scholarly journals Identification and Host Relations of Turnip ringspot virus, A Novel Comovirus from Ohio

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1212-1220 ◽  
Author(s):  
P. Rajakaruna ◽  
S. Khandekar ◽  
T. Meulia ◽  
S. M. Leisner
Keyword(s):  
Genomic Sequence ◽  
Microscopic Analysis ◽  
Unknown Origin ◽  
Ringspot Virus ◽  
Rt Pcr ◽  
Electron Microscopic ◽  
Polymerase Chain ◽  
Line Patterns ◽  
Ring Spot ◽  
Host Relations

Viruslike chlorotic ring spot symptoms and line patterns of unknown origin were observed on a greenhouse-grown turnip plant. The suspected virus was mechanically transmissible to plants in the Brassicaceae. Electron microscopic analysis revealed icosahedral particles approximately 28 nm in diameter. Reverse transcriptase–polymerase chain reaction (RT-PCR) analyses suggested that the pathogen is a comovirus, an observation that was confirmed by analysis of portions of the genomic sequence. This virus was provisionally named Turnip ringspot virus (TuRSV). Based on the RNA 1 sequence, TuRSV is most similar to Radish mosaic virus, another pathogen that infects members of the Brassicaceae. Arabidopsis thaliana is susceptible to TuRSV, and 12 out of the 23 ecotypes studied showed symptoms when inoculated with the virus. TuRSV induced a variety of responses on ecotypes from death to no infection. Some ecotypes showed one or two rounds of symptom display followed by recovery when inoculated with TuRSV. About half of the ecotypes (11/23) analyzed showed no symptoms when inoculated with TuRSV. Col-0 plants showed no symptoms, and infectious virus was not recovered from systemic leaves, although it could be detected by RT-PCR. Col-0 plants harboring mutations impairing the ethylene, jasmonic acid, or salicylic acid signaling pathways did not show symptoms when inoculated with TuRSV.

scholarly journals Detection of Cherry leaf roll virus and Strawberry latent ring spot virus by one-step RT-PCR

2009 ◽  
Vol 45 (No. 4) ◽  
pp. 140-143 ◽  
Author(s):  
S. Kumari
Keyword(s):  
Leaf Roll ◽  
Rt Pcr ◽  
Spot Virus ◽  
Cherry Leaf Roll Virus ◽  
One Step ◽  
Polymerase Chain ◽  
The One ◽  
Ring Spot ◽  
Screen House ◽  
Xiphinema Diversicaudatum

A one-step reverse transcription-polymerase chain reaction (RT-PCR) protocol was developed and used for the detection of <i>Cherry leaf roll virus</i> (CLRV) and <i>Strawberry latent ring spot virus</i> (SLRSV). The protocol was used to test infected screen house plants and also plants from orchards and vineyards where the vector (<i>Xiphinema diversicaudatum</i>) of SLRSV was detected from the soil. The one-step RT-PCR protocol is rapid and sensitive and has the potential to be used for the diagnosis of CLRV and SLRSV in routine diagnostic laboratories.

Electron microscopic analysis of the microtubular structure of HEp-2 cells

1990 ◽  
Vol 48 (3) ◽  
pp. 470-471
Author(s):  
Miklós S.Z. Kellermayer ◽  
Tamás Henics ◽  
György Szücs ◽  
Gerald H. Pollack
Keyword(s):  
Microscopic Analysis ◽  
Unknown Origin ◽  
Tubular Structure ◽  
Minimal Essential Medium ◽  
Electron Microscopic ◽  
Brij 58 ◽  
Cacodylate Buffer ◽  
Microscopic Studies ◽  
And Function ◽  
Hank’S Solution

The HEp-2 cell line was first established by Moore, et al. and today it serves as a widely used subject for a large variety of microbiological and cell-biological experiments. A tubular structure of unknown origin and function has been described first in virally infected, and later in uninfected HEp-2 cells. However, this tubular structure has not been further analyzed. We performed transmission (TEM) and whole cell mount electron microscopic studies of monolayer HEp-2 cells to morphologically describe the structure and relate it to other organelles of the cell.For embedding, HEp-2 cells were grown on glass coverslips in Eagle's minimal essential medium. 24 hours after passage, three types of procedures were carried out: (1) The cells were fixed with 2.5% glutaraldehyde in 0.14 M Na-cacodylate buffer. (2) The cells were treated for 10 min. with Hank's solution containing 0.2% Brij-58 and 2.5% glutaraldehyde. Fixation was completed with 2.5% glutaraldehyde in 0.14 M Na-cacodylate. (3) Cells were treated with 0.2% Brij-58 in Hank’s solution for 10 min. Subsequently, they were fixed with 2.5% glutaraldehyde in 0.14 M Na-cacodylate.

