scholarly journals Recent Outbreak of Soybean Stem Canker Caused by Diaporthe phaseolorum var. caulivora in the Main Soybean-Producing Region of Argentina

Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1403-1403 ◽  
Author(s):  
R. N. Pioli ◽  
E. N. Morandi ◽  
A. Luque ◽  
C. O. Gosparini
Keyword(s):  
Disease Incidence ◽  
Stem Canker ◽  
Santa Fe ◽  
Diaporthe Phaseolorum ◽  
Recent Outbreak ◽  
Dark Regime ◽  
Pathogen Variability ◽  
Glycine Max L ◽  
Glucose Agar ◽  
Stem Segments

The first report of soybean stem canker (SSC) caused by Diaporthe phaseolorum var. caulivora in South America was published in 2001, and was based on an isolate obtained in 1999 at Oliveros, Santa Fe (32°33′S, 60°51′W), Argentina (2). During the 2001 to 2002 growing season, isolates of D. phaseolorum var. caulivora were obtained from stems of field-grown soybeans (Glycine max L.) exhibiting SSC symptoms. Isolates were collected in three localities of the main soybean-producing region of Argentina: Marcos Juárez, Córdoba (32°66′S, 62°10′W); Salto, Buenos Aires (34°20′S, 60°33′W); and Diego de Alvear, Santa Fe (34°21′S, 62°10′W), and disease incidence in the fields was 10 to 60%, 5 to 15%, and 10 to 20%, respectively. The pathogen was isolated on potato glucose agar acidified with 0.2% lactic acid cultured in the dark at 25 ± 1°C. White colonies with compact and tufted mycelium were produced and turned yellow and light tan after 6 days. Appressed and fluffy mycelia were observed in old cultures. Stromata (2 mm diameter) were produced but pycnidia were not detected. After 20 days in culture at 25 ± 1°C under a 12-h light and 12-h dark regime, clustered perithecia developed on stem segments. For each isolate, 10 perithecia, 90 asci, and 30 bicellular, biguttulate ascospores were measured. Averages of asci length and width were 28.3 ± 2.3 and 5.9 ± 0.7 μm, respectively. Averages of ascospores mean length and width were 8.4 ± 0.6 and 2.5 ± 0.4 μm, respectively. These measures were similar to the measures obtained previously (2). Based on these features, the new isolates were classified as D. phaseolorum var. caulivora (Athow & Caldwell). Clustered perithecia, smaller asci and ascospores, and the development of fluffy mycelia with age were the main characteristics that distinguished D. phaseolorum var. caulivora from D. phaseolorum var. meridionalis (1). Pathogenicity trials were performed on cvs. Tracy M, Crockett, Hutchenson, and RA 702 in the greenhouse by placing a small amount of mycelium in soybean seedling hypocotyls wounds made with a scalpel. The pathogen was reisolated from stem portions of the symptomatic plants. Control plants remained healthy. The results reported here show that D. phaseolorum var. caulivora is widely disseminated in the main soybean-producing region of Argentina, where it coexists with D. phaseolorum var. meridionalis (2). The coexistence of both varieties indicates pathogen variability in the region is higher than previously recognized. References: (1) R. N. Pioli et al. Plant Dis. 83:1071, 1999. (2) R. N. Pioli et al. Plant Dis. 85:95, 2001.

scholarly journals Recent Outbreak of Stem Canker (Diaporthe phaseolorum var. meridionalis) of Soybean in Santa Fe, Argentina

Plant Disease ◽  
1997 ◽  
Vol 81 (10) ◽  
pp. 1215-1215 ◽  
Author(s):  
R. Pioli ◽  
S. Gattuso ◽  
D. Prado ◽  
A. Borghi
Keyword(s):  
Cotyledonary Node ◽  
Stem Canker ◽  
Climatic Conditions ◽  
Santa Fe ◽  
Diaporthe Phaseolorum ◽  
Recent Outbreak ◽  
Mycelial Plug ◽  
Glycine Max L ◽  
Phomopsis Phaseoli ◽  
Beak Length

