First Report of Septoria Leaf Spot on Cornus sericea in Italy

Cornus sericea (synonym C. stolonifera), family Cornaceae, is becoming widely used in Italy as ground cover in parks and gardens. In spring 2001, severe outbreaks of a previously unknown disease were observed in several gardens located in northern Italy (Biella Province). Infected leaves displayed small, circular, angular, or irregular necrotic lesions measuring 1 to 3 mm in diameter. Lesions were olivaceous to dark brown with a distinct reddish-to-black margin and surrounded by a chlorotic halo. Lesions eventually coalesced. Under favorable conditions, infected leaves become heavily spotted, dulling their appearance; severe infections resulted in premature defoliation. Pycnidia occurred on diseased leaves, and a fungus identified as Septoria cornicola (1) was consistently isolated on potato dextrose agar (PDA). Dark mycelium grew slowly on PDA and produced abundant pycnidia and conidia. Conidia were holoblastic, hyaline, 2 to 6 septate, 22 to 48 µm (average 35) × 2.2 to 3.6 µm (average 2.5). Pathogenicity tests were performed by inoculating leaves of healthy plants of C. sericea (cv. Flaviramea) with a conidial suspension (1 × 106 CFU/ml). Noninoculated plants served as controls. Plants were covered for 72 h with plastic bags and maintained in a growth chamber at 20°C. The first lesions developed on leaves of inoculated plants after 15 days. From such lesions, S. cornicola was consistently reisolated. No symptoms occurred on control plants. The presence of S. cornicola on C. sericea cv. Flaviramea has been reported in the United States (2) and was observed in 1905 in northeastern Italy on Cornus sanguinea (1), but to our knowledge, this is the first report of septoria leaf spot on C. sericea in Italy. References: (1) D. F. Farr. Mycologia, 83:611, 1991. (2) D. Neely and D. S. Nolte. J. Arboric. 15:263, 1989.

Download Full-text

First Report of Leaf Spot of Rudbeckia hirta var. pulcherrima Caused by Septoria rudbeckiae in Korea

Plant Disease ◽

10.1094/pdis-02-12-0172-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 911-911 ◽

Cited By ~ 1

Author(s):

J. H. Park ◽

S. E. Cho ◽

K. S. Han ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

The United States ◽

Flowering Plant ◽

Leaf Spot Disease ◽

Morphological Identification ◽

Its Sequence ◽

Conidial Suspension ◽

First Report ◽

Rudbeckia Hirta ◽

Close Phylogenetic Relationship

Rudbeckia hirta L. var. pulcherrima Farw. (synonym R. bicolor Nutt.), known as the black-eyed Susan, is a flowering plant belonging to the family Asteraceae. The plant is native to North America and was introduced to Korea for ornamental purposes in the 1950s. In July 2011, a previously unknown leaf spot was first observed on the plants in a public garden in Namyangju, Korea. Leaf spot symptoms developed from lower leaves as small, blackish brown lesions, which enlarged to 6 mm in diameter. In the later stages of disease development, each lesion was usually surrounded with a yellow halo, detracting from the beauty of the green leaves of the plant. A number of black pycnidia were present in diseased leaf tissue. Later, the disease was observed in several locations in Korea, including Pyeongchang, Hoengseong, and Yangpyeong. Voucher specimens were deposited at the Korea University Herbarium (KUS-F25894 and KUS-F26180). An isolate was obtained from KUS-F26180 and deposited at the Korean Agricultural Culture Collection (Accession No. KACC46694). Pycnidia were amphigenous, but mostly hypogenous, scattered, dark brown-to-rusty brown, globose, embedded in host tissue or partly erumpent, 50 to 80 μm in diameter, with ostioles 15 to 25 μm in diameter. Conidia were substraight to mildly curved, guttulate, hyaline, 25 to 50 × 1.5 to 2.5 μm, and one- to three-septate. Based on the morphological characteristics, the fungus was consistent with Septoria rudbeckiae Ellis & Halst. (1,3,4). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA.). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 528 bp was deposited in GenBank (Accession No. JQ677043). A BLAST search showed that there was no matching sequence of S. rudbeckiae; therefore, this is the first ITS sequence of the species submitted to GenBank. The ITS sequence showed >99% similarity with those of many Septoria species, indicating their close phylogenetic relationship. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on potato dextrose agar. Control leaves were sprayed with sterile water. The plants were covered with plastic bags to maintain 100% relative humidity (RH) for the first 24 h. Plants were then maintained in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, leaf spot symptoms identical to those observed in the field started to develop on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. rudbeckiae was reisolated from the lesions of inoculated plants, confirming Koch's postulates. A leaf spot disease associated with S. rudbeckiae has been reported on several species of Rudbeckia in the United States, Romania, and Bulgaria (1–4). To our knowledge, this is the first report of leaf spot on R. hirta var. pulcherrima caused by S. rudbeckiae in Korea. References: (1) J. B. Ellis and B. D. Halsted. J. Mycol. 6:33, 1890. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ February 2, 2012. (3) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973. (4) S. G. Vanev et al. Fungi Bulgaricae 3:1, 1997.

