First Report of Powdery Mildew Caused by Erysiphe heraclei on Celery in North America

Since 1994, a fungal disease has been affecting celery (Apium graveolens) grown for seed in the central coast region of California. White, ectophytic mycelia and conidia, characteristic of a powdery mildew, were present on compound umbels, including the involucre, rays, raylets, flowers, and fruits. Celery with powdery mildew had twisted flower petals, and the disease possibly contributed to premature senescence and drying of the fruits. Powdery mildew was not observed on leaves. Mycelial growth was effused and amphigenous and had lobed appressoria. Conidiophores were straight, and cylindrical foot cells were followed by a longer cell and one or two shorter cells. Conidia were produced singly and were 36 to 44 × 11 to 16 μm. Fibrosin bodies were not observed. Germ tubes were located at the ends of conidia and formed lobed appressoria. Cleistothecia were not present. Based on these characteristics, the fungus was identified as Erysiphe heraclei (1). In California, parsley (Petroselinum crispum) is a host of E. heraclei (4), and parsley is grown in the same region as celery seed crops. To determine if parsley was an alternative host of the celery powdery mildew, infected celery umbels were gently pressed onto adaxial surfaces of leaves on 2-month-old greenhouse grown parsley cvs. Italian Plain and Triple Curled. Inoculated plants were incubated 48 h in a moist chamber at 22°C, then transferrred to a greenhouse at 22 ± 2°C / 16 ± 2°C day/night temperatures, 75% relative humidity, and natural light. After 12 to 14 days, powdery mildew was observed on both parsley cultivars. Uninoculated control plants did not develop the disease. This is the first report of powdery mildew on celery in North America. Previous reports list E. heraclei on celery in Chile, the former Czechoslovakia, France, Iraq, Italy, and the former USSR (Georgia region). In the U.S., E. heraclei is reported on carrot (Daucus carota) (2), parsley (4), meadow parsnip (Zizia aptera and Z. aurea) (3), and now celery. References: (1) H. J. Boesewinkel. Bot. Rev. 46:167, 1980. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (3) K. A. Hirata. Host Range and Geographic Distribution of the Powdery Mildew Fungi. Jpn. Scientif. Soc. Press, Tokyo. (4) S. T. Koike and G. S. Saenz. Plant Dis. 78:1219, 1994.

Download Full-text

First Report of Powdery Mildew of Platanus occidentalis Caused by Erysiphe platani in Korea

Plant Disease ◽

10.1094/pdis-10-12-0982-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 843-843 ◽

Cited By ~ 2

Author(s):

Y. J. La ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

North America ◽

Powdery Mildew ◽

Its Region ◽

The United States ◽

Control Measures ◽

Base Substitution ◽

Width Ratio ◽

First Report ◽

Platanus Occidentalis ◽

Young Leaves

Platanus occidentalis L., called American sycamore or American plane, is native to North America. The trees are commonly planted throughout the world on the sides of roads and in parks. In June 2012, diseased leaves exhibiting signs of powdery mildew from a park in Daegu City of Korea were sent to Plant Clinic of Seoul National University for diagnosis. Our observations in Daegu City during September and October 2012 showed that nearly 99% of the approximately 1,000 trees surveyed were infected with a powdery mildew. Voucher specimens (n = 6) were deposited at the Korea University Herbarium (KUS). Symptoms were characterized by chlorosis, distortion, or cupping of young leaves. White superficial colonies developed amphigenously on leaves. Hyphae were flexuous to straight, branched, septate, 4 to 7 μm wide, and had lobed appressoria. Conidiophores were 120 to 350 × 5 to 7.5 μm and produced conidia singly. Foot-cells of conidiophores were straight, cylindric, and 115 to 200 μm long. Conidia were hyaline, ellipsoid-ovoid, measured 33 to 47.5 × 17.5 to 29 μm with a length/width ratio of 1.5 to 2.0, lacked distinct fibrosin bodies, and showed reticulate wrinkling of the outer walls. Germ tubes were produced on the subterminal position of conidia. No chasmothecia were observed. The structures and measurements were compatible with those of the anamorphic state of Erysiphe platani (Howe) U. Braun & S. Takam. (1). To confirm the identification, the complete internal transcribed spacer (ITS) region of the rDNA from isolate KUS-F26959 was amplified with nested PCR and sequenced. The resulting sequence of 625 bp was deposited in GenBank (Accession No. JX997805). A GenBank BLAST search of this sequence showed only one base substitution with the four sequences (JQ365940 to JQ365943) of E. platani on Platanus spp. Pathogenicity was confirmed through inoculation tests by gently pressing diseased leaves onto young leaves of three 2-year-old disease-free seedlings. Three non-inoculated plants were used as control. Plants were maintained in a greenhouse at 24 to 30°C. Inoculated leaves developed symptoms after 7 days, whereas the control plants remained symptomless. The fungus present on the inoculated leaves was morphologically identical to that observed on the original diseased leaves, fulfilling Koch's postulates. Since E. platani first was recorded in the United States in 1874, it has been regarded as endemic in North America. From the second half of the 20th century, introduction and expansion of the range of this fungus to South America, South Africa, Australia and New Zealand, Europe, and Asia have been reported (1,2). To our knowledge, this is the first report of E. platani infections of P. occidentalis in Korea. This species was recorded on P.× hispanica from Japan in 1999 (4) and on P. orientalis from China in 2006 (3), suggesting invasive spread of the sycamore powdery mildew in East Asia. Since American sycamores are widely planted in Korea, control measures should be made to prevent further spread of the disease. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved October 22, 2012. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) S, Tanda. J. Agric. Sci., Tokyo Univ. Agric. 43:253, 1999.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera (Sphaerotheca) fusca on Euryops pectinatus in North America