This disease was first noted in the area in February 1993 (2), when a soybean (Glycine max (L.) Merr.) disease survey was conducted in several localities of southern Santa Fe province, the core soybean region of Argentina. At that time, its incidence ranged from 5 to 8% in isolated fields. However, in March 1997, stem canker reached a dramatic 70 to 100% incidence, probably helped by the extensive use of susceptible cultivars, favorable climatic conditions, and inoculum availability from no-till fields. Observed symptoms on stems consisted of V-shaped longitudinal lesions at petiole insertion, with reddish brown margins and discolored centers, where the pycnidia of the anamorph Phomopsis phaseoli (Desmaz.) Sacc. meridionalis Morgan-Jones were found. The lesions coalesced and consequently the main stem and branches died. Foliage symptoms started as yellow blotches, later developing into interveinal chlorosis and necrosis. Perithecia of the teleomorph Diaporthe phaseolorum (Cooke & Ellis) Sacc. var. meridionalis F. A. Fernandez (1) were obtained from infected stems in several crop seasons. Once ripe, the ascospores were cultured on potato dextrose agar (PDA) acidified with lactic acid (0.2%), amended with streptomycin (100 mg/liter), and maintained in darkness at 20 to 25°C. Yellowish white colonies were obtained, later becoming tan and developing perithecia. Perithecia had a beak length of 868 ± 183 μm, neck width of 126.2 ± 17 μm, the asci of 36.7 ± 4.7 μm length and bicellular biguttulate ascospores of 10.2 ± 1 μm length and 3 ± 0.13 μm width. All features match the available descriptions of the pathogen (1). Pathogenicity trials were performed on seedlings of resistant and susceptible cultivars up to second trifoliar leaf stage; these cultivars were classified according to inoculations and field behavior. Plants were wounded with a scalpel in the cotyledonary node and inoculated with a 3-mm-diameter PDA mycelial plug, covered with vaseline. Control seedlings were either not wounded or similarly wounded and covered with vaseline but no PDA plugs were applied. Symptom development was observed within 4 days from inoculation in the top leaf, and in 7 days most seedlings of susceptible cultivars were dead. Resistant cultivars survived and showed only reddish discoloration in wounds. The control seedlings were symptomless and the pathogen was not isolated from them. Conversely, inoculated seedlings with visible symptoms consistently yielded D. phaseolorum var. meridionalis from stem sections at different distances from the inoculation point.When cultured on water agar, alpha conidia from pycnidia and ascospores from the perithecia were obtained. References: (1) F. A. Fernandez and R. T. Hanlin. Mycologia 88:425, 1996. (2) R. N. Pioli et al. Comun. Biol. 11:156, 1993.

scholarly journals First Report on Pathogenic Variability of Different Isolates of Diaporthe phaseolorum var. meridionalis on Soybean in Argentina

Plant Disease ◽  
1999 ◽  
Vol 83 (11) ◽  
pp. 1071-1071 ◽  
Author(s):  
R. N. Pioli ◽  
E. N. Morandi ◽  
C. O. Gosparini ◽  
A. L. Borghi
Keyword(s):  
Resistance Genes ◽  
Stem Canker ◽  
Growing Seasons ◽  
Diaporthe Phaseolorum ◽  
Glycine Max L ◽  
Glucose Agar ◽  
Soybean Plants ◽  
Pathogenic Variability ◽  
Major Resistance Genes ◽  
Phomopsis Phaseoli

