours. The majority of seed extracts caused high mortality rates, especially in 1:10 concentration. Trigonella foenum graceum, Sesbania sesban, Albizzia lebbak, Cassia fistula and Pongamia glabra were the most efficacious (above 90% mortality). S. sesban and P. glabra were significantly effective even in the lowest concentration (1:40).

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Improving Tolerance of Faba Bean during Early Growth Stages to Salinity through Micronutrients Foliar Spray

2010 ◽  
Vol 2 (2) ◽  
pp. 98-102 ◽  
Author(s):  
Mohamed M. EL FOULY ◽  
Zeinab M. MOBARAK ◽  
Zeinab A. SALAMA
Keyword(s):  
Faba Bean ◽  
Irrigation Water ◽  
Foliar Application ◽  
Nutrient Balance ◽  
Foliar Spray ◽  
Dry Weight ◽  
Growth Stages ◽  
Plant Tolerance ◽  
Negative Effect ◽  
Tolerance To Salinity

Salinity, either of soil or of irrigation water, causes disturbances in plant growth and nutrient balance. Previous work indicates that applying nutrients by foliar application increases tolerance to salinity. A pot experiment with three replicates was carried out in the green house of NRC, Cairo, Egypt, to study the effect of micronutrients foliar application on salt tolerance of faba bean. Two concentrations of a micronutrient compound (0.1% and 0.15%) were sprayed in two different treatments prior to or after the salinity treatments. Levels of NaCl (0.00-1000-2000-5000 ppm) were supplied to irrigation water. Results indicated that 2000 and 5000 ppm NaCl inhibited growth and nutrient uptake. Spraying micronutrients could restore the negative effect of salinity on dry weight and nutrients uptake, when sprayed either before or after the salinity treatments. It is suggested that micronutrient foliar sprays could be used to improve plant tolerance to salinity.

scholarly journals Reproduction of Meloidogyne enterolobii in lettuce cultivars of the American group

2015 ◽  
Vol 33 (2) ◽  
pp. 147-150
Author(s):  
Érika CSS Correia ◽  
Norberto Silva ◽  
Marylia GS Costa ◽  
Silvia RS Wilcken
Keyword(s):  
Reproductive Potential ◽  
Egg Mass ◽  
Root Knot Nematodes ◽  
Second Stage ◽  
American Group ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Gall Index ◽  
Summer Time ◽  
Reproduction Factor

Lettuce is the main vegetable cultivated in Brazil, in volume and in marketed value. There are ranges of diseases which may affect lettuce crops, including those caused by root-knot nematodes (Meloidogyne spp.). We evaluated the reproductive potential of Meloidogyne enterolobii in 22 lettuce cultivars. The plants were inoculated with 5,000 eggs and eventuals second stage juveniles of nematode per pot, two days after the transplanting. 'Rutgers' tomato was used as standard for inoculum viability of M. enterolobii. We evaluated, 60 days after inoculation, the gall index, egg mass index and reproduction factor (RF). The 'Ithaca', 'Raider Plus', 'RS-1397', 'L-104', 'Challenge', 'IP-11', 'Classic', 'Salinas 88', 'Vanguard 75', 'Calona' and 'Desert Queen' were resistant to M. enterolobii with RF varying from 0.22 to 0.9, and the cultivars Lady Winterset, Robinson, Sonoma, Raider, Lucy Brown, Bnondaga, Summer Time, Taina, Sundevil and L-109 were susceptible to this nematode, with RF ranging from 1.06 to 5.73.

Molecular characterisation of Meloidogyne enterolobii and other Meloidogyne spp. from South Africa

2019 ◽  
Vol 44 (3) ◽  
pp. 213-224 ◽  
Author(s):  
Milad Rashidifard ◽  
Mariette Marais ◽  
Mieke Stefanie Daneel ◽  
Charlotte M. S. Mienie ◽  
Hendrika Fourie
Keyword(s):  
South Africa ◽  
Molecular Characterisation ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp

Development of Pasteuria penetrans on different field populations of Meloidogyne spp. from Pakistan

Nematology ◽  
2019 ◽  
Vol 21 (10) ◽  
pp. 1003-1010
Author(s):  
Muhammad Kamran ◽  
Nazir Javed ◽  
Huma Abbas ◽  
Sajid Aleem Khan ◽  
Ihsan Ullah ◽  
...  
Keyword(s):  
Biological Control ◽  
Root System ◽  
Biological Control Agent ◽  
Control Agent ◽  
Pasteuria Penetrans ◽  
Successful Development ◽  
Nematode Reproduction ◽  
Tomato Roots ◽  
Differential Infectivity ◽  
Meloidogyne Spp