Download Full-text

First Report of Myrothecium roridum Causing Myrothecium Leaf Spot on Salvia spp. in the United States

Plant Disease ◽

10.1094/pdis-91-6-0772b ◽

2007 ◽

Vol 91 (6) ◽

pp. 772-772 ◽

Cited By ~ 7

Author(s):

J. A. Mangandi ◽

T. E. Seijo ◽

N. A. Peres

Keyword(s):

United States ◽

Leaf Spot ◽

Pathogenic Fungi ◽

Lower Surface ◽

The United States ◽

Plant Diseases ◽

Control Measures ◽

Conidial Suspension ◽

First Report ◽

Myrothecium Roridum

The genus Salvia includes at least 900 species distributed worldwide. Wild species are found in South America, southern Europe, northern Africa, and North America. Salvia, commonly referred to as sage, is grown commercially as a landscape plant. In August 2006, pale-to-dark brown, circular leaf spots 5 to 20 mm in diameter with concentric rings were observed on Salvia farinacea ‘Victoria Blue’. Approximately 5% of the plants in a central Florida nursery were affected. Lesions were visible on both leaf surfaces, and black sporodochia with white, marginal hyphal tuffs were present mostly on the lower surface in older lesions. Symptoms were consistent with those of Myrothecium leaf spot described on other ornamentals such as gardenia, begonia, and New Guinea impatiens (4). Isolations from lesions on potato dextrose agar produced white, floccose colonies with sporodochia in dark green-to-black concentric rings. Conidia were hyaline and cylindrical with rounded ends and averaged 7.4 × 2.0 μm. All characteristics were consistent with the description of Myrothecium roridum Tode ex Fr. (2,3). The internal transcribed spacer regions ITS1, ITS2, and the 5.8s rRNA genomic region of one isolate were sequenced (Accession No. EF151002) and compared with sequences in the National Center for Biotechnology Information (NCBI) database. Deposited sequences from M. roridum were 96.3 to 98.8% homologous to the isolate from salvia. To confirm pathogenicity, three salvia plants were inoculated by spraying with a conidial suspension of M. roridum (1 × 105 conidia per ml). Plants were covered with plastic bags and incubated in a growth chamber at 28°C for 7 days. Three plants were sprayed with sterile, distilled water as a control and incubated similarly. The symptoms described above were observed in all inoculated plants after 7 days, while control plants remained symptomless. M. roridum was reisolated consistently from symptomatic tissue. There are more than 150 hosts of M. roridum, including one report on Salvia spp. in Brunei (1). To our knowledge, this is the first report of Myrothecium leaf spot caused by M. roridum on Salvia spp. in the United States. Even the moderate level disease present caused damage to the foliage and reduced the marketability of salvia plants. Therefore, control measures may need to be implemented for production of this species in ornamental nurseries. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2006, (2) M. B. Ellis. Page 449 in: Microfungi on Land Plants: An Identification Handbook. Macmillan Publishing, NY, 1985. (3) M. Fitton and P. Holliday. No. 253 in: CMI Descriptions of Pathogenic Fungi and Bacteria. The Eastern Press Ltd. Great Britain, 1970. (4) M. G. Daughtrey et al. Page 19 in: Compendium of Flowering Potted Plant Diseases. The American Phytopathological Society. St. Paul, MN, 1995.

Download Full-text

First Report of Leaf Spot of Spinach Caused by Pleospora betae in Spain

Plant Disease ◽

10.1094/pdis-04-14-0367-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1583-1583 ◽

Cited By ~ 4

Author(s):

D. D. M. Bassimba ◽

J. L. Mira ◽

A. Vicent

Keyword(s):