The objective of this study was to characterize the pathogenicity of several local isolates of Diaporthe phaseolorum (Cooke & Ellis) Sacc. var. meridionalis Fernández and its anamorph, Phomopsis phaseoli (Desmaz.) Sacc. meridionalis Morgan-Jones, the causal agent of southern stem canker of soybean (Glycine max (L.) Merr.), in soybean lines carrying major resistance genes. Soybean plants with typical stem canker symptoms were collected during the 1996 to 1997 and 1997 to 1998 growing seasons in the central and southern areas of Santa Fe Province, Argentina. The pathogen was isolated from the internal tissues of infected stems, cultured on potato glucose agar acidified with 0.2% lactic acid (APGA), amended with streptomycin at 100 mg/liter, and maintained in the dark at 25 ± 1°C. Isolates were characterized based on the morphology of colonies, perithecia, and pycnidia and measurement of asci, bicellular, biguttulate ascospores, and alpha conidia (1). Soybean cultivars used to assay pathogenicity included Tracy M (Rdc1 and Rdc2 genes), Isoline I (Tracy Misoline with only the Rdc1 gene), Isoline II (Tracy M isoline with only the Rdc2 gene), Crockett (Rdc3 gene), Hutchinson (Rdc4 gene), and RA 702 (susceptible cultivar). Hypocotyls of 14-day-old seedlings grown in the greenhouse were inoculated by the toothpick method. Four replicates of nine seedlings each were used. Seedlings punctured with sterile toothpicks served as controls. The experiment was repeated twice with similar results. The D. phaseolorum var. meridionalis isolates assayed and their collection locations were Dpm1 (Malabrigo), Dpm2 (Los Molinos), Dpm3 (San Justo), Dpm5 (Oliveros), Dpm6 (San Jerónimo), and Dpm7 (Clarke). Twenty-eight days after inoculation, stem canker reactions were measured as the percentage of dead plants. The pathogen was reisolated from stems of randomly chosen symptomatic plants on day 14 after inoculation. These plants were included in the calculation of the percentage of dead plants. In control plants, lesions were not detected, and mycelial growth did not occur from stem portions plated on APGA. Tracy M and RA 702 had 0 to 7% dead plants and 70 to 95% dead plants, respectively, with all assayed isolates. Cultivars with single resistance genes reacted differently to various isolates. Isolates Dpm1 and Dpm3 caused little or no stem canker (<10% dead plants) on all cultivars with resistance genes. Isolates Dpm2 and Dpm6 killed 56 and 52%, respectively, of Isoline II (Rdc2 gene) plants. Isolates Dpm2 and Dpm7 killed 25% of cv. Hutchinson (Rdc4 gene) and Isoline I (Rdc1 gene) plants, respectively. Isolate Dpm5 killed <12% of plants with genes Rdc1, Rdc2, or Rdc3. The reaction of isolate Dpm5 with Hutchinson (Rdc4 gene) was not evaluated. The pathogenic diversity of these isolates of D. phaseolorum var. meridionalis may have been induced by the wide diffusion of resistant host cultivars (2). References: (1) F. A. Fernández and R. T. Hanlin. Mycologia 88:425, 1996. (2) A. W. Zhang et al. Phytopathology 88:1306, 1998.

scholarly journals First Report of Soybean Stem Canker Caused by Diaporthe phaseolorum var. caulivora in Argentina

Plant Disease ◽  
2001 ◽  
Vol 85 (1) ◽  
pp. 95-95 ◽  
Author(s):  
R. N. Pioli ◽  
E. N. Morandi ◽  
V. Bisaro
Keyword(s):  
Disease Incidence ◽  
Low Frequency ◽  
Principal Component ◽  
Stem Canker ◽  
Morphological Characters ◽  
Santa Fe ◽  
First Report ◽  
Soybean Seedlings ◽  
Diaporthe Phaseolorum ◽  
Soybean Plants

