scholarly journals Mechanism of IRSp53 inhibition by 14-3-3

2018 ◽  
Author(s):  
David J. Kast ◽  
Roberto Dominguez
Keyword(s):  
Conformational Changes ◽  
Dendritic Spines ◽  
Mammalian Cells ◽  
Neuronal Development ◽  
Rho Gtpase ◽  
Phosphorylation Sites ◽  
Binding Studies ◽  
Bar Domain ◽  
Dependent Inhibition ◽  
Bicistronic Expression

AbstractFilopodia are precursors of dendritic spines and polarized cell migration. The I-BAR-domain protein IRSp53 is an essential regulator of filopodia dynamics that couples Rho-GTPase signaling to cytoskeleton and membrane remodeling, playing essential roles in neuronal development and cell motility. Here, we describe a mechanism whereby phosphorylation-dependent inhibition of IRSp53 by 14-3-3 counters membrane binding and activation by Cdc42 or downstream cytoskeletal effectors. Phosphoproteomics, quantitative binding studies and crystal structures show that 14-3-3 binds to two pairs of phosphorylation sites in IRSp53. Using bicistronic expression we obtained a heterodimer of IRSp53 in which only one subunit is phosphorylated, and show that each subunit of the IRSp53 dimer independently binds a 14-3-3 dimer. A FRET-sensor assay developed using natively phosphorylated and 14-3-3-binding competent IRSp53 purified from mammalian cells reveals opposite conformational changes in IRSp53 upon binding of activatory (Cdc42, Eps8) vs. inhibitory (14-3-3) inputs.

scholarly journals IRSp53 coordinates AMPK and 14-3-3 signaling to regulate filopodia dynamics and directed cell migration

2019 ◽  
Vol 30 (11) ◽  
pp. 1285-1297 ◽  
Author(s):  
David J. Kast ◽  
Roberto Dominguez
Keyword(s):  
Cell Migration ◽  
Cancer Cell ◽  
Rho Gtpase ◽  
Cell Communication ◽  
Phosphorylation Sites ◽  
Bar Domain ◽  
Directed Cell Migration ◽  
Downstream Effectors ◽  
Dependent Inhibition ◽  
Membrane Protrusions

Filopodia are actin-filled membrane protrusions that play essential roles in cell motility and cell–cell communication and act as precursors of dendritic spines. IRSp53 is an essential regulator of filopodia formation, which couples Rho-GTPase signaling to actin cytoskeleton and membrane remodeling. IRSp53 has three major domains: an N-terminal inverse-BAR (I-BAR) domain, a Cdc42- and SH3-binding CRIB-PR domain, and an SH3 domain that binds downstream cytoskeletal effectors. Phosphorylation sites in the region between the CRIB-PR and SH3 domains mediate the binding of 14-3-3. Yet the mechanism by which 14-­3-3 regulates filopodia formation and dynamics and its role in cell migration are poorly understood. Here, we show that phosphorylation-dependent inhibition of IRSp53 by 14-3-3 counters activation by Cdc42 and cytoskeletal effectors, resulting in down-regulation of filopodia dynamics and cancer cell migration. In serum-starved cells, increased IRSp53 phosphorylation triggers 14-3-3 binding, which inhibits filopodia formation and dynamics, irrespective of whether IRSp53 is activated by Cdc42 or downstream effectors (Eps8, Ena/VASP). Pharmacological activation or inhibition of AMPK, respectively, increases or decreases the phosphorylation of two of three sites in IRSp53 implicated in 14-3-3 binding. Mutating these phosphorylation sites reverses 14-3-3-dependent inhibition of filopodia dynamics and cancer cell chemotaxis.

scholarly journals PAK4 Kinase Is Essential for Embryonic Viability and for Proper Neuronal Development

2003 ◽  
Vol 23 (20) ◽  
pp. 7122-7133 ◽  
Author(s):  
Jian Qu ◽  
Xiaofan Li ◽  
Bennet G. Novitch ◽  
Ye Zheng ◽  
Matthew Kohn ◽  
...  
Keyword(s):  
Motor Neurons ◽  
Neural Tube ◽  
Mammalian Cells ◽  
Neuronal Development ◽  
Rho Gtpase ◽  
Serine Threonine Kinase ◽  
Cytoskeletal Organization ◽  
Threonine Kinase ◽  
Caudal Portion ◽  
Neural Tube Development

ABSTRACT The serine/threonine kinase PAK4 is a target for the Rho GTPase Cdc42 and has been shown to regulate cell morphology and cytoskeletal organization in mammalian cells. To examine the physiological and developmental functions of PAK4, we have disrupted the PAK4 gene in mice. The absence of PAK4 led to lethality by embryonic day 11.5, a result most likely due to a defect in the fetal heart. Striking abnormalities were also evident in the nervous systems of PAK4-deficient embryos. These embryos had dramatic defects in neuronal development and axonal outgrowth. In particular, spinal cord motor neurons and interneurons failed to differentiate and migrate to their proper positions. This is probably related to the role for PAK4 in the regulation of cytoskeletal organization and cell and/or extracellular matrix adhesion. PAK4-null embryos also had defects in proper folding of the caudal portion of the neural tube, suggesting an important role for PAK4 in neural tube development.