scholarly journals Karakterisasi Molekuler Papaya ringspot virus tipe P pada Tanaman Mentimun di Jawa

2018 ◽  
Vol 14 (3) ◽  
pp. 75
Author(s):  
Listihani Listihani ◽  
Tri Asmira Damayanti ◽  
Sri Hendrastuti Hidayat ◽  
Suryo Wiyono
Keyword(s):  
Ringspot Virus ◽  
Mosaic Symptom ◽  
Papaya Ringspot Virus ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Specific Primers ◽  
Central Java ◽  
Dna Fragment ◽  
Polymerase Chain

Moleculer Characterization of Papaya ringspot virus type P on Cucumber in JavaInfection of Papaya ringspot virus (PRSV) on cucumber plants showing mosaic symptom was detected using specific antibody.  Further investigation was conducted to determine molecular characters and status of PRSV infecting cucumber in Java.  Infection of PRSV was detected from leaf samples collected from the field using dot immunobinding assay (DIBA).  Disease frequency caused by PRSV infection reached 81.11%, 95.86%, 91.66%, and 92.3% in East Java, Central Java, Yogyakarta, and West Java, respectively.  Characterization of PRSV isolates was conducted by reverse transcription polymerase chain reaction (RT-PCR) using specific primers for PRSV-P and PRSV-W, followed by cloning, and DNA sequencing.  DNA fragment of 470 bp was successfully amplified using specific primers for PRSV-P from several samples from Nganjuk, Brebes, Kulon Progo, and Subang; but no amplification was achieved using specific primers for PRSV-W.  Nucleotide and amino acid analysis showed high homology among PRSV-P isolates from Nganjuk, Brebes, Kulon Progo, and Subang, i.e. 98.6%-99.7% and 99.3%-100%, respectively.  This is an indication of a low genetic variation among PRSV-P from Java. Further phylogenetic analysis indicated that PRSV-P isolate cucumber is in the same cluster with PRSV-P isolate papaya from Bali, Indonesia.  This is the first report of PRSV-P infecting cucumber in Indonesia.

scholarly journals The First Report of Tomato torrado virus in Poland

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1364-1364 ◽  
Author(s):  
H. Pospieszny ◽  
N. Borodynko ◽  
A. Obrępalska-Stęplowska ◽  
B. Hasiów
Keyword(s):  
Genomic Sequence ◽  
Infected Plant ◽  
Biological Properties ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
Electron Microscopic ◽  
Greenhouse Whitefly ◽  
Specific Primers ◽  
Severe Stunting ◽  
Virus Particles

In 2003 and 2004, unusual disease symptoms, including severe stunting, malformation, and necrosis of the leaves on tomato cv. Grace, were observed in the Wielkopolska Region of Poland. The disease appeared to be associated with the presence of the greenhouse whitefly Trialeurodes vaporariorium. An electron microscopic examination of a negatively stained leaf-dip preparation from an infected plant showed the presence of spherical virus particles approximately 25 to 28 nm in diameter. The virus (designated Wal'03) was shown to be vectored efficiently (100%) by T. vaporariorium and poorly (50 to 70%) by mechanical transmission to tomato. Mechanical inoculation or whitefly transmission caused systemic infection on Nicotiana tabacum (cvs. Xanthi nc, Samsun, and White Burley), N. benthamiana, N. clevelandii, N. debneyi, N. affinis, N. glutinosa, Lycopersicon esculentum, Petunia hybrida, Capsicum annuum, Nicandra physaloides, Physalis floridana, and Solanum tuberosum. The virus did not infect Phaseolus vulgaris, Pisum sativum, Cucumis sativus, Chenopodium quinoa, or Beta vulgaris. Partially purified virus preparations from N. bethamiana or N. tabacum cv. Xanthi centrifuged in a sucrose density gradient sedimented as two separated zones. Viral RNA was extracted from the purified viral preparations with phenol-chloroform, and analysis by denaturing agarose gel electrophoresis revealed RNA 1 (approximately 7,800 bp) and RNA 2 (approximately 5,400 bp). The biological properties and the genomic RNA composition showed significant similarities to that of Tomato necrotic dwarf virus (ToNDV) described from California (1) and the newly identified Tomato torrado virus (ToTV) in Spain (2). Immuno-specific electron microscopy (ISEM) showed Wal'03 virus particles reacted with ToNDV antiserum (provided by W. Wintermantel, Salinas, CA). The genomic sequence of ToTV (GenBank Accession Nos. DQ388879 and DQ388880) was used to design specific primers for analysis by reverse transcription (RT)-PCR: TR1F (5′ CAATGTGCCAAAGATGAGCG 3′), TR1R (5′ ACTCCCGTGTCTATGTTTTC 3′), TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′), which amplified products of 573 and 892 bp for RNA 1 and RNA 2, respectively. These RT-PCR fragments from Wal'03 were sequenced (GenBank Accession Nos. EF635007 and EF635008) and comparisons with ToTV showed 99 and 98% nucleotide identity for RNA1 and RNA2, respectively. Immunocapture-RT-PCR with leaf tissue from N. benthamiana infected by Wal'03, antiserum against ToNDV, and ToTV-specific primers TR2F and TR2R produced a fragment of the expected size. Sequence of this product showed 100% identity with previously obtained RT-PCR fragments. The similarity of the symptoms on tomato plants, the morphology of virus particles, genome composition and nucleotide sequence identities suggest that Wal'03 and ToTV are the same. References: (1) R. C. Larsen et al. Phytopathology 74:795, 1984. (2) M. Verbeek et al. Arch. Virol. 152:881, 2007.