Plant Disease ◽

10.1094/pdis.2000.84.9.1048a ◽

2000 ◽

Vol 84 (9) ◽

pp. 1048-1048 ◽

Cited By ~ 1

Author(s):

G. S. Saenz ◽

S. T. Koike ◽

N. Shishkoff

Keyword(s):

United States ◽

New York ◽

North America ◽

Powdery Mildew ◽

Fungal Growth ◽

The United States ◽

Voucher Specimen ◽

First Report ◽

Humidity Chamber ◽

Powdery Mildew Pathogen

Gray-leaved Euryops (Euryops pectinatus Cass., Asteraceae) is an evergreen shrub that is widely planted in landscapes in the United States. In the fall of 1999, powdery mildew was observed on E. pectinatus planted in landscapes in Redlands (San Bernardino County), CA. Symptoms consisted only of slight cupping of leaves. Fungal growth was observed on stems, leaves, petioles, and pedicels and was ectophytic and amphigenous. The white mycelium was patchy to effuse. Hyphal appressoria were indistinct (1). Conidiophore foot cells were cylindric and sometimes were tapered toward or constricted at the base. Foot cells measured 30 to 50 by 10 to 12 μm and were followed by one to two shorter cells. Conidia were cylindric to slightly doliform, borne in chains of two to three, and measured 26 to 38 by 14 to 18 μm. Conidial length to width ratios ranged from 1.7 to 2.4. Catenate conidia had crenate edge lines (3). Conidia possessed conspicuous fibrosin bodies and from their sides produced short germ tubes without appressoria. Cleistothecia were not observed. Based on these characters, the fungus was identified as Podosphaera fusca (Fr.) U. Braun & N. Shishkoff (Podosphaera sect. Sphaerotheca) (1,2). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of healthy E. pectinatus plants. Plants were incubated in a humidity chamber at 22 to 24°C and after 12 to 14 days powdery mildew colonies developed. E. pectinatus cv. Viridis, a cultivar that lacks the extensive pubescence of E. pectinatus, also developed disease when inoculated. This appears to be the first report of powdery mildew on E. pectinatus in North America. A voucher specimen has been deposited into the University of California Herbarium (accession # UC1738635). P. fusca was also observed on cv. Viridis in a nursery in New York in 1999. It is unclear where this pathogen originated. P. fusca parasitizes a large number of asteraceous species including dandelion (Taraxacum officinalis) and sowthistle (Sonchus spp.) weeds, which occur in the area and sometimes are infected with powdery mildew. The Euryops powdery mildew pathogen may be a race that is different than those found on other composites in the United States. The fungus was observed on plants in shaded areas but not on plants in full sun. References: (1) U. Braun. Nova Hedwigia 89:1, 1987. (2) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (3) H. D. Shin and Y. J. La. Mycotaxon 46:445, 1993.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe heraclei on Chervil in California

Plant Disease ◽

10.1094/pdis.2004.88.10.1163a ◽

2004 ◽

Vol 88 (10) ◽

pp. 1163-1163

Author(s):

S. T. Koike ◽

G. S. Saenz

Keyword(s):

