scholarly journals Tauopathy-associated tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Vol 15 (1) ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail V. W. Johnson ◽  
Keith Nehrke
Keyword(s):  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Neuronal Morphology ◽  
Mitochondrial Morphology ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

Abstract Background A defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear. Methods Human 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E, to mimic phosphorylation of a commonly observed pathological epitope, and K274/281Q, to mimic disease-associated lysine acetylation – collectively referred as “PTM-mimetics” – as well as a T231A phosphoablation mutant. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age. Genetically-encoded fluorescent biosensors were expressed in touch neurons and used to measure neuronal morphology, mitochondrial morphology, mitophagy, and macro autophagy. Results Unlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and neuronal morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage neuronal mitophagy in response to mitochondrial stress. Conclusions Limiting the expression of tau results in a genetic model where modifications that mimic pathologic tauopathy-associated PTMs contribute to cryptic, stress-inducible phenotypes that evolve with age. These findings and their relationship to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

scholarly journals Alzheimer’s disease-relevant tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail VW Johnson ◽  
Keith Nehrke
Keyword(s):  
Alzheimer’S Disease ◽  
Alzheimer's Disease ◽  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

ABSTRACTBackgroundA defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear.MethodsHuman 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E and T231A, to mimic phosphorylation and phospho-ablation of a commonly observed pathological epitope, respectively, and K274/281Q, to mimic disease-associated lysine acetylation. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age, and genetically-encoded fluorescent biosensors were used to measure the morphological dynamics and turnover of touch neuron mitochondria.ResultsUnlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage mitophagy in response to mitochondrial stress.ConclusionsLimiting the expression of tau results in a genetic model where pathological modifications and age result in evolving phenotypes, which may more closely resemble the normal progression of AD. The finding that disease-associated PTMs suppress compensatory responses to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

scholarly journals Calcineurin homologous proteins regulate the membrane localization and activity of sodium/proton exchangers in C. elegans

2016 ◽  
Vol 310 (3) ◽  
pp. C233-C242 ◽  
Author(s):  
Erik Allman ◽  
Qian Wang ◽  
Rachel L. Walker ◽  
Molly Austen ◽  
Maureen A. Peters ◽  
...  
Keyword(s):  
Genetic Model ◽  
Expression Patterns ◽  
Critical Role ◽  
Model Organism ◽  
Loss Of Function ◽  
Homologous Proteins ◽  
Relative Significance ◽  
C Elegans ◽  
Fluorescent Tags

Calcineurin B homologous proteins (CHP) are N-myristoylated, EF-hand Ca2+-binding proteins that bind to and regulate Na+/H+ exchangers, which occurs through a variety of mechanisms whose relative significance is incompletely understood. Like mammals, Caenorhabditis elegans has three CHP paralogs, but unlike mammals, worms can survive CHP loss-of-function. However, mutants for the CHP ortholog PBO-1 are unfit, and PBO-1 has been shown to be required for proton signaling by the basolateral Na+/H+ exchanger NHX-7 and for proton-coupled intestinal nutrient uptake by the apical Na+/H+ exchanger NHX-2. Here, we have used this genetic model organism to interrogate PBO-1's mechanism of action. Using fluorescent tags to monitor Na+/H+ exchanger trafficking and localization, we found that loss of either PBO-1 binding or activity caused NHX-7 to accumulate in late endosomes/lysosomes. In contrast, NHX-2 was stabilized at the apical membrane by a nonfunctional PBO-1 protein and was only internalized following its complete loss. Additionally, two pbo-1 paralogs were identified, and their expression patterns were analyzed. One of these contributed to the function of the excretory cell, which acts like a kidney in worms, establishing an alternative model for testing the role of this protein in membrane transporter trafficking and regulation. These results lead us to conclude that the role of CHP in Na+/H+ exchanger regulation differs between apical and basolateral transporters. This further emphasizes the importance of proper targeting of Na+/H+ exchangers and the critical role of CHP family proteins in this process.

scholarly journals Long-term activity drives dendritic branch elaboration of a C. elegans sensory neuron

2019 ◽  
Author(s):  
Jesse A Cohn ◽  
Elizabeth R Cebul ◽  
Giulio Valperga ◽  
Mario de Bono ◽  
Maxwell G Heiman ◽  
...  
Keyword(s):  
Sensory Neuron ◽  
Neuronal Activity ◽  
Morphological Changes ◽  
Model Organism ◽  
Neuronal Morphology ◽  
Sensory Transduction ◽  
Central Component ◽  
C Elegans ◽  
Activity Dependent