scholarly journals First Report of Celery mosaic virus Infecting Celery in Venezuela

Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1111-1111 ◽  
Author(s):  
T. Fernández ◽  
O. Carballo ◽  
K. Zambrano ◽  
M. Romano ◽  
E. Marys
Keyword(s):  
Mosaic Virus ◽  
Microscopic Analysis ◽  
Apium Graveolens ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Leaf Extracts ◽  
Electron Microscopic ◽  
First Report ◽  
Three Samples ◽  
Topo Vector

Celery mosaic virus (CeMV) is a significant pathogen of celery (Apium graveolens) worldwide (1). In 2005, in a produce market located in Los Salias, Miranda, celery plants with mottling and leaf malformation were noticed. Electron microscopic analysis of leaf-dip preparations from three symptomatic samples revealed flexuous viral particles that were 750 nm long. Infected cells contained pinwheel inclusions typical of those associated with potyvirus infection. Inoculation of healthy celery plants with leaf extracts from four symptomatic plants produced symptoms identical to those first observed. A survey of five produce markets in Miranda was conducted to determine the prevalence of virus infection in celery using serological and molecular analyses. Mottling and malformation of celery leaflets were observed in all the markets visited. Symptoms were noted in all five markets in each of three visits during a 3-month period. A total of 125 postharvested symptomatic plants were collected from five markets on March 29, 2005 and tested for CeMV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with antiserum provided by F. Rabenstein, BAX, Aschersleben, Germany. Of the 125 samples collected during the survey, 53% were ELISA positive. Twenty ELISA-positive samples were also tested using reverse transcription-polymerase chain reaction (RT-PCR) with general primers for the family Potyviridae (2). All 20 samples produced an amplicon of the expected size (1.7 kbp) after RT-PCR. Amplicons from three samples were cloned into the pCR-TOPO vector (Invitrogen, Carlsbad, CA). Sequence analysis of one clone revealed more than 98% nt to a CeMV isolate from Australia (GenBank Accession No AF203532). To our knowledge, this is the first report of CeMV in Venezuela. Our results suggest that the disease may be widely spread on celery crops growing in the areas surrounding produce markets in Miranda State. References: (1) A. Brunt et al. Viruses of Plants. CAB International, Wallingford, Oxon, UK. 1996. (2) J. Chen et al. Arch. Virol. 146:757, 2001.

Ultrastructural Characteristics of Gallbladder Epithelial Inclusions Mimicking Cystoisospora

2019 ◽  
Vol 153 (1) ◽  
pp. 88-93 ◽  
Author(s):  
Arun Gopinath ◽  
Aysha Mubeen ◽  
Brett Baskovich ◽  
Amber Ginn ◽  
Amal Shukri ◽  
...  
Keyword(s):  
Microscopic Analysis ◽  
Electron Microscopic Analysis ◽  
Its2 Region ◽  
Chain Reaction ◽  
Electron Microscopic ◽  
Cytoplasmic Material ◽  
Ultrastructural Characteristics ◽  
Polymerase Chain ◽  
Or Organization ◽  
Generation Sequencing

Abstract Objectives There is recently reported increased prevalence of Isospora organisms in cholecystectomy specimens from immunocompetent patients, especially in acalculous cholecystectomies. We performed an ultrastructural and molecular evaluation of these specimens. Methods From 28 gallbladders with intraepithelial inclusions, two specimens with diffuse involvement of the gallbladder epithelium were analyzed by electron microscopy. Polymerase chain reaction was performed on five samples for the ITS2 region of C belli and eukaryotic 18S region. The 18S products were sequenced by next-generation sequencing. Results Electron microscopic analysis showed cytoplasmic condensations leading to vacuole formation. In contrast with true C belli, there were no identifiable organelles or organization. None of these cases showed amplified products other than human on molecular analysis. Conclusions Electron microscopic analysis demonstrates that the inclusions are condensed cytoplasmic material and not true organisms.