A soybean stem canker (SSC) outbreak caused by Diaporthe phaseolorum (Cooke & Ellis) Sacc. var. meridionalis Fernández was reported in Santa Fe, Argentina, in 1997 (3). In 1999 an isolate, which was morphologically distinct from D. phaseolorum var. meridionalis, was obtained from stems of field-grown soybean plants exhibiting SSC symptoms, at Oliveros, Santa Fe, Argentina (Lat. 32° 33′S, Lon. 60° 51′W). Disease incidence was 76% in the field where samples were collected. The pathogen was isolated in darkness at 25°C on potatoglucose agar acidified with 0.2% lactic acid (3). The isolate produced white colonies with compact and tufted mycelium that changed to yellow and light tan with age. Stromata and pycnidia were not produced. After 35 days in culture, clustered perithecia were frequently observed on stem segments. Fifty asci, five from each of 10 perithecia, and bicellular, biguttulated ascospores were measured. Ascus mean length was 26.9 ± 2.5 μm and width was 5.3 ± 0.5 μm; ascospore mean length was 8.3 ± 0.6 μm and width was 2.6 ± 0.1μm. Based on these features, the new isolate was classified as D. phaseolorum var. caulivora Athou & Caldwell (1). To further compare the new isolate with previous identified ones, a principal component analysis (PCA, SAS Systems) was performed using seven isolates of D. phaseolorum var. meridionalis, three isolates of D. phaseolorum var. sojae, and two isolates of Phomopsis longicolla. Seventeen morphological characters, all related with the color and texture of the colonies, the presence and shape of the pycnidia and conidia, the presence and type of stromata and perithecia, and the length of the asci, were compared. According to the PCA analysis, the principal characters that discriminated SSC producing isolates (D. phaseolorum var. meridionalis and D. phaseolorum var. caulivora) from non-SSC producing ones (D. phaseolorum var. sojae and P. longicolla) were the development of perithecia (r = 0.98) and low frequency stromata (r = 0.98) in D. phaseolorum var. meridionalis and D. phaseolorum var. caulivora isolates. The principal components that discriminated SSC producing isolates were the more compact and tufted aspect of the mycelia (r = 0.95) and the shorter length of the asci (r = 0.83) in D. phaseolorum var. caulivora compared with D. phaseolorum var. meridionalis. Pathogenicity trials were performed under greenhouse conditions by inoculating D. phaseolorum var. caulivora mycelia in hypocotyls of soybean seedlings by the toothpick method (2). Typical SSC symptoms were observed on susceptible plants and the pathogen was re-isolated and identified from stem portions of the first internode above the inoculation point. Pathogenicity trials were repeated twice with similar results. This is the first report of D. phaseolorum var. caulivora in Argentina and, as far as we know, in all of South America. References: (1) F. A. Fernández et al. 1999. Stem canker. Pages 32–35 in: Compendium of Soybean Diseases, 4th ed. APS Press, St. Paul, MN. (2) B. L. Keeling. Phytopathology 72:807–809, 1982. (3) R. N. Pioli et al. Plant Dis. 81:1215, 1997.

scholarly journals Occurrence and intensity of more important fungal diseases on soybean (Glycine max (L.) Merrill) cultivars

2017 ◽  
Vol 38 (SI 2 - 6th Conf EFPP 2002) ◽  
pp. 590-592
Author(s):  
T. Duvnjak ◽  
M. Vrataric ◽  
A. Sudaric ◽  
J. Cosic
Keyword(s):  
Genetic Diversity ◽  
Downy Mildew ◽  
Disease Incidence ◽  
Stem Canker ◽  
Climatic Conditions ◽  
Planting Date ◽  
Fungal Diseases ◽  
Stem Blight ◽  
Growing Seasons ◽  
Glycine Max L

The main objective of this study was to determinate the occurrence and intensity of attack by the more important fungal diseases on soybean in Eastern Croatia. Four-year investigation (1998–2001) was undertaken on 10 domestic soybean cultivars with different level of disease resistance. The investigation was set in two planting date (optimal and delayed) on experimental fields of the Agricultural Institute Osijek. Following more important diseases were established: Downy mildew, Pod and stem blight and Stem canker. Significant differences in disease incidence were caused by genetic diversity of tested materials as well as different climatic conditions among growing seasons. According to planting date, significantly higher incidence of Downy mildew and Pod and stem blight was in optimal planting date.

scholarly journals Resistance to stem canker, frogeye leaf spot and powdery mildew of soybean lines lacking lipoxigenases in the seeds

2002 ◽  
Vol 59 (4) ◽  
pp. 701-705 ◽  
Author(s):  
Carlos Alberto Osório Martins ◽  
Carlos Sigueyuki Sediyama ◽  
Maria Goreti de Almeida Oliveira ◽  
Múcio Silva Reis ◽  
Valterley Soares Rocha ◽  
...  
Keyword(s):  
Powdery Mildew ◽  
Leaf Spot ◽  
Plant Pathogens ◽  
Stem Canker ◽  
Limiting Factor ◽  
Cercospora Sojina ◽  
Frogeye Leaf Spot ◽  
Normal Varieties ◽  
Diaporthe Phaseolorum ◽  
Glycine Max L