ABSTRACTNeuronal activity often leads to alterations in gene expression and cellular architecture. The nematode Caenorhabditis elegans, owing to its compact translucent nervous system, is a powerful system in which to study conserved aspects of the development and plasticity of neuronal morphology. Here we focus on one sensory neuron in the worm, termed URX, which senses oxygen and signals tonically proportional to environmental oxygen. Previous studies have reported that URX has variable branched endings at its dendritic sensory tip. By controlling oxygen levels and analyzing mutants, we found that these branched endings grow over time as a consequence of neuronal activity. Furthermore, we observed that the branches contain microtubules, but do not appear to harbor the guanylyl cyclase GCY-35, a central component of the oxygen sensory transduction pathway. Interestingly, we found that although URX dendritic tips grow branches in response to long-term activity, the degree of branch elaboration does not correlate with oxygen sensitivity at the cellular or the behavioral level. Given the strengths of C. elegans as a model organism, URX may serve as a potent system for uncovering genes and mechanisms involved in activity-dependent morphological changes in neurons.

scholarly journals Mitochondrial Deficits With Neural and Social Damage in Early-Stage Alzheimer’s Disease Model Mice

2021 ◽  
Vol 13 ◽  
Author(s):  
Afzal Misrani ◽  
Sidra Tabassum ◽  
Qingwei Huo ◽  
Sumaiya Tabassum ◽  
Jinxiang Jiang ◽  
...  
Keyword(s):  
Alzheimer’S Disease ◽  
Alzheimer's Disease ◽  
Neurodegenerative Disorder ◽  
Early Stage ◽  
Mitochondrial Dynamics ◽  
Mitochondrial Fission ◽  
Neuronal Morphology ◽  
Therapeutic Interventions ◽  
Early Event ◽  
Mitochondrial Morphology

Alzheimer’s disease (AD) is the most common neurodegenerative disorder worldwide. Mitochondrial dysfunction is thought to be an early event in the onset and progression of AD; however, the precise underlying mechanisms remain unclear. In this study, we investigated mitochondrial proteins involved in organelle dynamics, morphology and energy production in the medial prefrontal cortex (mPFC) and hippocampus (HIPP) of young (1∼2 months), adult (4∼5 months) and aged (9∼10, 12∼18 months) APP/PS1 mice. We observed increased levels of mitochondrial fission protein, Drp1, and decreased levels of ATP synthase subunit, ATP5A, leading to abnormal mitochondrial morphology, increased oxidative stress, glial activation, apoptosis, and altered neuronal morphology as early as 4∼5 months of age in APP/PS1 mice. Electrophysiological recordings revealed abnormal miniature excitatory postsynaptic current in the mPFC together with a minor connectivity change between the mPFC and HIPP, correlating with social deficits. These results suggest that abnormal mitochondrial dynamics, which worsen with disease progression, could be a biomarker of early-stage AD. Therapeutic interventions that improve mitochondrial function thus represent a promising approach for slowing the progression or delaying the onset of AD.

scholarly journals The Detection of Early Epigenetic Inheritance of Mitochondrial Stress in C. Elegans with a Microfluidic Phenotyping Platform

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
H. B. Atakan ◽  
K. S. Hof ◽  
M. Cornaglia ◽  
J. Auwerx ◽  
M. A. M. Gijs
Keyword(s):  
Dna Sequence ◽  
Drug Exposure ◽  
Model Organism ◽  
Epigenetic Inheritance ◽  
Short Term ◽  
Mitochondrial Stress ◽  
New Device ◽  
C Elegans ◽  
Short Lifespan ◽  
Depth Analysis

AbstractFluctuations and deterioration in environmental conditions potentially have a phenotypic impact that extends over generations. Transgenerational epigenetics is the defined term for such intergenerational transient inheritance without an alteration in the DNA sequence. The model organism Caenorhabditis elegans is exceptionally valuable to address transgenerational epigenetics due to its short lifespan, well-mapped genome and hermaphrodite behavior. While the majority of the transgenerational epigenetics on the nematodes focuses on generations-wide heritage, short-term and in-depth analysis of this phenomenon in a well-controlled manner has been lacking. Here, we present a novel microfluidic platform to observe mother-to-progeny heritable transmission in C. elegans at high imaging resolution, under significant automation, and enabling parallelized studies. After approximately 24 hours of culture of L4 larvae under various concentrations and application periods of doxycycline, we investigated if mitochondrial stress was transferred from the mother nematodes to the early progenies. Automated and custom phenotyping algorithms revealed that a minimum doxycycline concentration of 30 µg/mL and a drug exposure time of 15 hours applied to the mothers could induce mitochondrial stress in first embryo progenies indeed, while this inheritance was not clearly observed later in L1 progenies. We believe that our new device could find further usage in transgenerational epigenetic studies modeled on C. elegans.