Leaf Spot ◽

Spinacia Oleracea ◽

Disease Incidence ◽

Control Measures ◽

Conidial Suspension ◽

First Report ◽

Leaf Spots ◽

Plastic Bags ◽

Swiss Chard ◽

Spinach Leaves

The production of spinach (Spinacia oleracea L.) in Spain has increased 50% since 2009, mainly due to the commercialization of fresh-cut spinach leaves packaged in modified atmosphere containers. In October 2012, light brown leaf spots 1 to 2 cm in diameter with dark concentric rings were observed in a commercial spinach production area in Valencia Province, Spain. The initial outbreak comprised an area of about 3 ha with a 20% disease incidence. Symptomatic leaves from spinach cv. Apollo were collected in the affected area and were surface disinfected with 0.5% NaOCl for 2 min. Small fragments from lesions were placed onto potato dextrose agar (PDA) amended with 0.5 g streptomycin sulfate/liter. Fungal colonies developed after 3 days of incubation at 23°C from about 90% of the infected tissues plated. Isolates were transferred to oatmeal agar (OA) (1) and water agar (WA) amended with autoclaved pea seeds (2). Plates were incubated for 30 days at 24°C with 13 h of fluorescent light and 11 h of dark for morphological examination. Colonies were olivaceous grey in OA and pycnidia developed in WA were globose to subglobose, olivaceous black, and 100 to 200 μm in diameter. Conidia were globose to ellipsoidal, hyaline, aseptate, and 3.8 to 7.7 × 2.4 to 3.9 μm. Swollen cells were observed. Isolates showed a positive reaction to NaOH (1). Partial 18S, ITS1, 5.8S, ITS2, and partial 28S ribosomal RNA (rRNA) regions were amplified using the primers ITS1 and ITS4 (4) and sequenced from DNA extracted from the isolate designated as IVIA-V004 (GenBank Accession No. KF321782). The sequence had 100% identity (e-value 0.0) with that of Pleospora betae (Berl.) Nevod. (syn. Phoma betae A.B. Frank) representative strain CBS 523.66 (1). Pathogenicity tests were performed twice by inoculating 4-month-old plants of spinach cv. Apollo, table beet (Beta vulgaris L.) cv. Detroit, and Swiss chard (B. vulgaris subsp. cicla) cv. Verde de Penca Blanca. Plants were inoculated by spraying a conidial suspension of isolate IVIA-V004 (10 ml/plant, 105 conidia/ml water) using a manual pressure sprayer. Plants were immediately covered with black plastic bags and incubated in a growth chamber at 23°C. In each experiment, four plants of each host were inoculated with the fungus and four additional plants sprayed with sterile distilled water were used as controls. Plastic bags were removed after 48 h and leaf spots similar to those observed in affected spinach plants in the field were visible on all spinach, table beets, and Swiss chard plants 3 to 5 days after inoculation. No symptoms were observed on control plants. Fungal colonies morphologically identified as P. betae were re-isolated from leaf lesions on inoculated plants, but not from asymptomatic leaves of control plants. To our knowledge, this is the first report of leaf spot caused by P. betae on spinach in Spain, where it was previously described affecting sugar beet (3). The disease reduces the quality of spinach leaves and proper control measures should be implemented. References: (1) G. H. Boerema et al. Phoma Identification Manual, Differentiation of Specific and Infra-Specific Taxa in Culture. CABI Publishing, Wallingford, UK, 2004. (2) O. D. Dhingra and J. B. Sinclair. Basic Plant Pathology Methods, 2nd ed. CRC Press, Boca Raton, FL, 1995. (3) P. Melgarejo et al. Patógenos de Plantas Descritos en España. MARM-SEF, Madrid, 2010. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Leaf Spot Caused by Colletotrichum fructicola and C. siamense on Zizyphus mauritiana in Guangxi, China

Plant Disease ◽

10.1094/pdis-09-20-1863-pdn ◽

2020 ◽

Author(s):

Juan Shu ◽

Tangxun Guo ◽

Qili Li ◽

Lihua Tang ◽

Suiping Huang ◽

...

Keyword(s):