The soybean [Glycine max (L.) Merrill] crop holds a prominent position in the Brazilian economy because of the extension of the planted area and volume of grain production, but the beany flavor has been a limiting factor for soybean derivatives consumption by western population. This flavor is produced mainly by action of lipoxygenase enzymes (Lox1, Lox2 and Lox3), present in some commercial varieties. The genetic elimination of the alleles that codify these enzymes is the most appropriate way to avoid problems associated to this deleterious flavor. To elucidate the effect of seed lipoxygenase elimination on the resistance to plant pathogens, normal varieties of soybean (FT-Cristalina RCH, Doko RC and IAC-12) and their backcross-derived lines, both with the three lipoxygenases present in their seeds (triple-positive, TP) and without the three lipoxygenases (triple-null, TN), were tested for their resistance to stem canker (Diaporthe phaseolorum f.sp. meridionalis), frogeye leaf spot (Cercospora sojina Hara), and powdery mildew (Microsphaera diffusa Cke. & Pk.). All genetic materials studied were resistant to stem canker. FT-Cristalina RCH and Doko-RC and their TP and TN lines were resistant to frogeye leaf spot. IAC-12 and its derived lines not only presented a higher disease index, but also the derived lines, TP and TN, were more susceptible, indicating the loss of genes for disease resistance in the backcrosses. There was no association between the elimination of lipoxygenases from the seeds with the resistance to frogeye leaf spot. In relation to the powdery mildew, TP or TN lines presented similar or higher resistance than their respective recurrent parents whose susceptibility appeared in the following order: IAC-12, less susceptible, Doko-RC, intermediate and FT-Cristalina RCH, more susceptible.

scholarly journals First report of Diaporthe ueckerae causing stem canker on soybean (Glycine max L.) in Colombia

Plant Disease ◽  
2021 ◽  
Author(s):  
Nathali López-Cardona ◽  
YUDY ALEJANDRA GUEVARA ◽  
Lederson Gañán-Betancur ◽  
Carol Viviana Amaya Gomez
Keyword(s):  
Management Strategies ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Stem Canker ◽  
Growth Stages ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Glycine Max L ◽  
Soybean Plants

In October 2018, soybean plants displaying elongated black to reddish-brown lesions on stems were observed in a field planted to the cv. BRS Serena in the locality of Puerto López (Meta, Colombia), with 20% incidence of diseased plants. Symptomatic stems were collected from five plants, and small pieces (∼5 mm2) were surface sterilized, plated on potato dextrose agar (PDA) and incubated for 2 weeks at 25°C in darkness. Three fungal isolates with similar morphology were obtained, i.e., by subculturing single hyphal tips, and their colonies on PDA were grayish-white, fluffy, with aerial mycelium, dark colored substrate mycelium, and produced circular black stroma. Pycnidia were globose, black, occurred as clusters, embedded in tissue, erumpent at maturity, with an elongated neck, and often had yellowish conidial cirrus extruding from the ostiole. Alpha conidia were observed for all isolates after 30 days growth on sterile soybean stem pieces (5 cm) on water agar, under 25ºC and 12 h light/12h darkness photoperiod. Alpha conidia (n = 50) measured 6.0 – 7.0 µm (6.4 ± 0.4 µm) × 2.0 – 3.0 µm (2.5± 0.4 µm), were aseptate, hyaline, smooth, ellipsoidal, often biguttulate, with subtruncate base. Beta conidia were not observed. Observed morphological characteristics of these isolates were similar to those reported in Diaporthe spp. by Udayanga et al. (2015). DNA from each fungal isolate was used to sequence the internal transcribed spacer region (ITS), and the translation elongation factor 1-α (TEF1) gene, using the primer pairs ITS5/ITS4 (White et al. 1990) and EF1-728F/EF1- 986R (Carbone & Kohn, 1999), respectively. Results from an NCBI-BLASTn, revealed that the ITS sequences of the three isolates (GenBank accessions MW566593 to MW566595) had 98% (581/584 bp) identity with D. miriciae strain BRIP 54736j (NR_147535.1), whereas the TEF1 sequences (GenBank accessions MW597410 to MW597412) had 97 to 100% (330-339/339 bp) identity with D. ueckerae strain FAU656 (KJ590747). The species Diaporthe miriciae R.G. Shivas, S.M. Thomps. & Y.P. Tan, and Diaporthe ueckerae Udayanga & Castl. are synonymous, with the latter taking the nomenclature priority (Gao et al. 2016). According to a multilocus phylogenetic analysis, by maximum likelihood, the three isolates clustered together in a clade with reference type strains of D. ueckerae (Udayanga et al. 2015). Soybean plants cv. BRS Serena (growth stages V3 to V4) were used to verify the pathogenicity of each isolate using a toothpick inoculation method (Mena et al. 2020). A single toothpick colonized by D. ueckerae was inserted directly into the stem of each plant (10 plants per isolate) approximately 1 cm below the first trifoliate node. Noncolonized sterile toothpicks, inserted in 10 soybean plants served as the non-inoculated control. Plants were arbitrarily distributed inside a glasshouse, and incubated at high relative humidity (>90% HR). After 15 days, inoculated plants showed elongated reddish-brown necrosis at the inoculated sites, that were similar to symptoms observed in the field. Non-inoculated control plants were asymptomatic. Fungal cultures recovered from symptomatic stems were morphologically identical to the original isolates. This is the first report of soybean stem canker caused by D. ueckerae in Colombia. Due to the economic importance of this disease elsewhere (Backman et al. 1985; Mena et al. 2020), further research on disease management strategies to mitigate potential crop losses is warranted.