Powdery Mildew ◽

Host Range ◽

Germ Tube ◽

Apium Graveolens ◽

Petroselinum Crispum ◽

First Report ◽

Tube Forming ◽

Disease Impact ◽

Symptoms And Signs ◽

Culinary Herb

Chervil (Anthriscus cerefolium) is a culinary herb in the Apiaceae family that is grown commercially in California. In 2003 and 2004, shade house plantings of chervil in central coastal California exhibited symptoms and signs of a powdery mildew disease. White, epiphytic mycelia and conidia were present on petioles and leaves. Severely affected leaflets became slightly twisted and bent. Mycelium was amphigenous and effused or in patches. Hyphae measured 5.0 to 7.5 μm in diameter and had lobed appressoria. Conidiophores were straight and had cylindric foot cells measuring 25.0 to 37.5 × 7.5 to 10.0 μm, followed by a longer cell and one to two shorter cells. Conidia formed singly, were cylindric, and measured (37.5-) 40.0 to 50.0 (-52.5) × 15.0 to 17.5 μm. Conidia lacked fibrosin bodies and germinated at the ends with either a very short or a long germ tube forming a lobed appressorium (Polygoni type). No cleistothecia were observed. On the basis of these characteristics, the fungus was identified as Erysiphe heraclei (1). To confirm pathogenicity, severely colonized chervil leaves from a commercial nursery were gently pressed onto leaves of potted chervil plants. Plants were then maintained in a greenhouse (22 to 24°C). After 10 to 12 days, signs of powdery mildew developed on the foliage of inoculated plants, and the pathogen morphology matched that of the originally observed pathogen. Noninoculated control plants did not develop powdery mildew. To investigate the host range of this chervil isolate, parsley (Petroselinum crispum) and celery (Apium graveolens) plants were inoculated in the same way as described. However, after more than 3 weeks, no powdery mildew developed on these two Apiaceae plants. Control chervil plants again developed the disease. To our knowledge, this is the first report of powdery mildew of chervil caused by E. heraclei in California. Disease impact was severe, and in some cases, chervil crops were not harvested. The inability of the chervil isolate to infect two other Apiaceae plants that are listed as hosts of E. heraclei indicates that this pathogen may consist of strains having different host ranges. Reference: (1) U. Braun. Nova Hedwigia 89:1, 1987.

Download Full-text

Biology and Management of the Carrot Weevil (Coleoptera: Curculionidae) in North America

Journal of Integrated Pest Management ◽

10.1093/jipm/pmz007 ◽

2019 ◽

Vol 10 (1) ◽

Author(s):

Emily J Justus ◽

Elizabeth Y Long

Keyword(s):

United States ◽

North America ◽

Behavioral Ecology ◽

Management Strategies ◽

The United States ◽

Apium Graveolens ◽

Future Research ◽

Petroselinum Crispum ◽

Knowledge Gaps ◽

Carrot Weevil

Abstract The carrot weevil, Listronotus oregonensis (LeConte) (Coleoptera: Curculionidae), is a devastating pest of high value Apiaceous crops like carrots (Daucus carota subsp. sativusHoffm.), parsley (Petroselinum crispum (Mill.) Fuss), and celery (Apium graveolens L.). Although native to North America, it is a serious pest across the Eastern United States and Great Lakes region of the United States and Canada. Females deposit eggs in the petiole of cultivated hosts, and upon hatching, larvae tunnel down through the petiole and into plant roots causing wilting, yellowing, and plant death. Scouting procedures focus mainly on adult activity and require detection of small egg scars on the foliage and crown of the root, or reliance on traps that are only effective at the beginning of the season before the crop emerges. Several avenues of cultural, biological, and chemical control have been explored for this pest, but with limited success. Furthermore, investigation of these management strategies have primarily focused on carrot systems, neglecting other cultivated Apiaceae. Here we present a review of carrot weevil research and highlight key knowledge gaps in the carrot weevil system, which impede our understanding of this insect’s biology and behavioral ecology. Future research addressing these key knowledge gaps will expand our understanding of this pest and contribute to the development and implementation of more effective management strategies.