Leaf Spot ◽

Management Strategies ◽

Economic Value ◽

Epidemiological Studies ◽

Conidial Suspension ◽

Tropical Fruit ◽

First Report ◽

Plastic Bags ◽

Zizyphus Mauritiana ◽

Dark Green

Zizyphus mauritiana Lam. is an important tropical fruit tree and has significant economic value. It is widely planted in Hainan, Guangdong, Guangxi and Fujian provinces in China (Yang et al. 2017). In March 2019, leaf spot was observed on leaves of Z. mauritiana at Bagui fields in Nanning, Guangxi, China, with incidence exceeding 50%. Symptomatic leaves developed a yellow to tan-brown sunken lesion and finally abscised. To isolate the pathogen causing the symptoms, small pieces (5 × 5 mm) of infected leaves were surface sterilized by exposure to 75% ethanol for 10 sec, 1% sodium hypochlorite for 1 min and rinsed three times in sterile water. Fifty pieces were isolated, surface sterilized, and pieces were plated onto potato dextrose agar (PDA) and grown at 28°C for 7 days. The isolation rate of Colletotrichum species was 100%. Three representative isolates (DQZ3-1, DQZ3-2 and DQZ3-3) were selected for further study. Mycelia were greyish-white for all three isolates, with isolate DQZ3-1 also appearing dark green in the center of the colony. Conidia were elliptical, aseptate and hyaline, with sizes of 13.4 ± 0.12 µm × 5.7 ± 0.1 µm, 14.8 ± 0.1 µm × 5.8 ± 0.1 µm and 15.1 ± 0.1 µm × 5.5 ± 0.1 µm for DQZ3-1, DQZ3-2 and DQZ3-3, respectively. Genomic DNA was extracted using the DNAsecure Plant Kit [Tiangen Biotech (Beijing) Co., Ltd] and the internal transcribed spacer (ITS), partial actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), beta-tubulin (TUB2), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were sequenced (Weir et al. 2012). Phylogenetic analysis of the three isolates was performed with MEGA-X (Version 10.0) based on sequences of multiple loci (ITS, ACT, CAL, CHS-1, TUB2 and GAPDH) using Maximum Likelihood analysis. Isolate DQZ3-1 was identified as C. fructicola, and the other two isolates, DQZ3-2 and DQZ3-3, were identified as C. siamense (accessions MT039396 to MT039410, for ACT, CAL, CHS-1, GAPDH and TUB2 of DQZ3-1, DQZ3-2 and DQZ3-3; MT041651 to MT041653 for ITS of DQZ3-1, DQZ3-2 and DQZ3-3). Pathogenicity tests were conducted on 1-year-old plants. Young, healthy leaves were artificially wounded by gently scratching with a sterile needle and 10 µl droplets of conidial suspension (106 spores/ml) applied per wound site for each isolate. Some wounded leaves were inoculated with 10 µl droplets of water as controls. Each isolate was inoculated onto three plants, with 15 leaves at least for each plant, same as controls. All inoculated plants were sprayed with water and covered with plastic bags to maintain high humidity. Symptomatic lesions were observed on the inoculated leaves after 7 days at 28°C, whereas no symptoms were observed on the control leaves. To fulfill Koch’s postulates, fungi were re-isolated from 50 symptomatic leaf pieces and fungi re-isolated from each leaf piece were morphologically identical to the inoculated isolates, for a 100% isolation frequency. To our knowledge, this is the first report of leaf spot caused by C. fructicola and C. siamense on Z. mauritiana worldwide. This research may accelerate the development of future epidemiological studies and management strategies for anthracnose caused by C. fructicola and C. siamense on Z. mauritiana.

Download Full-text

First Report of Septoria Leaf Spot of Lavandin Caused by Septoria lavandulae in Croatia

Plant Disease ◽

10.1094/pdis-07-13-0735-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 282-282

Author(s):

K. Vrandečić ◽

J. Ćosić ◽

D. Jurković ◽

I. Stanković ◽

A. Vučurović ◽

...

Keyword(s):

Leaf Spot ◽

Antibacterial Properties ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Identification ◽

Conidial Suspension ◽

Necrotic Tissue ◽

First Report ◽

Initial Symptoms ◽

Septoria Leaf Spot

Lavandula × intermedia Emeric ex Loiseleur, commonly known as lavandin, is an aromatic and medicinal perennial shrub widely and traditionally grown in Croatia. The lavandin essential oil is primarily used in perfumery and cosmetic industries, but also possesses anti-inflammatory, sedative, and antibacterial properties. In June 2012, severe foliar and stem symptoms were observed on approximately 40% of plants growing in a commercial lavandin crop in the locality of Banovo Brdo, Republic of Croatia. Initial symptoms on lower leaves included numerous, small, oval to irregular, grayish brown lesions with a slightly darker brown margin of necrotic tissue. Further development of the disease resulted in yellowing and necrosis of the infected leaves followed by premature defoliation. Similar necrotic oval-shaped lesions were observed on stems as well. The lesions contained numerous, dark, sub-globose pycnidia that were immersed in the necrotic tissue or partly erumpent. Small pieces of infected internal tissues were superficially disinfected with 50% commercial bleach (4% NaOCl) and placed on potato dextrose agar (PDA). A total of 10 isolates from leaves and five from stems of lavandin formed a slow-growing, dark, circular colonies with raised center that produced pycnidia at 23°C, under 12 h of fluorescent light per day. All 15 recovered isolates formed uniform hyaline, elongate, straight or slightly curved conidia with 3 to 4 septa, with average dimensions of 17.5 to 35 × 1.5 to 2.5 μm. Based on the morphological characteristics, the pathogen was identified as Septoria lavandulae Desm., the causal agent of lavender leaf spot (1,2). Pathogenicity of one selected isolate (428-12) was tested by spraying 10 lavandin seedlings (8 weeks old) with a conidial suspension (106 conidia/ml) harvested from a 4-week-old monoconidial culture on PDA. Five lavandin seedlings, sprayed with sterile distilled water, were used as negative control. After 5 to 7 days, leaf spot symptoms identical to those observed on the source plants developed on all inoculated seedlings and the pathogen was successfully re-isolated. No symptoms were observed on any of the control plants. Morphological identification was confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region of rDNA (3). Total DNA was extracted directly from fungal mycelium with a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and PCR amplification performed with primers ITS1F/ITS4. Sequence analysis of ITS region revealed at least 99% identity between the isolate 428-12 (GenBank Accession No. KF373078) and isolates of many Septoria species; however, no information was available for S. lavandulae. To our knowledge, this is the first report of Septoria leaf spot of lavandin caused by S. lavandulae in Croatia. Since the cultivation area of lavandin plants has been increasing in many continental parts of Croatia, especially in Slavonia and Baranja counties, the presence of a new and potentially harmful disease may represent a serious constraint for lavandin production and further monitoring is needed. References: (1) T. V. Andrianova and D. W. Minter. IMI Descriptions of Fungi and Bacteria, 142, Sheet 1416, 1999. (2) R. Bounaurio et al. Petria 6:183, 1996. (3) G. J. M. Verkley et al. Mycologia 96:558, 2004.