scholarly journals Occurrence of Diaporthe phaseolorum var. meridionalis on Soybean in Illinois

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1211-1211 ◽  
Author(s):  
C. E. Gravert ◽  
S. Li ◽  
G. L. Hartman
Keyword(s):  
Stem Canker ◽  
The United States ◽  
The State ◽  
Potato Dextrose Agar ◽  
Phomopsis Longicolla ◽  
Growing Seasons ◽  
Irregular Shapes ◽  
Diaporthe Phaseolorum ◽  
Northern Regions ◽  
Soybean Plants

Both Diaporthe phaseolorum var. caulivora and D.phaseolorum var. meridionalis cause stem canker on soybean, with D. phaseolorum var. caulivora reported in the northern regions and D. phaseolorum var. meridionalis reported in the southern regions of the United States (1). During the 1999 and 2000 growing seasons, fungi were isolated from soybean plants from growers' fields exhibiting stem canker symptoms. Stem tissue along the margin of the canker was cut into 1- to 5-mm3 pieces, surface-disinfected for 4 min in 0.5% NaOCl solution, rinsed twice, and plated on water or potato dextrose agar (PDA). Fungi of interest were hyphal tipped, grown on PDA at 21°C with 24 h of light, and identified by culture and spore morphology after 3 to 4 weeks. Typical D. phaseolorum var. meridionalis isolates produced white, lanose colonies that turned tan with age. Most of the D. phaseolorum var. meridionalis isolates produced pycnidia with alpha spores and beaked perithecia after 25 to 30 days (2). Brown to black stromata formed in irregular shapes. Of the 16 D. phaseolorum var. meridionalis isolates identified, 11 were from Illinois, 1 each from Indiana and Ohio, and 3 from Kentucky. In Illinois, four isolates were from the northern part of the state, and the rest were from the central and southern areas of the state. In addition to D. phaseolorum var. meridionalis, other isolates obtained from soybean plants included D. phaseolorum var. caulivora, D. phaseolorum var. sojae, and Phomopsis longicolla. References: (1) J. A. McGee and D. C. Biddle. Plant Dis. 71:620, 1987. (2) A. W. Zhang et al. Phytopathology 88:1306, 1998.

scholarly journals First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jinjie Hu ◽  
Qian Zhou ◽  
Chaohui Shi ◽  
Yexin Ke ◽  
Shun Xiao ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Solanum Melongena ◽  
Stem Canker ◽  
Morphological Characters ◽  
Single Spore ◽  
Specific Primers ◽  
Fujian Province ◽  
Phomopsis Longicolla ◽  
Fungal Isolation ◽  
First Report

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only for P. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus’s pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Sign in / Sign up

Export Citation Format

Share Document