Take a Walk to the Wild Side of Caenorhabditis elegans-Pathogen Interactions

2021 ◽  
Vol 85 (2) ◽  
Author(s):  
Leah J. Radeke ◽  
Michael A. Herman
Keyword(s):  
Innate Immunity ◽  
Caenorhabditis Elegans ◽  
Recent Work ◽  
Genetic Model ◽  
Model Organism ◽  
Bacterial Pathogen ◽  
Content Type ◽  
Microbiome Composition ◽  
C Elegans ◽  
Functional Studies

SUMMARY Microbiomes form intimate functional associations with their hosts. Much has been learned from correlating changes in microbiome composition to host organismal functions. However, in-depth functional studies require the manipulation of microbiome composition coupled with the precise interrogation of organismal physiology—features available in few host study systems. Caenorhabditis elegans has proven to be an excellent genetic model organism to study innate immunity and, more recently, microbiome interactions. The study of C. elegans-pathogen interactions has provided in depth understanding of innate immune pathways, many of which are conserved in other animals. However, many bacteria were chosen for these studies because of their convenience in the lab setting or their implication in human health rather than their native interactions with C. elegans. In their natural environment, C. elegans feed on a variety of bacteria found in rotting organic matter, such as rotting fruits, flowers, and stems. Recent work has begun to characterize the native microbiome and has identified a common set of bacteria found in the microbiome of C. elegans. While some of these bacteria are beneficial to C. elegans health, others are detrimental, leading to a complex, multifaceted understanding of bacterium-nematode interactions. Current research on nematode-bacterium interactions is focused on these native microbiome components, both their interactions with each other and with C. elegans. We will summarize our knowledge of bacterial pathogen-host interactions in C. elegans, as well as recent work on the native microbiome, and explore the incorporation of these bacterium-nematode interactions into studies of innate immunity and pathogenesis.

scholarly journals Retroviral origins of theCaenorhabditis elegansorphan gene F58H7.5

2016 ◽  
Author(s):  
Wadim J Kapulkin
Keyword(s):  
Genetic Model ◽  
Genetic Research ◽  
Model Organism ◽  
Endogenous Retrovirus ◽  
Long Terminal Repeats ◽  
Orphan Gene ◽  
C Elegans ◽  
Infection Event ◽  
New Gene ◽  
Genome Scale

AbstractThis work describes the results of the genome-scale analysis of endogenous retrovirus insertions in twoC. elegansisolates: the prototype N2 (Bristol) and CB4856 (Hawaii). In total thirteen, identification of potentially replication competent, endogenous retroviral elements is described. Ten elements were identified as conserved between N2 and CB4856 by the reciprocal match of paired LTRs. The description focuses on the particular endogenous retrovirus insertion wich is identified on the proximal arm of the chromosome IV (located at positions IV: 912,948 – 921,658 and IV: 899,767 – 908,485 of the N2 and CB4856 respectively). In both isolates the inserted provirus is flanked by the predicted long terminal repeats (LTR)s of the length of 415 bp and of identical sequence. Provided the absolute LTR sequence identity this particular provirus represents insertion acquired prior to split from the common ancestor, suggesting this insertion event is evolutionary recent. The identified insertion of the endogenous retrovirus embeds the orphan gene F58H7.5, specific toC. eleganslineage. This unprecedented example establishes that in the evolutionary pastC. elegans, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.ImportanceThis work describes the retroviral origins ofC. elegansorphan gene F58H7.5. Presented work implies that in the evolutionary past theC. eleganshave acquired new gene as a result of the infection event.C. elegansis presently regarded as genetic model organism widely used in genetic research. The genome ofC. eleganshave been sequenced nearly 20 years ago. This unprecedented example establishes that in the evolutionary past C. elegans genome, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.

scholarly journals High-Content C. elegans Screen Identifies Natural Compounds Impacting Mitochondria-Lipid Homeostasis and Promoting Healthspan

Cells ◽  
2021 ◽  
Vol 11 (1) ◽  
pp. 100
Author(s):  
Silvia Maglioni ◽  
Nayna Arsalan ◽  
Anna Hamacher ◽  
Shiwa Afshar ◽  
Alfonso Schiavi ◽  
...  
Keyword(s):  
Stress Response ◽  
Lipid Content ◽  
Model Organism ◽  
Natural Compounds ◽  
Extrinsic Factors ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Stress Response Genes ◽  
Age Related ◽  
Kahalalide F