Summary Pasteuria penetrans is a hyperparasite with potential as a biological control agent of root-knot nematodes, Meloidogyne spp. In this study two exotic Pasteuria isolates (PP-3 and PP-J) were developed on different Meloidogyne spp. collected from different districts of Punjab, Pakistan. The development of PP-3 and PP-J on different field populations of Meloidogyne spp. showed differential infectivity in terms of nematode reproduction variables. The development of PP-3 and PP-J was maximum on tomato as compared to cucumber. It was probably due to more invasion sites for nematodes present in the tomato roots. However, a bigger root system has not always been a guarantee for development of Pasteuria on Meloidogyne spp. For successful development of Pasteuria, the key parameters are the percentage of infected females, number of endospores (female)−1 or endospores (mg root powder)−1. The results of these parameters are greater in tomato as compared to cucumber.

scholarly journals Agrobacteria Enhance Plant Defense Against Root-Knot Nematodes on Tomato

2017 ◽  
Vol 107 (6) ◽  
pp. 681-691 ◽  
Author(s):  
Janja Lamovšek ◽  
Barbara Gerič Stare ◽  
Irena Mavrič Pleško ◽  
Saša Širca ◽  
Gregor Urek
Keyword(s):  
Plant Defense ◽  
Crown Gall ◽  
Pathogenic Bacteria ◽  
Systemic Acquired Resistance ◽  
Quantitative Polymerase Chain Reaction ◽  
Hormonal Control ◽  
Root Knot Nematodes ◽  
Nematode Reproduction ◽  
Pathogenesis Related Protein ◽  
Meloidogyne Spp

The increased incidence of the crown gall disease caused by Agrobacterium tumefaciens has long been associated with activities of root-knot nematodes (Meloidogyne spp.). Pot experiments on tomato were designed to assess plant vitality, nematode reproduction, and crown gall incidence in combined infection with Agrobacterium and Meloidogyne spp. on tomato roots. Results suggest that tomato plants infected with pathogenic A. tumefaciens 2 days before the nematodes show enhanced plant defense against M. ethiopica resulting in lower egg and gall counts on roots 45 and 90 days postinoculation (dpi); no significantly enhanced defense was observed when the plant was inoculated with bacteria and nematodes at the same time. Split-root experiments also showed that the observed interaction was systemic. Reverse-transcription quantitative polymerase chain reaction analysis that targeted several genes under plant hormonal control suggests that the suppression was mediated via systemic acquired resistance by the pathogenesis-related protein 1 and that M. ethiopica did not enhance the defense reaction of tomato against Agrobacterium spp. Nematodes completely inhibited tumor growth in a 45-day experiment if inoculated onto the roots before the pathogenic bacteria. We conclude that the observed antagonism in the tested pathosystem was the result of initially strong plant defense that was later suppressed by the invading pathogen and pest.

scholarly journals Negative short-term salt effects on the soybean–Bradyrhizobium japonicum interaction and partial reversion by calcium addition

2014 ◽  
Vol 41 (1) ◽  
pp. 96 ◽  
Author(s):  
Nacira Muñoz ◽  
Marianela Rodriguez ◽  
German Robert ◽  
Ramiro Lascano
Keyword(s):  
Salt Stress ◽  
Root Hair ◽  
Bradyrhizobium Japonicum ◽  
Plant Pathogens ◽  
Root Hairs ◽  
Short Term ◽  
Calcium Addition ◽  
Negative Effect ◽  
Osmotic Treatment ◽  
Related Proteins

The short-term (2 h) effects of salt stress (50 and 150 mM NaCl) on early events of soybean– Bradyrhizobium japonicum (rhizobia) interaction were analysed, determining the following parameters in root hair with or without calcium addition: deformation, apoplastic superoxide radical production (O2⚫–), root hair death and sodium/potassium ion content. We also analysed whether this short-term salt stress influenced later formation of crown and noncrown nodules, determining the number and weight of nodules. The negative effect of salt stress on these characters was attenuated by the addition of 5 mM CaCl2. We also analysed the expression of pathogenesis-related proteins (PRP) genes PR-1, PR-2, PR-3, and four isoforms of PR-5. The expression of PR-2 increased under saline conditions and decreased in osmotic treatment and saline treatment supplemented with calcium in the presence of the symbiont. The changes in PR-2 expression levels, together with the death of root hairs provide a possible mechanism for the inhibition of infection by the symbiont under salinity, and suggests a possible overlap with responses to plant pathogens.

Sign in / Sign up

Export Citation Format

Share Document