Download Full-text

First Report of Volutella Blight on Pachysandra Caused by Volutella pachysandricola in China

Plant Disease ◽

10.1094/pdis-11-11-0997 ◽

2012 ◽

Vol 96 (4) ◽

pp. 584-584

Author(s):

Q. Bai ◽

Y. Xie ◽

R. Dong ◽

J. Gao ◽

Y. Li

Keyword(s):

Morphological Characteristics ◽

Stem Canker ◽

Botanical Garden ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

Conidial Suspension ◽

First Report ◽

Leaf Spots ◽

Plastic Bags

Pachysandra (Pachysandra terminalis, Buxaceae) and Japanese Pachysandra, also called Japanese Spurge, is a woody ornamental groundcover plant distributed mostly in Zhejiang, Guizhou, Henan, Hubei, Sichuan, Shanxi, and Gansu provinces in China. In April 2010, P. terminalis asymptomatic plants were shipped from Beijing Botanical Garden Institute of Botany Chinese Academy of Science to the garden nursery of Jilin Agricultural University (43°48′N, 125°23′E), Jilin Province. In June 2011, Volutella blight (sometimes called leaf blight and stem canker) of P. terminalis was observed on these plants. Infected leaves showed circular or irregular, tan-to-brown spots often with concentric rings and dark margins. The spots eventually grew and coalesced until the entire leaf died. Cankers appeared as greenish brown and water-soaked diseased areas, subsequently turning brown or black, and shriveled and often girdled the stems and stolons. During wet, humid weather in autumn, reddish orange, cushion-like fruiting structures of the fungus appeared on the stem cankers and undersides of leaf spots. Symptoms of the disease were consistent with previous descriptions (2–4). Five isolates were obtained from necrotic tissue of leaf spots and cankers of stems and stolons and cultured on potato dextrose agar. The colony surface was salmon colored and slimy. Conidia were hyaline, one celled, spindle shaped, and 12.57 to 22.23 × 3.33 to 4.15 μm with rounded ends. Morphological characteristics of the fungus were consistent with the description by Dodge (2), and the fungus was identified as Volutella pachysandricola (telemorph Pseudonectria pachysandricola). The internal transcribed spacer (ITS) regions of the nuclear rDNA were amplified using primers ITS4/ITS5 (1). The ITS sequences were 553 bp long and identical among these five isolates (GenBank Accession No. HE612114). They were 100% identical to Pseudonectria pachysandricola voucher KUS-F25663 (Accession No. JN797821) and 99% identical to P. pachysandricola culture-collection DAOM (Accession No. HQ897807). Pathogenicity was confirmed by spraying leaves of clonally propagated cuttings of P. terminalis with a conidial suspension (1 × 106 conidia/ml) of the isolated V. pachysandricola. Control leaves were sprayed with sterile water. Plants were covered with plastic bags and kept in a greenhouse at 20 to 25°C for 72 h. After 5 to 8 days, typical disease symptoms appeared on leaves, while the control plants remained healthy. V. pachysandricola was reisolated from the leaf spots of inoculated plants. Pachysandra leaf blight and stem canker also called Volutella blight, is the most destructive disease of P. terminalis and previously reported in the northern humid areas of the United States (Illinois, Connecticut, Ohio, Indiana, Iowa, Massachusetts, Missouri, Kentucky, and Wisconsin), northern Europe (Britain, Germany, and Poland), and the Czech Republic. To our knowledge, this is the first report of the disease caused by V. pachysandricola in China. The disease may become a more significant problem in P. terminalis cultivation areas if the disease spreads on P. terminalis in nursery beds. References: (1) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (2) B. O. Dodge. Mycologia 36:532, 1944. (3) S. M. Douglas. Online publication. Volutella Blight of Pachysandra. The Connecticut Agricultural Experiment Station, 2008. (4) I. Safrankova. Plant Protect. Sci.43:10, 2007.