Download Full-text

First Report of Powdery Mildew Caused by an Oidium sp. on Banana Shrub (Michelia figo)

Plant Disease ◽

10.1094/pdis.1999.83.2.198c ◽

1999 ◽

Vol 83 (2) ◽

pp. 198-198 ◽

Cited By ~ 1

Author(s):

G. E. Holcomb

Keyword(s):

United States ◽

Powdery Mildew ◽

Baton Rouge ◽

The United States ◽

Sexual Stage ◽

First Report ◽

Leaf Chlorosis ◽

Leaf Surfaces ◽

Powdery Mildew Fungi ◽

Severity Of The Disease

Banana shrub (Michelia figo (Lour.) Spreng.) is an evergreen grown in southern landscapes in hardiness zones 7 to 9. A powdery mildew disease has been observed sporadically on this plant for several years in the Baton Rouge area during fall months, but symptoms were always mild. During the summer and fall of 1998, banana shrub plants were observed with moderately severe powdery mildew infections that resulted in leaf chlorosis, distortion, and some defoliation. An Oidium sp. was present on both leaf surfaces, but sporulation was more abundant on the abaxial surfaces. Conidia were ellipsoid, produced in chains, devoid of conspicuous fibrosin bodies, and averaged 37 × 19 μm. No sexual stage was found. Conidia brushed from infected leaves to healthy leaves of a potted banana shrub maintained in a greenhouse caused new infections in 5 to 8 days. Factors responsible for the increased severity of the disease in 1998 are unknown, but the unusually dry summer may have contributed to the increased incidence of this disease. An Oidium sp. was listed on M. figo in Australia and the United States (1), but no other reports were found to confirm this. This is the first report of the occurrence of a powdery mildew on M. figo in the United States. Reference: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Press, Tokyo, 1986.

Download Full-text

First Report of Powdery Mildew of Lycium chinense (Chinese Matrimony Vine) Caused by Arthrocladiella mougeotii in the Pacific Northwest

Plant Health Progress ◽

10.1094/php-2004-1208-01-hn ◽

2004 ◽

Vol 5 (1) ◽

pp. 16

Author(s):

Dean A. Glawe

Keyword(s):

North America ◽

Powdery Mildew ◽

Medicinal Plant ◽

Pacific Northwest ◽

Morphological Features ◽

Lycium Chinense ◽

First Report ◽

Landscape Plant ◽

The Pacific ◽

Plant Grown

Chinese matrimony-vine (Lycium chinense Mill.) is a traditional medicinal plant grown in China and used as a perennial landscape plant in North America. This report documents the presence of powdery mildew on L. chinense in the Pacific Northwest and describes and illustrates morphological features of the causal agent. It appears to be the first report of a powdery mildew caused by Arthrocladiella in the Pacific Northwest. Accepted for publication 10 November 2004. Published 8 December 2004.

Download Full-text

First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽

10.1094/pdis-01-13-0017-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 9

Author(s):

T. Candresse ◽

A. Marais ◽

C. Faure

Keyword(s):

North America ◽

Seed Transmission ◽

The United States ◽

High Rate ◽

Reference Sequence ◽

Tomato Mosaic Virus ◽

Potential Contribution ◽

First Report ◽

Tomato Sample ◽

Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Download Full-text

First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽

10.1094/pdis-91-4-0468a ◽

2007 ◽

Vol 91 (4) ◽

pp. 468-468 ◽

Cited By ~ 5

Author(s):

D. H. Gent ◽

R. R. Martin ◽

C. M. Ocamb

Keyword(s):

United States ◽

Disease Incidence ◽

The United States ◽

Yellow Spot ◽

Onion Bulb ◽

Spot Virus ◽

First Report ◽

Seed Crop ◽

Onion Seed ◽

Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

Download Full-text

First Report of a Leaf Spot Caused by Alternaria brassicae on the Invasive Weed Lepidium draba in North America

Plant Disease ◽

10.1094/pdis-93-8-0846a ◽

2009 ◽

Vol 93 (8) ◽

pp. 846-846 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey

Keyword(s):

North America ◽

Chinese Cabbage ◽

Leaf Spot ◽

The United States ◽

Alternaria Brassicae ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Black Spots ◽