The aging process is concurrently shaped by genetic and extrinsic factors. In this work, we screened a small library of natural compounds, many of marine origin, to identify novel possible anti-aging interventions in Caenorhabditis elegans, a powerful model organism for aging studies. To this aim, we exploited a high-content microscopy platform to search for interventions able to induce phenotypes associated with mild mitochondrial stress, which is known to promote animal’s health- and lifespan. Worms were initially exposed to three different concentrations of the drugs in liquid culture, in search of those affecting animal size and expression of mitochondrial stress response genes. This was followed by a validation step with nine compounds on solid media to refine compounds concentration, which led to the identification of four compounds (namely isobavachalcone, manzamine A, kahalalide F and lutein) consistently affecting development, fertility, size and lipid content of the nematodes. Treatment of Drosophila cells with the four hits confirmed their effects on mitochondria activity and lipid content. Out of these four, two were specifically chosen for analysis of age-related parameters, kahalalide F and lutein, which conferred increased resistance to heat and oxidative stress and extended animals’ healthspan. We also found that, out of different mitochondrial stress response genes, only the C. elegans ortholog of the synaptic regulatory proteins neuroligins, nlg-1, was consistently induced by the two compounds and mediated lutein healthspan effects.

scholarly journals Recombinant DNA resources for the comparative genomics ofAncylostoma ceylanicum

2016 ◽  
Author(s):  
Wadim J. Kapulkin ◽  
Adriana Magalska ◽  
Ewa Janecka ◽  
Arkadiusz Ciesielski ◽  
Malgorzata Lobocka ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Developmental Stages ◽  
Recombinant Dna ◽  
Genomic Library ◽  
Genetic Model ◽  
Model Organism ◽  
General Interest ◽  
Ancylostoma Ceylanicum ◽  
Free Living ◽  
C Elegans

AbstractWe describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm,Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematodeC. elegansandA. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organismC. elegansand closely related parasitic species. We discuss the potential and relevance ofAncylostoma ceylanicumdata and resources generated by the recombinant DNA approach.

scholarly journals Healthspan Enhancement by Olive Polyphenols in C. elegans Wild Type and Parkinson’s Models

2020 ◽  
Vol 21 (11) ◽  
pp. 3893 ◽  
Author(s):  
Gabriele Di Rosa ◽  
Giovanni Brunetti ◽  
Maria Scuto ◽  
Angela Trovato Salinaro ◽  
Edward J. Calabrese ◽  
...  
Keyword(s):  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Full Potential ◽  
Wild Type ◽  
Motor Impairments ◽  
C Elegans ◽  
Beneficial Effects ◽  
Swim Performance ◽  
Polyphenolic Extract ◽  
Health Promoting

Parkinson’s disease (PD) is the second most prevalent late-age onset neurodegenerative disorder, affecting 1% of the population after the age of about 60 years old and 4% of those over 80 years old, causing motor impairments and cognitive dysfunction. Increasing evidence indicates that Mediterranean diet (MD) exerts beneficial effects in maintaining health, especially during ageing and by the prevention of neurodegenerative disorders. In this regard, olive oil and its biophenolic constituents like hydroxytyrosol (HT) have received growing attention in the past years. Thus, in the current study we test the health-promoting effects of two hydroxytyrosol preparations, pure HT and Hidrox® (HD), which is hydroxytyrosol in its “natural” environment, in the established invertebrate model organism Caenorhabditis elegans. HD exposure led to much stronger beneficial locomotion effects in wild type worms compared to HT in the same concentration. Consistent to this finding, in OW13 worms, a PD-model characterized by α-synuclein expression in muscles, HD exhibited a significant higher effect on α-synuclein accumulation and swim performance than HT, an effect partly confirmed also in swim assays with the UA44 strain, which features α-synuclein expression in DA-neurons. Interestingly, beneficial effects of HD and HT treatment with similar strength were detected in the lifespan and autofluorescence of wild-type nematodes, in the neuronal health of UA44 worms as well as in the locomotion of rotenone-induced PD-model. Thus, the hypothesis that HD features higher healthspan-promoting abilities than HT was at least partly confirmed. Our study demonstrates that HD polyphenolic extract treatment has the potential to partly prevent or even treat ageing-related neurodegenerative diseases and ageing itself. Future investigations including mammalian models and human clinical trials are needed to uncover the full potential of these olive compounds.

Sign in / Sign up

Export Citation Format

Share Document