Cytokinesis arrest and redistribution of actin-cytoskeleton regulatory components in cells expressing the Rho GTPase CDC42Hs

1996 ◽  
Vol 109 (2) ◽  
pp. 367-377 ◽  
Author(s):  
H. Dutartre ◽  
J. Davoust ◽  
J.P. Gorvel ◽  
P. Chavrier
Keyword(s):  
Actin Cytoskeleton ◽  
Rho Gtpases ◽  
Mammalian Cells ◽  
Laser Scanning ◽  
Rho Gtpase ◽  
Laser Scanning Microscopy ◽  
Regulatory Subunit ◽  
Confocal Laser ◽  
Complex Architectures ◽  
Immunofluorescence Labelling

In mammalian cells, Rho GTPases control the reorganisation of the actin cytoskeleton in response to growth factors. In the cytoplasm, the polymerisation of actin filaments and their organisation into complex architectures is orchestrated by numerous proteins which act either directly, by interacting with actin, or by producing secondary messengers which serve as mediators between signal transduction pathways and the microfilament organisation. We sought to determine whether the intracellular distribution of some of these regulatory components may be controlled by the Rho GTPase CDC42Hs. With this aim, we have established HeLa-derived human cell lines in which expression of a constitutively activated mutant of CDC42Hs is inducible. Morphological analysis by immunofluorescence labelling and confocal laser scanning microscopy revealed a massive reorganisation of F-actin in cortical microspikes as well as podosome-like structures located at the ventral face of the cells. Concomitantly, the cells became giant and multinucleate indicating that cytokinesis was impaired. The actin bundling protein T-plastin, the vasodilatator-stimulated phosphoprotein (VASP), a profilin ligand, as well as the 85 kDa regulatory subunit of the phosphoinosite 3-kinase redistributed with F-actin into the CDC42Hs-induced structures.

scholarly journals Phosphorylation of 20S proteasome alpha subunit C8 (alpha7) stabilizes the 26S proteasome and plays a role in the regulation of proteasome complexes by gamma-interferon

2004 ◽  
Vol 378 (1) ◽  
pp. 177-184 ◽  
Author(s):  
Suchira BOSE ◽  
Fiona L. L. STRATFORD ◽  
Kerry I. BROADFOOT ◽  
Grant G. F. MASON ◽  
A. Jennifer RIVETT
Keyword(s):  
Mammalian Cells ◽  
Substantial Effect ◽  
26S Proteasome ◽  
20S Proteasome ◽  
Phosphorylation Sites ◽  
Animal Cells ◽  
Catalytic Subunits ◽  
Kinase Ck2 ◽  
Γ Interferon

In animal cells there are several regulatory complexes which interact with 20S proteasomes and give rise to functionally distinct proteasome complexes. γ-Interferon upregulates three immuno beta catalytic subunits of the 20S proteasome and the PA28 regulator, and decreases the level of 26S proteasomes. It also decreases the level of phosphorylation of two proteasome alpha subunits, C8 (α7) and C9 (α3). In the present study we have investigated the role of phosphorylation of C8 by protein kinase CK2 in the formation and stability of 26S proteasomes. An epitope-tagged C8 subunit expressed in mammalian cells was efficiently incorporated into both 20S proteasomes and 26S proteasomes. Investigation of mutants of C8 at the two known CK2 phosphorylation sites demonstrated that these are the two phosphorylation sites of C8 in animal cells. Although phosphorylation of C8 was not absolutely essential for the formation of 26S proteasomes, it did have a substantial effect on their stability. Also, when cells were treated with γ-interferon, there was a marked decrease in phosphorylation of C8, a decrease in the level of 26S proteasomes, and an increase in immunoproteasomes and PA28 complexes. These results suggest that the down-regulation of 26S proteasomes after γ-interferon treatment results from the destabilization that occurs after dephosphorylation of the C8 subunit.

scholarly journals Mutational Analysis of the Cy Motif from p21 Reveals Sequence Degeneracy and Specificity for Different Cyclin-Dependent Kinases