Download Full-text

First Report of Ascochyta Leaf Spot Caused by Phoma exigua var. exigua on Common Bean in Greece

Plant Disease ◽

10.1094/pdis-92-4-0653c ◽

2008 ◽

Vol 92 (4) ◽

pp. 653-653 ◽

Cited By ~ 3

Author(s):

G. A. Bardas ◽

G. T. Tziros ◽

K. Tzavella-Klonari

Keyword(s):

Common Bean ◽

Leaf Spot ◽

Morphological Characteristics ◽

Pathogenic Fungi ◽

Weather Conditions ◽

Conidial Suspension ◽

Phoma Exigua ◽

First Report ◽

Plastic Bags ◽

And Control

Common bean (Phaseolus vulgaris L.) is cultivated extensively in Greece for dry and fresh bean production. During 2005 and 2006, a disease with typical blight symptoms was observed occasionally on dark red kidney, brown kidney, and black bean plants in most bean-producing areas of Greece. It rarely was destructive unless the crop had been weakened by some unfavorable environmental conditions. Infected leaves had brown-to-black lesions that developed concentric zones 10 to 30 mm in diameter and also contained small, black pycnidia. Concentric dark gray-to-black lesions also appeared on branches, stems, nodes, and pods. Infected seeds turned brown to black. Plants sometimes showed defoliation and pod drop. The fungus was consistently isolated on potato dextrose agar from diseased leaves and pods and identified as Phoma exigua var. exigua Sutton and Waterstone on the basis of morphological characteristics of conidia and pycnidia (1,2). Spores were massed in pycnidia from which they were forced in long, pink tendrils under moist weather conditions. Conidia were cylindrical to oval, allantoid, hyaline, pale yellow to brown, usually one-celled, and 2 to 3 × 5 to 10 μm. To satisfy Koch's postulates, a conidial suspension (1 × 106 conidia per ml) of the fungus was sprayed onto leaves and stems of bean seedlings (first-leaf stage) (cv. Zargana Hrisoupolis). Both inoculated and control seedlings (inoculated with sterile water) were covered with plastic bags for 72 h in a greenhouse at 23°C. Inoculated plants showed characteristic symptoms of Ascochyta leaf spot 12 to 15 days after inoculation. The fungus was reisolated from lesions that developed on the leaves and stems of all inoculated plants. The pathogen is present worldwide on bean. To our knowledge, this is the first report of P. exigua var. exigua on common bean in Greece. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2007. (2) B. C. Sutton and J. M. Waterstone. Ascochyta phaseolorum. No. 81 in: Descriptions of Pathogenic Fungi and Bacteria. CMI/AAB, Kew, Surrey, England, 1966.

Download Full-text

First Report of Leaf Spot Caused by Phoma dictamnicola on Dictamnus dasycarpus in Korea

Plant Disease ◽

10.1094/pdis-06-14-0658-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1443-1443

Author(s):