scholarly journals Development of a Real-Time RT-PCR SYBR Green Assay for Tomato ring spot virus in Grape

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1083-1088 ◽  
Author(s):  
Elwin L. Stewart ◽  
Xinshun Qu ◽  
Barrie E. Overton ◽  
Fred E. Gildow ◽  
Nancy G. Wenner ◽  
...  
Keyword(s):  
Real Time ◽  
Gene Sequence ◽  
Sybr Green ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Spot Virus ◽  
Sybr Green Assay ◽  
One Step ◽  
Polymerase Chain ◽  
Ring Spot

Grapevines infected with Tomato ring spot virus (ToRSV) pose an economic risk for growers in the northeastern United States. This study describes a one-step real-time reverse-transcription polymerase chain reaction (RT-PCR) SYBR Green assay for detecting ToRSV in grapevines. Two newly designed primer pairs based on the ToRSV coat protein gene sequence were evaluated for specificity and optimized for a SYBR Green assay. The primer pair ToRSV1f/1r yielded a 130-bp product with strong primer-dimer products, whereas the primer pair ToRSV2f/2r yielded a 330-bp product with weak primer dimer products. Real-time RT-PCR detected ToRSV in more naturally infected grapevines maintained in the greenhouse than did enzyme-linked immunosorbent assay. The nucleotide sequences of the fragments amplified from grapevine growing in Pennsylvania using real-time PCR were divergent from previously published sequences.

scholarly journals Partial characterization of Prunus Necrotic Ringspot Virus on apple in EGYPT 

2021 ◽  
Author(s):  
Aly M. Abdel-Salam ◽  
Samah A. Mokbel
Keyword(s):  
Binding Assay ◽  
Ringspot Virus ◽  
Economic Losses ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Prunus Necrotic Ringspot Virus ◽  
Polymerase Chain ◽  
Severe Isolate ◽  
Microscopy Examination

Abstract A severe isolate of Prunus necrotic ringspot virus (PNRSV) was isolated from apple orchards in the vicinity of Nubaria city, Beheira governorate, Egypt. Infected-apple trees showed chlorotic, necrotic ringspots, and shoot holes on leaves. Severely infected- trees withered, became useless, and were removed causing severe economic losses. Reverse transcriptase (RT) polymerase chain reaction (PCR), RT-PCR, using degenerate primer pair for the coat protein (CP) gene of Ilarvirus amplified products similar to those produced from peach and apricot isolates of PNRSV-infecting stone fruits). Dot blotting immuno-binding assay (DBIA showed a positive reaction between PNRSV-infected apple sap and an Egyptian antiserum for PNRSV. Purified preparation from infected leaves, using the electro-elution technique yielded nucleoprotein, which had Amax and Amin at 260 and 240 nm respectively. Electron microscopy examination showed spherical virions with ca. 26 nm in diameter.

scholarly journals A CLINICAL STUDY OF SIDDHA HERBAL PREPARATION – M V KASHAYAM FOR THE TREATMENT, CONTROL, AND MANAGEMENT OF COVID-19

2021 ◽  
pp. 104-107
Author(s):  
MALARKANNAN SP ◽  
DHARUMARAJAN P ◽  
HARIYOHESH MK
Keyword(s):  
Herbal Medicine ◽  
Preventive Measure ◽  
Unknown Origin ◽  
The Body ◽  
Rt Pcr ◽  
Treatment Control ◽  
Oxygen Saturation Level ◽  
Polymerase Chain ◽  
Novel Coronavirus ◽  
Control And Management

Objective: At present, the pandemic COVID-19 by novel coronavirus causing severe mortality and losses to the human and no specific medicine to cure. Siddha is an ancient system of medicine used in using a variety of medicinal herbs to cure diseases of viral and unknown origin. Method: The herbal medicine M V Kashayam prepared as per Siddha formula administered at the dose rate of 150 ml for every 6-h interval for Reverse Transcription–Polymerase Chain Reaction (RT – PCR) positive patients Results: The prepared MV Kashayam can able to provide RT-PCR negative in 87.5% of cases within 4–6 days and 97.5% negatives in 12 days. The body temperature, Oxygen saturation level (SPO2), and respiration level become normal within 3 days. Conclusion: The Siddha medicine, MV kashayam may be used as herbal medicine to treat the COVID-19 patients for earlier recovery and as a preventive measure to enhance immunity.

scholarly journals First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 575-575 ◽  
Author(s):  
R. R. Martin ◽  
I. E. Tzanetakis ◽  
J. E. Barnes ◽  
J. F. Elmhirst
Keyword(s):  
British Columbia ◽  
Chenopodium Quinoa ◽  
The United States ◽  
Ringspot Virus ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
The Family ◽  
Polymerase Chain

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Sign in / Sign up

Export Citation Format

Share Document