2001 ◽  
Vol 21 (15) ◽  
pp. 4868-4874 ◽  
Author(s):  
James A. Wohlschlegel ◽  
Brian T. Dwyer ◽  
David Y. Takeda ◽  
Anindya Dutta
Keyword(s):  
Inhibitory Activity ◽  
Mammalian Cells ◽  
Mutational Analysis ◽  
Cyclin E ◽  
Cyclin A ◽  
Binding Motif ◽  
Binding Studies ◽  
Alanine Scanning Mutagenesis ◽  
Cyclin Dependent Kinases

ABSTRACT Inhibitors, activators, and substrates of cyclin-dependent kinases (cdks) utilize a cyclin-binding sequence, known as a Cy or RXL motif, to bind directly to the cyclin subunit. Alanine scanning mutagenesis of the Cy motif of the cdk inhibitor p21 revealed that the conserved arginine or leucine (constituting the conserved RXL sequence) was important for p21's ability to inhibit cyclin E-cdk2 activity. Further analysis of mutant Cy motifs showed, however, that RXL was neither necessary nor sufficient for a functional cyclin-binding motif. Replacement of either of these two residues with small hydrophobic residues such as valine preserved p21's inhibitory activity on cyclin E-cdk2, while mutations in either polar or charged residues dramatically impaired p21's inhibitory activity. Expressing p21N with non-RXL Cy sequences inhibited growth of mammalian cells, providing in vivo confirmation that RXL was not necessary for a functional Cy motif. We also show that the variant Cy motifs identified in this study can effectively target substrates to cyclin-cdk complexes for phosphorylation, providing additional evidence that these non-RXL motifs are functional. Finally, binding studies using p21 Cy mutants demonstrated that the Cy motif was essential for the association of p21 with cyclin E-cdk2 but not with cyclin A-cdk2. Taking advantage of this differential specificity toward cyclin E versus cyclin A, we demonstrate that cell growth inhibition was absolutely dependent on the ability of a p21 derivative to inhibit cyclin E-cdk2.

scholarly journals The eisosome core is composed of BAR domain proteins

2011 ◽  
Vol 22 (13) ◽  
pp. 2360-2372 ◽  
Author(s):  
Agustina Olivera-Couto ◽  
Martin Graña ◽  
Laura Harispe ◽  
Pablo S. Aguilar
Keyword(s):  
Plasma Membrane ◽  
Mammalian Cells ◽  
Site Directed Mutagenesis ◽  
Bar Domain ◽  
Macromolecular Assemblies ◽  
Surface Patches ◽  
Cytoplasmic Proteins ◽  
Associated Proteins ◽  
Core Components ◽  
Membrane Bending

Eisosomes define sites of plasma membrane organization. In Saccharomyces cerevisiae, eisosomes delimit furrow-like plasma membrane invaginations that concentrate sterols, transporters, and signaling molecules. Eisosomes are static macromolecular assemblies composed of cytoplasmic proteins, most of which have no known function. In this study, we used a bioinformatics approach to analyze a set of 20 eisosome proteins. We found that the core components of eisosomes, paralogue proteins Pil1 and Lsp1, are distant homologues of membrane-sculpting Bin/amphiphysin/Rvs (BAR) proteins. Consistent with this finding, purified recombinant Pil1 and Lsp1 tubulated liposomes and formed tubules when the proteins were overexpressed in mammalian cells. Structural homology modeling and site-directed mutagenesis indicate that Pil1 positively charged surface patches are needed for membrane binding and liposome tubulation. Pil1 BAR domain mutants were defective in both eisosome assembly and plasma membrane domain organization. In addition, we found that eisosome-associated proteins Slm1 and Slm2 have F-BAR domains and that these domains are needed for targeting to furrow-like plasma membrane invaginations. Our results support a model in which BAR domain protein–mediated membrane bending leads to clustering of lipids and proteins within the plasma membrane.

scholarly journals Regulation of Clathrin-Mediated Endocytosis

2018 ◽  
Vol 87 (1) ◽  
pp. 871-896 ◽  
Author(s):  
Marcel Mettlen ◽  
Ping-Hung Chen ◽  
Saipraveen Srinivasan ◽  
Gaudenz Danuser ◽  
Sandra L. Schmid
Keyword(s):  
Conformational Changes ◽  
Posttranslational Modifications ◽  
Mammalian Cells ◽  
Environmental Changes ◽  
Protein Complexes ◽  
Adaptor Protein ◽  
Endocytic Pathway ◽  
Coat Proteins ◽  
Membrane Composition ◽  
Coated Pits