J. H. Park ◽

S. E. Cho ◽

C. K. Lee ◽

S. H. Lee ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

Its Region ◽

Molecular Data ◽

Culture Collection ◽

Morphological Identification ◽

Conidial Suspension ◽

Aesthetic Value ◽

Transparent Plastic ◽

First Report ◽

Plastic Bags

Dictamnus dasycarpus Turcz, known as densefruit pittany, is a perennial herbal plant belonging to the Rutaceae. In Oriental medicine, this plant is used for treatment of various ailments (4). Since the white and purple striped flowers and glossy leaves are of aesthetic value, the plant is popular in gardens throughout Korea. In July 2012, a leaf spot was observed on hundreds of D. dasycarpus with nearly 100% incidence in a garden in Gapyeong County, Korea. Lesions on leaves reaching up to 20 mm in diameter were circular to irregular, brown to dark brown, then becoming zonate with age, and finally fading to grayish brown in the center with a reddish brown margin. The disease caused premature defoliation and reduced plant vigor as well as aesthetic value. In June 2014, the same symptoms were found on D. dasycarpus in a nursery in Jinju City, Korea. Representative samples were deposited in the Korea University Herbarium (KUS). Pycnidia on lesions were epiphyllous, immersed or semi-immersed in host tissue, light brown to olive brown, and 90 to 210 μm in diameter. Ostioles were 15 to 30 μm wide and surrounded by a ring of darker cells. Conidia were hyaline, smooth, ellipsoidal to nearly reniform, straight to mildly curved, aseptate or rarely medianly 1-septate with age, 5.5 to 9.6 × 1.8 to 3.6 μm, and contained small oil drops. These characteristics were consistent with the previous descriptions of Phoma dictamnicola Boerema, Gruyter & Noordel. (1,2). A monoconidial isolate was cultured on potato dextrose agar plates and deposited in the Korea Agricultural Culture Collection (Accession No. KACC46948). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using a DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 505 bp was deposited in GenBank (Accession No. KM047023). A BLAST search showed that the ITS sequence shared >99% similarity with that of P. dictamnicola (GU237877). For the pathogenicity tests, inoculum was prepared by harvesting conidia from 30-day-old cultures of KACC46948 and a conidial suspension (2 × 106 conidia/ml) was sprayed onto leaves of five healthy seedlings. Five seedlings were sprayed with sterile distilled water, serving as controls. The plants were covered with transparent plastic bags for 48 h in a 25°C glasshouse with a 12-h photoperiod. After 10 days, typical leaf spot symptoms started to develop on the leaves of the inoculated plants. The fungus, P. dictamnicola, was re-isolated from those lesions, confirming Koch's postulates. No symptoms were observed on control plants. Previously, Phoma leaf spot on Dictamnus spp. has been reported in the Netherlands and North America (3) and recently in China (1). To our knowledge, this is the first report of leaf spot on D. dasycarpus caused by P. dictamnicola in Korea. Our observations suggest that low humidity with good ventilation as well as removal of infected leaves and plant debris might be main strategies for preventing this disease. References: (1) Q. Bai et al. Plant Dis. 95:771, 2011. (2) G. H. Boerema et al. Phoma Identification Manual: Differentiation of Specific and Infra-Specific Taxa in Culture. CABI Publishing. Wallingford, UK, 2004. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, USDA ARS, Retrieved June 19, 2014. (4) J. L. Yang et al. Planta Med. 77:271, 2011.

Download Full-text

First Report of Alternaria alternata f. sp. cucurbitae Causing Alternaria Leaf Spot of Melon in the Mid-Atlantic Region of the United States

Plant Disease ◽

10.1094/pdis-92-4-0652b ◽

2008 ◽

Vol 92 (4) ◽

pp. 652-652 ◽

Cited By ~ 2

Author(s):

X. G. Zhou ◽

K. L. Everts

Keyword(s):

United States ◽

Disease Severity ◽

Body Length ◽

Alternaria Alternata ◽

Leaf Spot ◽

The United States ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

Alternaria Leaf Spot

Alternaria alternata f. sp. cucurbitae, the casual agent of Alternaria leaf spot, was first described in Greece where it caused severe losses to greenhouse-grown cucumbers (Cucumis sativus) (3,4). The fungus also attacks melon (C. melo) and watermelon (Citrullus lanatus) (1–3). In late June of 2006, following a period of windy and rainy days, numerous dark brown, circular lesions, 0.5 to 1 mm in diameter, were observed on leaves of melons in a field in Wicomico County, Maryland. The lesions gradually enlarged and coalesced into large, nearly circular, or irregularly shaped lesions that could be as long as 3 cm. The center of the lesions was light tan, surrounded by a dark brown ring and a chlorotic halo, and tended to split in the later development stages. Most of the lesions appeared on the edge of the leaves and no lesions developed on the stems and fruit. Lesions first started on old leaves and then developed on leaves in the middle part of the canopy. Leaf lesions were observed on melon cvs. Ananas, Honeydew Greenflesh, and Israeli. Disease severity ranged from 3 to 20% of the leaf area affected. Small pieces (3 × 3 mm) of tissue removed from the margin between healthy and diseased tissue were surface disinfected in 0.5% NaOCl for 2 min and plated on acidified, ¼-strength potato dextrose agar. Isolations made from diseased tissue frequently (61%) yielded fungal colonies with morphological features and spore dimensions that were consistent with the description of A. alternata f. sp. cucurbitae (1,3). Fungal isolates were characterized by small, short-beaked, multicellular conidia. Conidia were ovoid, obclavate, and sometimes ellipsoidal with the average overall body length of 39 μm (range, 17 to 80 μm) and width of 14 μm (range, 7 to 20 μm). Conidia were produced on short conidiophores in chains. The beaks were short (often less than one-third the body length) and conical or cylindrical. Pathogenicity of six single-spore isolates was determined on four melon cultivars (Honeydew Greenflesh, Israeli, Tam Dew, and Topmark) and one watermelon cultivar (Sugar Baby) in a greenhouse. Twenty plants of each cultivar at the one-true-leaf stage were sprayed with a conidial suspension (106 conidia/ml) of each isolate amended with 0.1% (vol/vol) of Tween 20 until runoff (1.5 to 2 ml per plant). Inoculation with sterile distilled water amended with 0.1% Tween 20 served as controls. The plants were placed in a dew growth chamber for 48 h at 24°C and subsequently maintained in a greenhouse at 21 to 29°C. At 4 to 5 days after inoculation, each isolate induced leaf lesions on each inoculated cultivar similar to typical lesions observed in the field. There was no significant difference in disease severity among the cultivars tested or between melon and watermelon. Control plants remained symptomless. The fungus was readily reisolated from symptomatic tissues. To our knowledge, this is the first report of A. alternata f. sp. cucurbitae causing Alternaria leaf spot of melon in the Mid-Atlantic United States and the only report outside Georgia in the southern region of the United States (D. B. Langston, personal communication) and Greece. References: (1) D. L. Vakalounakis. Plant Dis. 74:227, 1990. (2) D. L. Vakalounakis. Ann. Appl. Biol. 117:507, 1990. (3) D. L. Vakalounakis. Alternaria leaf spot. Page 24 in: Compendium of Cucurbit Diseases. T. A. Zitter et al., eds. The American Phytopathological Society, St. Paul, MN, 1996. (4) D. L. Vakalounakis and N. E. Malathrakis. J. Phytopathol. 121:325, 1988.