Lepidium Draba

The exotic, rangeland weed Lepidium draba L., a brassicaceous perennial, is widely distributed in the United States. For example, Oregon contains 100,000 ha of land infested with L. draba (2). Because it is capable of aggressive spread and has the potential to reduce the value of wheat-growing land (4), it is the target of biological control research. The application of multiple pathogens has been advocated for control of other brassicaceous weeds, including the simultaneous application of biotrophic and necrotrophic pathogens (3). In pursuit of this approach, in 2007, we discovered the occurrence of leaf spots on approximately 90% of L. draba plants near Shepherd, MT, which were distinct from leaf lesions caused by Cercospora bizzozeriana (1). The lesions were initially tiny, black spots enlarging over time to become circular to irregular and cream-colored around the initial black spots and sometimes with dark brown borders or chlorotic halos. Conidia from the lesions were light brown, elongate and obclavate, produced singly from short conidia, with 8 to 12 transverse septa, and 2 to 6 longitudinal septa. The spore body measured 25 to 35 × 200 to 250 μm with a beak cell 42 to 100 μm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc. Leaf tissues bordering lesions were plated on acidified potato dextrose agar. Colonies on V8 and alfalfa seed agar were black with concentric rings, eventually appearing uniformly black after 10 to 14 days. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with a sequence of A. brassicae Strain B from mustard (GenBank Accession No. DQ156344). The nucleotide sequence has been assigned GenBank Accession No. FJ869872. For pathogenicity tests, aqueous spore suspensions approximately 105/ml were prepared from cultures grown at 20 to 25°C for 10 to 14 days on V8 agar and sprayed on leaves of three L. draba plants. Inoculated plants were enclosed in plastic bags and incubated at 20 to 22°C for 72 to 80 h. In addition, three plants of the following reported hosts of A. brassicae were inoculated: broccoli, canola, Chinese cabbage, collards, broccoli raab, kale, mustard greens, radish, rape kale, and turnip. Within 10 days, leaf spots similar to those described above developed on plants of radish, canola, Chinese cabbage, and turnip and A. brassicae was reisolated and identified. Control plants sprayed with distilled water remained symptomless. These inoculations were repeated and results were the same. To our knowledge, this is the first report of a leaf spot disease caused by A. brassicae on L. draba in North America. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) A. J. Caesar et al. Plant Dis. 93:108, 2009. (2) G. L. Kiemnec and M. L. McInnis. Weed Technol. 16:231, 2002. (3) A. Maxwell and J. K. Scott. Adv. Bot. Res. 43:143, 2005. (4) G. A. Mulligan and J. N. Findlay. Can. J. Plant Sci. 54:149, 1974.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe aquilegiae var. aquilegiae on Aquilegia flabellata in Italy

Plant Disease ◽

10.1094/pdis.2004.88.6.681a ◽

2004 ◽

Vol 88 (6) ◽

pp. 681-681

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

United States ◽

Powdery Mildew ◽

The United States ◽

Northern Italy ◽

American Phytopathological Society ◽

First Report ◽

Powdery Mildews ◽

The Family ◽

White Mycelium ◽

The University

Aquilegia flabellata Sieb. and Zucc. (columbine) is a perennial garden species belonging to the family Ranunculaceae. During the summer of 2003, a severe outbreak of a previously unknown powdery mildew was observed in several gardens near Biella (northern Italy). Upper surfaces of leaves were covered with a white mycelium and conidia, and as the disease progressed infected leaves turned yellow and died. Foot cell was cylindric and appressorium lobed. Conidia were hyaline, ellipsoid, and measured 31.2 to 47.5 × 14.4 to 33 μm (average 38.6 × 21.6 μm). Fibrosin bodies were not present. Cleistothecia were globose, brown, had simple appendages, ranged from 82 to 127 (average 105) μm in diameter, and contained one to two asci. Ascocarp appendages measured five to eight times the ascocarp diameter. Asci were cylindrical (ovoidal) and measured 45.3 to 58.2 × 30.4 to 40.2 μm. Ascospores (three to four per ascus) were ellipsoid or cylindrical and measured 28.3 to 31.0 × 14.0 to 15.0 μ;m. On the basis of its morphology, the pathogen was identified as Erysiphe aquilegiae var. aquilegiae (1). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of five, healthy A. flabellata plants. Five noninoculated plants served as controls. Inoculated and noninoculated plants were maintained in a garden where temperatures ranged between 20 and 30°C. After 10 days, typical powdery mildew symptoms developed on inoculated plants. Noninoculated plants did not show symptoms. To our knowledge, this is the first report of the presence of powdery mildew on Aquilegia flabellata in Italy. E. communis (Wallr.) Link and E. polygoni DC. were reported on several species of Aquilegia in the United States (2), while E. aquilegiae var. aquilegiae was previously observed on A. flabellata in Japan and the former Union of Soviet Socialist Republics (3). Specimens of this disease are available at the DIVAPRA Collection at the University of Torino. References: (1) U. Braun. Nova Hedwigia, 89:700, 1987. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) K. Hirata. Host Range and Geographical Distribution of the Powdery Mildews. Faculty of Agriculture, Niigata University, 1966.

Download Full-text