Clathrin-mediated endocytosis (CME) is the major endocytic pathway in mammalian cells. It is responsible for the uptake of transmembrane receptors and transporters, for remodeling plasma membrane composition in response to environmental changes, and for regulating cell surface signaling. CME occurs via the assembly and maturation of clathrin-coated pits that concentrate cargo as they invaginate and pinch off to form clathrin-coated vesicles. In addition to the major coat proteins, clathrin triskelia and adaptor protein complexes, CME requires a myriad of endocytic accessory proteins and phosphatidylinositol lipids. CME is regulated at multiple steps—initiation, cargo selection, maturation, and fission—and is monitored by an endocytic checkpoint that induces disassembly of defective pits. Regulation occurs via posttranslational modifications, allosteric conformational changes, and isoform and splice-variant differences among components of the CME machinery, including the GTPase dynamin. This review summarizes recent findings on the regulation of CME and the evolution of this complex process.

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Functional Glyco-Nanogels for Multivalent Interaction with Lectins

Molecules ◽  
2019 ◽  
Vol 24 (10) ◽  
pp. 1865 ◽  
Author(s):  
Jo Sing Julia Tang ◽  
Sophia Rosencrantz ◽  
Lucas Tepper ◽  
Sany Chea ◽  
Stefanie Klöpzig ◽  
...  
Keyword(s):  
Pseudomonas Aeruginosa ◽  
Lectin Binding ◽  
Host Cells ◽  
Protecting Group ◽  
Reaction Parameters ◽  
Binding Studies ◽  
Huge Number ◽  
Dependent Inhibition ◽  
Tremendous Impact

Interactions between glycans and proteins have tremendous impact in biomolecular interactions. They are important for cell–cell interactions, proliferation and much more. Here, we emphasize the glycan-mediated interactions between pathogens and host cells. Pseudomonas aeruginosa, responsible for a huge number of nosocomial infections, is especially the focus when it comes to glycan-derivatives as pathoblockers. We present a microwave assisted protecting group free synthesis of glycomonomers based on lactose, melibiose and fucose. The monomers were polymerized in a precipitation polymerization in the presence of NiPAm to form crosslinked glyco-nanogels. The influence of reaction parameters like crosslinker type or stabilizer amount was investigated. The gels were characterized in lectin binding studies using model lectins and showed size and composition-dependent inhibition of lectin binding. Due to multivalent presentation of glycans in the gel, the inhibition was clearly stronger than with unmodified saccharides, which was compared after determination of the glycan loading. First studies with Pseudomonas aeruginosa revealed a surprising influence on the secretion of virulence factors. Functional glycogels may be in the future potent alternatives or adjuvants for antibiotic treatment of infections based on glycan interactions between host and pathogen.

G-actin conformational change and polymerization induced by paraquat

1998 ◽  
Vol 76 (4) ◽  
pp. 583-591 ◽  
Author(s):  
Isabella DalleDonne ◽  
Aldo Milzani ◽  
Roberto Colombo
Keyword(s):  
Conformational Changes ◽  
Mammalian Cells ◽  
Structural Changes ◽  
Cell Injury ◽  
Atp Hydrolysis ◽  
Protein Composition ◽  
Dnase I ◽  
Cross Linking ◽  
Cytoskeletal Protein ◽  
Actin Assembly

Paraquat (1,1´-dimethyl-4,4´-bipyridilium dichloride) is a broad-spectrum herbicide that is highly toxic to animals (including man), the major lesion being in the lung. In mammalian cells, paraquat causes deep alterations in the organization of the cytoskeleton, marked decreases in cytoskeletal protein synthesis, and alterations in cytoskeletal protein composition; therefore, the involvement of the cytoskeleton in cell injury by paraquat was suggested. We previously demonstrated that monomeric actin binds paraquat; moreover, prolonged actin exposure to paraquat, in depolymerizing medium, induces the formation of actin aggregates, which are built up by F-actin. In this work we have shown that the addition of paraquat to monomeric actin results in a strong quenching of Trp-79 and Trp-86 fluorescence. Trypsin digestion experiments demonstrated that the sequence 61-69 on actin subdomain 2 undergoes paraquat-dependent conformational changes. These paraquat-induced structural changes render actin unable to completely inhibit DNase I. By using intermolecular cross-linking to characterize oligomeric species formed during paraquat-induced actin assembly, we found that the herbicide causes the formation of actin oligomers characterized by subunit-subunit contacts like those occurring in oligomers induced by polymerizing salts (i.e., between subdomain 1 on one actin subunit and subdomain 4 on the adjacent subunit). Furthermore, the oligomerization of G-actin induced by paraquat is paralleled by ATP hydrolysis.Key words: actin, paraquat, subdomain 2, DNase I, ATP hydrolysis.

Sign in / Sign up

Export Citation Format

Share Document