Download Full-text

First Report of Ascochyta Leaf Spot of Quinoa Caused by Ascochyta sp. in the United States

Plant Disease ◽

10.1094/pdis-11-12-1008-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. L. Testen ◽

J. M. McKemy ◽

P. A. Backman

Keyword(s):

United States ◽

Leaf Spot ◽

Sequence Data ◽

Chenopodium Quinoa ◽

The United States ◽

Management Program ◽

Tween 20 ◽

Conidial Suspension ◽

First Report ◽

The Impact

The Andean crop quinoa (Chenopodium quinoa Willd.), an amaranthaceous pseudograin, is an important food and export crop for this region. Quinoa is susceptible to Ascochyta leaf spot reportedly caused by Ascochyta hyalospora and/or A. caulina (1,2), and quinoa seeds can be infested by A. hyalospora (3). Quinoa fields were established in Pennsylvania during summer 2011. Widespread leafspot symptoms were observed on quinoa in mid-August 2011 in Centre County, PA. Tan to reddish-brown, irregularly shaped lesions were observed with numerous black pycnidia randomly distributed within each lesion. Crushed pycnidia revealed sub-hyaline to light brown, 1 to 2, or less often 3 septate, cylindrical to ovoid spores, 13 to 25 μm long by 5 to 10 μm wide. Pure cultures of Ascochyta were obtained by plating pycnidia from surface disinfested leaves onto half strength acidified potato dextrose agar (APDA). To obtain conidia for pathogenicity trials, cultures were transferred to oatmeal agar and placed in a 20°C incubator with a 12-h photoperiod. Conidia were harvested by scraping 2-week-old cultures. The conidial suspension was filtered through cheesecloth and adjusted to 1.8 × 105 conidia/mL. Tween 20 (0.1%) was added to the final inoculum and sprayed (with a Crown Spra-tool) onto ten 1-month old quinoa plants. Six plants sprayed with sterile water with 0.1% Tween 20 served as controls. Plants were placed in a growth chamber and bagged for 48 h to maintain >95% humidity. After 48 h, tan, irregularly shaped lesions were observed on inoculated plants, but no symptoms were observed on control plants. Plants were grown for 2 more weeks to observe symptom development, and then leaves with characteristic lesions were collected for isolation. Symptomatic leaves were surface disinfested in 10% bleach for 1 min and tissue from the lesion periphery was plated onto APDA. Obtained cultures were morphologically and molecularly identical to those obtained from quinoa fields. For molecular identification of the pathogen, DNA was extracted from cultures of Ascochyta and amplified using ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) primers. Sequences obtained shared 99% maximum identity with a GenBank accession of A. obiones (GU230752.1), a species closely related to A. hyalospora and A. caulina (4). However, the obtained pathogen is morphologically more similar to A. hyalospora and A. chenopodii, but not to A. caulina or A. obiones. At this time, final species identification is impossible because no GenBank sequence data is available for A. hyalospora or A. chenopodii. To our knowledge, this is the first report of Ascochyta leaf spot of quinoa in the United States. The impact of Ascochyta leaf spot on domestic and global quinoa production is unknown, but management of foliar diseases of quinoa, including Ascochyta leaf spot, is a critical component of any disease management program for quinoa. References: (1) S. Danielsen. Food Rev. Int. 19:43, 2003. (2) M. Drimalkova. Plant Protect. Sci. 39:146, 2003. (3) G. Boerema. Neth. J. Plant. Pathol. 83:153, 1977. (4) J. de Gruyter. Stud. Mycol. 75:1, 2012.

Download Full-text